Edited by: Yih-Cherng Liou, National University of Singapore, Singapore
Reviewed by: Qiang Wu, Macau University of Science and Technology, Macau; Canhua Huang, Sichuan University, China; Han-Ming Shen, National University of Singapore, Singapore
†These authors have contributed equally to this work and share first authorship
‡These authors share senior authorship
This article was submitted to Molecular and Cellular Oncology, a section of the journal Frontiers in Cell and Developmental Biology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
High human telomerase reverse transcriptase (hTERT) expression is related to severe Colorectal Cancer (CRC) progression and negatively related to CRC patient survival. Previous studies have revealed that hTERT can reduce cancer cellular reactive oxygen species (ROS) levels and accelerate cancer progression; however, the mechanism remains poorly understood. NFE2-related factor 2 (NRF2) is a molecule that plays a significant role in regulating cellular ROS homeostasis, but whether there is a correlation between hTERT and NRF2 remains unclear. Here, we showed that hTERT increases CRC proliferation and migration by inducing NRF2 upregulation. We further found that hTERT increases NRF2 expression at both the mRNA and protein levels. Our data also revealed that hTERT primarily upregulates NRF2 by increasing NRF2 promoter activity rather than by regulating NRF2 mRNA or protein stability. Using DNA pull-down/MS analysis, we found that hTERT can recruit YBX1 to upregulate NRF2 promoter activity. We also found that hTERT/YBX1 may localize to the P2 region of the NRF2 promoter. Taken together, our results demonstrate that hTERT facilitates CRC proliferation and migration by upregulating NRF2 expression through the recruitment of the transcription factor YBX1 to activate the NRF2 promoter. These results provide a new theoretical basis for CRC treatment.
Colorectal cancer (CRC) is the third most frequently occurring carcinoma and the second most common cause of cancer-related death in the world (
Human telomerase reverse transcriptase (hTERT) is an important component of human telomerase that synthesizes telomeric DNA to maintain and increase telomere length, ultimately leading to cellular immortality (
NFE2-related factor 2 (NRF2) is a transcription factor that principally maintains the cellular ROS balance and plays dual roles in cancer proliferation, invasion and cell differentiation (
In the present study, we aimed to investigate the mechanism by which hTERT regulates NRF2 to enhance the proliferation and migration of CRC cells. We demonstrate that hTERT can act as a co-activator to recruit the transcriptional factor YBX1 to the promoter region of NRF2 to increase its expression, ultimately promoting proliferation and migration of CRC cells. Our findings provide novel insights into the crucial role of hTERT in the progression of CRC and may provide a new theoretical basis for the prevention and treatment of CRC.
The colon cancer cell lines RKO, HCT116, and sw620 were obtained from the Chinese Academy of Sciences (Shanghai, China) and cultivated in high-glucose DMEM (HyClone, Waltham, MA, United States) with 100 units/ml penicillin, 100 g/ml streptomycin, and 10% FBS at 37°C in an atmosphere of 5% CO2.
Total RNA was extracted from the frozen tissues and cell lines using RNAiso Plus reagent (TaKaRa, Dalian, China) according to the manufacturer’s protocol. Reverse transcription was performed using PrimeScript RT Master Mix (TaKaRa, Dalian, China) according to the manufacturer’s instructions. Then, the expression of target genes was determined with a SYBR Premix Ex Taq II Kit (TaKaRa, Dalian, China) and a Step OnePlus system (Applied Biosystems, Forster City, CA, United States). The experimental settings were as follows: hold 95°C 10 min; cycling (95°C for 30 s; 56°C for 30 s; 72°C for 30 s with fluorescence measurement for 40 cycles). The 2−ΔΔCt method was applied to detect fold changes. The primer sequences used for quantitative real-time polymerase chain reaction (qRT-PCR) are listed in
Primer sequences used in this paper.
