C57BL/6, TLR2 knockout, and TLR4 knockout mice were obtained from the Model Animal Research of Nanjing University (Nanjing, China), and they were housed under specific pathogen-free conditions in the Animal Center of the School of Life Science of Fudan University. All experimental procedures followed the Guidelines for the Care and Use of Laboratory Animals from the National Institutes of Health and were approved by the Animal Care and Use Ethical Committee of Shanghai Provence. THP-1 cell line was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml) and streptomycin (100 mg/ml) and maintained at 37°C in a humidified incubator (5% CO₂). PBMCs were isolated from whole blood with Ficoll-Paque Plus (Amersham Biosciences, Piscataway, NJ). Monocytes were prepared from PBMCs either by adherence or with the Miltenyi monocyte isolation kit (Miltenyi Biotec, Auburn, CA), and monocytes derived macrophages (MDMs) were obtained as previously described (Dao et al., 2004). The resultant macrophages were used during the following week. DOBW T hybridoma cells were used to detect OVA_323−339 (Pai et al., 2003).

Middlebrook 7H9, 7H10, and OADC were obtained from Difco (Detroit, MI). Annexin V-PE was from BD PharMingen (Mississauga, Ontario, Canada). OVA:I-Ab complexes were detected with DOBW T hybridoma cells (Pai et al., 2003). Anti-His was obtained from antibodies (Santa Cruz Biotechnology, SantaCruz, USA). Anti-Rv1016c, Anti-Rv2145c and Anti-Rv3425 mouse polyclonal antibody were from C57BL/6 mouse immunized by synthesized respective peptides in our lab. The primary Abs used included rabbit antiERK2, rabbit anti-p38, rabbit anti-JNK, rabbit anti-phosphoERK1/2, rabbit anti-phospho-p38, rabbit anti-phospho-JNK, rabbit anti-phospho-IκBα, and peroxidase (HRP)-conjugated secondary Abs (Cell Signaling Technology). Anti-TLR2 and anti-TLR4 were from BioLegend. Alexa488-conjugated anti- His Abs, Alexa488-conjugated or Alexa555-conjugated secondary antibodies were obtained from (Cell Signaling Technology).

The MTB gene was amplified by PCR from H37Rv genomic DNA using the forward primer 5′CCCAAGCTTGGGGAGGGCATCCGGCGGGCTTG3′ and the reverse primer 5′CGGGATCCCGGCCCCAACCGTGCGGACAAT3′, which contain a Hind III site and a BamH I site, respectively. The amplified PCR product was cloned into the vector pRSFDuet-1 (Novagene, Madison, WI). The expression of the recombinant protein was induced by adding isopropyl-β-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM as previously described (Su et al., 2015). Recombinant Rv1016c was purified using a HIS-Select® Nickel Affinity Gel (Sigma-Aldrich, St. Louis, MO, USA) with minor modifications. Recombinant protein was dialyzed against PBS (pH 7.4) and treated with Pierce High Capacity Endotoxin Removal Resin (Pierce, USA) in accordance with the user instructions to eliminate endotoxins. The endotoxin-free Rv1016c protein was quantified with a bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL, USA) and frozen at −80°C. Samples were subjected to SDS-PAGE, and the His-tagged Rv1016c protein was detected by Western blotting using mouse anti-his antibody or anti- Rv1016c.

The pNIT plasmid containing Rv1016c was electroporated into M. smegmatis. The selected M. smegmatis_Rv1016c (Ms_Rv1016c) transformants were cultured in Middlebrook 7H9 with 10% oleic albumin dextrose catalase (OADC) containing 50 μg/ml kanamycin. The Ms_Rv1016c strain was identified by immunoblotting using anti- Rv1016c mouse polyclonal anti-serum. The vector pNIT was electroporated into M. smegmatis to generate Ms_ pNIT strain as a control.

MTB H37Rv and Ms_Rv1016c were grown, and subcellular fractionation of Rv1016c protein was performed as previously described (Xu et al., 2015). Briefly, the cells were lysed by sonification for 30 min, and the lysates were centrifuged at 11,000 g for 5 min at 4°C to precipitate cellular debris and those unlysed cells. The supernatant was subjected to ultracentrifugation at 27,000 × g for 40 min at 4°C to recover cell wall-associated proteins. The supernatant was dell membrane and cytosol fractions. Each fraction was subjected to Western blotting using anti-Rv1016c mouse polyclonal antibody.

Proteinase K degradation assay was performed as previously described (Xu et al., 2015). Briefly, the recombinant Ms_Rv1016c were treated with proteinase K at a concentration of 100 μg/ml and incubated at 37°C for the indicated times. The reaction was stopped by the addition of protease inhibitor Cocktail Tablets (Roche, Basel, Switzerland). Finally, each sample was analyzed by Western blotting using anti-Rv1016c and anti-Rv2145c Abs (as a cytoplasmic protein control).

THP-1 cells (1 × 10⁶ cells per well) were cultured in 6-well tissue plates. Following 48 h of treatment with 0.1 mg/ml of phorbol 12-myristate-13-acetate (PMA) (Sigma), THP-1 cells were transformed into an adherent state. Cells were infected with Ms_Rv1016c or Ms_pNIT at an MOI of 10. Four hours after infection, macrophages were incubated with a final concentration of 2 μg/ml hygromycin for 2 h. At indicated time after infection, macrophages were then washed twice and lysed in sterile water containing 0.025 % (v/v) SDS. The lysed cells were plated on 7H10 agar plates, and the colony forming units were determined as a measure of intracellular survival of recombinant M. smegmatis.

The survival of Ms_Rv1016c under different stress conditions was performed as previously