Primers | Sequences | Application | Company |
hTERT-F | 5′ GCCGATTGTGAACATGGACTACG 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
hTERT-R | 5′ GCTCGTAGTTGAGCACGCTGAA 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
NRF2-F | 5′ CGCTTGGAGGCTCATCTCAC 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
NRF2-R | 5′ TGCAATTCTGAGCAGCCACT 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
GAPDH-F | 5′ GTCTCCTCTGACTTCAACAGCG 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
GAPDH-R | 5′ ACCACCCTGTTGCTGTAGCCAA 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
NRF2 promoter-F | 5′ TTCTGCCGGTCTTGCTTACAGT 3′ | PCR | Sangon Biotech, Shanghai, China |
NRF2 promoter-R | 5′ GGAGTTGCAGAACCTTGCCC 3′ | PCR | Sangon Biotech, Shanghai, China |
ILF3-F | 5′ GATGGTTCTGGCATTTATGACC 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
ILF3-R | 5′ CTCTGTGTGATATCTTCCCGTT 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
XRCC5-F | 5′ GTGCGGTCGGGGAATAAGG 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
XRCC5-R | 5′ GGGGATTCTATACCAGGAATGGA 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
YBX1-F | 5′ GGGGACAAGAAGGTCATCGC 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
YBX1-R | 5′ CGAAGGTACTTCCTGGGGTTA 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
P1-F | 5′ TTGGCAGATTGGAGCACAAAGGAG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P1-R | 5′ AGCCTGGCGACAGAGTGAGAC 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-F | 5′ ACTGCAACCTCCGCCTCCTG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-R | 5′ CCAACGTGGTGAAACCCTGTCTC 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P3-F | 5′ GGGCAAAGCAAGGGCTCAGG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P3-R | 5′ TCTCAAGACCACCCACGTCAAGG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P4-F | 5′ ATCCTGGGAGTGTCAAATTATGCA 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P4-R | 5′ AACCACACACACACCCCTGA 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P5-F | 5′ ACTGACCACTCTCCGACCTAAAGG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P5-R | 5′ TGAACGCCCTCCTCTGAACTCC 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-1-F | 5′ CCTCCTGGGTTCAAGCAATTCTCC 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-2-R | 5′ CAACGTGGTGAAACCCTGTCTCTAC 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-2-F | 5′CCAAAGTGCTGGGATTATAGGCGTTA3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-2-R | 5′TTGTGATACCTTGCTCCAGATTGCTC3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-3-F | 5′ ATGAGCAATCTGGAGCAAGGTATCAC3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-3-R | 5′ CCTGAATCATTTGCTGTCTTTGGGAA3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-4-F | 5′ GAAGGCCGTCTTCCCAAAGA 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-4-R | 5′ CTCCTGTCTTGCTGCCATGG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-5-F | 5′ AACCAGCACCTCCTCTTTCTTGTTC3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
P2-5-R | 5′ CCCTCCAAACCTGCCTATTGTGTTAG 3′ | ChIP-qPCR | Sangon Biotech, Shanghai, China |
GSTA2-F | 5′ TACTCCAATATACGGGGCAGAA 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
GSTA2-R | 5′ TCCTCAGGTTGACTAAAGGGC 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
GCS-F | 5′ GGAAGTGGATGTGGACACCAGATG 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
GCS-R | 5′ ACACTGTCTTGCTTGTAGTCAGGATG 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
HO-1-F | 5′ CCACCAAGTTCAAGCAGCTCTACC 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
HO-1-R | 5′ ATGTTGAGCAGGAACGCAGTCTTG 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
NQO-1-F | 5′ AAGCCGCAGACCTTGTGATATTCC 3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
NQO-1-R | 5′ CTCTCCTATGAACACTCGCTCAAACC3′ | qRT-PCR | Sangon Biotech, Shanghai, China |
Cells were lysed with RIPA (Beyotime, Beijing, China) on ice for 30 min, and then, cell lysates were centrifuged at the highest speed; the protein was in the supernatant. Next, protein concentration was analyzed using a BCA Protein Assay Kit (Beyotime, Beijing, China). Forty micrograms of each protein sample was separated via SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (GE Healthcare, United Kingdom). Next, the PVDF membranes were incubated with 5% BSA, followed by incubations with primary and secondary antibodies. Finally, the protein bands were visualized with GeneSnap using a SynGene system (Shanghai, China).
All transfections were carried out in Opti-MEM (Gibco, Brooklyn, NY, United States) using Lipofectamine 3000 (Gibco, Brooklyn, NY, United States). After 48 h, cells were harvested for subsequent analysis. Lentiviruses were used to transduce cells according to the manufacturer’s instructions. Plasmids were obtained from Sangon (Shanghai, China). siRNAs were from RIBOBIO (Guangzhou, China). Lentiviruses were from GenePharma (Shanghai, China) and GeneChem (Shanghai, China).
Cells were harvested after transfection with plasmids or siRNAs. Then, the cells were washed with PBS, resuspended in DMEM and plated into 96-well plates at a concentration of 3000 cells/well. Next, CCK-8 reagent (MCE, Shanghai, China) was added to the wells according to the manufacturer’s instructions. Optical density at 450 nm was measured using a microplate reader (Bio-Rad, Hercules, CA, United States) to assess cell viability.
Cells were harvested after transfection with plasmids or siRNAs. Then, the cells were washed with PBS, resuspended in DMEM and plated into six-well plates at a concentration of 500 cells/well. After 10 days, colonies were immobilized on the plates with 4% triformol for 20 min, stained with 0.5% crystal violet for 30 min and counted using ImageJ software.
Migration assays were performed to analyze cellular migration and invasion abilities. First, cells were harvested after transfection with plasmids or siRNAs. Then, the cells were washed with PBS and resuspended in DMEM without fetal bovine serum. Medium with 10% fetal bovine serum was added into the lower chambers, followed by the addition of 200 μL serum-free DMEM containing 5 × 104 cells into the upper chambers. For invasion assays, matrigel matrix (Corning, Toledo, OH, United States) was injected into the chambers before cells addition. After 24–48 h, the migrating and invading cells were immobilized on chambers with 4% triformol for 20 min. Then, attached cells were stained with 0.5% crystal violet for 30 min, and the cell migration and invasion ability were evaluated through digital imaging of the cells.
Cells were seeded in 24-well plates at an appropriate concentration on the first day. Cells were transfected with plasmids, Renilla luciferase vector and siRNAs at an appropriate ratio on the second day. After 48 h, cells were washed with PBS and lysed in passive lysis buffer. The activities of firefly and Renilla luciferases were measured by using a Dual Luciferase Reporter Assay System (Promega, Madison, WI, United States) according to the manufacturer’s protocol. The luminescence intensities of firefly and Renilla luciferases were recorded using a microplate reader. The results are presented as relative firefly luciferase activity after normalization to the internal control Renilla luciferase activity. All results were obtained from at least three independent experiments.
The NRF2 promoter region located at 3000 bp upstream of the transcription initiation sites was amplified via PCR using a 5-biotin-labeled forward primer. The primer sequences were as follows: forward primer, reverse primer. The 5-biotinylated DNA of the 5-flanking region of the NRF2 promoter was immobilized to streptavidin beads following the manufacturer’s protocol (Dynabeads® kilobase BINDERTM kit, Invitrogen Dynal AS, Oslo, Norway). Proteins in the nuclear fraction were incubated with 5-biotinylated DNA beads on a rotating shaker at 4°C overnight. Following this incubation, the supernatant was removed. The beads were washed three times with cold PBS. After the last wash, the pull-down mixture was resuspended in distilled water at 70°C for 3 min to break the bond between streptavidin and biotin. The proteins eluted from the beads were subjected to WB and MS analyses. The proteins eluted from the beads without the biotinylated DNA probe were used as a control.
Cells were harvested, and the proteins were extracted, quantified as previously described and then incubated with antibodies and protein A/G beads for IP testing using a co-immunoprecipitation (Co-IP) kit (Active Motif, Carlsbad, CA, United States) according to the manufacturer’s instructions. Immunoprecipitated proteins were detected via western blotting. The antibodies used are listed in
Antibodies used in this paper.
Antibodies | Catalog number | Application | Company |
Anti-Telomerase reverse transcriptase | ab32020 | WB, IP,I F, IHC | Abcam, Cambridge, MA, United States |
NRF2 (D1Z9C) XP® Rabbit mAb | 12721S | WB, ChIP | Cell Signaling Technology, United States |
Anti-Nrf2[EP1808Y] | ab62352 | WB, IHC | Abcam, Cambridge, MA, United States |
YBX1 Polyclonal Antibody | 20339-1-AP | IHC, WB | ProteinTech, Wuhan, China |
Anti-YB1 antibody [4F12] | ab219070 | IF | Abcam, Cambridge, MA, United States |
Anti-GAPDH [EPR16891] | Ab181602 | WB | Abcam, Cambridge, MA, United States |
Chromatin immunoprecipitation (ChIP) assays were performed according to the manufacturer’s protocol (CST, Boston, MA, United States). The percentage of bound DNA was quantified against the original DNA input. Specific primers were designed to amplify the NRF2 promoter sequence, which was immunoprecipitated with a specific anti-YB1 antibody. The primers used for amplification of the precipitated DNA fragments are listed in
Cells were grown on a circular microscope cover glass until 30–40% confluency was achieved. For cell fixation, cells were incubated with 4% paraformaldehyde for 20 min at room temperature. Subsequently, cells were washed twice with PBS, followed by permeabilization with 0.2% Triton-X/PBS for 15 min and blocking with 1% (w/v) BSA at room temperature for 30 min. Primary antibodies (1:250) were diluted in 5% BSA (w/v) and incubated with cells at 4°C overnight. Washing was performed thrice with PBS. Next, cells were incubated with goat anti-rabbit IgG CY3 (Beyotime, Beijing, China) and goat anti-mouse IgG FITC secondary antibody (Beyotime, Beijing, China) at room temperature in the dark for 1 h. The cover glass was removed following three additional washes with PBS and mounted on a coverslip with PBS containing DAPI (Beyotime, Beijing, China), which counterstained the nuclei. Subsequently, a confocal microscope (Olympus, Japan) was used to visualize the stained cells at 600× magnification.
Statistical analyses were conducted using SPSS 22.0 software (IBM, United States). All data are presented as the means ± SD. A
In this study, we first explored the hTERT and NRF2 expression levels in CRC tumor tissues and adjacent normal tissues and their effect on CRC patients. According to the Oncomine database, both hTERT and NRF2 were more highly expressed in CRC tumor tissues than in adjacent normal tissues (
Human telomerase reverse transcriptase (hTERT) and NRF2 are highly expressed in CRC tissues and associated with poor diagnosis.
Collectively, these results indicate that both hTERT and NRF2 are highly expressed in CRC patients, and their expression has a positive relationship, suggesting a potential hTERT/NRF2 pathway in CRC tissues. Moreover, a higher hTERT or NRF2 expression level was associated with a shorter survival time after surgery, and patients with both high hTERT expression and high NRF2 expression showed the worst survival, indicating that both hTERT and NRF2 have an important role in CRC and could be applied for predicting the prognosis of CRC patients.
Because a positive correlation was found between hTERT and NRF2 expression in CRC tissues, we investigated whether hTERT could regulate NRF2 expression in CRC cells. Before that, we first examined the expression of hTERT and NRF2 in a variety of human CRC cell lines via qPCR. hTERT expression was low in SW460, SW480, and SW620 cells; moderate in HT29 and LOVO cells; and high in HCT116 and RKO cells (
Human telomerase reverse transcriptase (hTERT) upregulates NRF2 expression by promoting NRF2 transcriptional activity.
Because hTERT and NRF2 have previously been reported to promote CRC progression (
Human telomerase reverse transcriptase (hTERT) promotes colorectal cancer cell proliferation and metastasis by upregulating NRF2.
From these results, we conclude that both hTERT and NRF2 can increase CRC cell proliferation, colony formation and migration and that hTERT promotes CRC proliferation and migration by relying on upregulation of NRF2 at the transcriptional level.
Our previous study demonstrated that hTERT could promote NRF2 expression at the mRNA level. Although hTERT is not a transcription factor, it has been reported to regulate gene expression by interacting with specific transcriptional factors that bind to the promoters of their target genes, thus regulating gene transcription (
Human telomerase reverse transcriptase (hTERT) increases NRF2 expression by recruiting YBX1 to bind to the NRF2 promoter.
To further screen the NRF2 transcription factor(s), we first performed separate knockdown of ILF3, XRCC5, and YBX1 using siRNA and subsequently conducted qPCR and dual luciferase reporter assays. The results showed that YBX1 inhibition significantly decreased NRF2 mRNA expression (
On the other hand, to confirm whether hTERT can recruit YBX1 in CRC cells, we performed hTERT and YBX1 immunoprecipitation, which showed that hTERT and YBX1 could immunoprecipitate each other (
In sum, these results demonstrate that hTERT upregulates NRF2 by recruiting the transcription factor YBX1, which binds to the P2 fragment of the NRF2 promoter to increase the transcriptional activity of NRF2.
To further explore the effect of YBX1 on NRF2 and CRC progression, we again verified the effect of YBX1 on NRF2 expression. Our data showed that, similar to previous results, inhibition of YBX1 decreased the NRF2 mRNA level in CRC cells and that transfection with NRF2 plasmids rescued the NRF2 decrease caused by YBX1 knockdown (
YBX1 is responsible for upregulation of NRF2 expression and CRC proliferation and migration.
In contrast, overexpression of YBX1 induced by transfection with a YBX1 expression plasmid increased the NRF2 mRNA level, and transfection with NRF2 siRNA rescued the increase in NRF2 caused by YBX1 overexpression (
The above results suggest that YBX1 is responsible for upregulation of NRF2 at both the mRNA and protein levels and that YBX1 and NRF2 have the same function in promoting CRC cell proliferation and migration.
YBX1 has been reported to be highly expressed in CRC tissue and to participate in CRC progression (
YBX1 is highly expressed in CRC and associated with poor prognosis.
In this study, we examined whether hTERT promotes CRC proliferation and migration by recruiting the transcription factor YBX1 to bind to the promoter of the NRF2 gene, activating NRF2 transcription (
Model for transcriptional regulation of NRF2 by hTERT via recruitment of YBX1 in CRC proliferation and migration. In this model, hTERT recruits YBX1 to form a transcriptional complex, which binds to the NRF2 promoter to promote NRF2 expression, thus promoting CRC proliferation and migration.
Human telomerase reverse transcriptase is the catalytic subunit of telomerase, which is located at the ends of chromosomes and protects them from degradation. It has been reported that hTERT and telomerase activity play a vital role in cell immortalization (
NFE2-related factor 2 is a molecule well known to regulate ROS homeostasis in cells. NRF2 is regulated by Keap1 via proteasomal degradation and is itself a transcription factor that activates target genes containing an ARE element (
In our study, knockdown of hTERT markedly reduced NRF2 expression, while overexpression of hTERT significantly increased NRF2 expression in CRC cells at both the mRNA and protein level. Furthermore, knockdown of hTERT decreased NRF2 promoter activity, and overexpression of hTERT increased NRF2 promoter activity, suggesting that hTERT is closely associated with transcriptional regulation of NRF2 in CRC cells.
It is known that hTERT is not a transcription factor that directly regulates target gene transcription. hTERT might affect gene transcription by interacting with other transcription factors. It has been reported that hTERT can interact with BRG1 to regulate Wnt-dependent target genes (
YBX1 is a multifunctional molecule that can regulate DNA and RNA expression, impacting the progression of several cancer types (
In summary, our study shows that hTERT recruits the transcription factor YBX1 to bind to the NRF2 promoter, accelerating NRF2 transcriptional activity, increasing NRF2 expression, and thereby accelerating CRC proliferation and migration. This work may provide a new theoretical basis and a potential therapeutic target for prevention and treatment of CRC.
The original contributions presented in the study are included in the article/
CG performed the experiments (cell culturing, DNA pull-down, ChIP-qPCR, Co-immunoprecipitation, colony formation assay, and migration and invasion assay), analyzed the data, interpreted the results, and drafted the manuscript. HY performed the experiments (Chromatin Immunoprecipitation and western blotting assay), analyzed the data, interpreted the results, and drafted the manuscript. SW and JL performed the IHC assay. ZL and YYH constructed the Plasmid vectors and analyzed the data. YC and YH performed the CCK8 assays. QL and YW performed the Immunofluorescence staining. EL conceived the study, interpreted the results, supervised the research, and wrote part of the manuscript. YX conceived the study, interpreted the results, and supervised the research. All authors read and approved the final manuscript.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We sincerely appreciate all lab members.
The Supplementary Material for this article can be found online at: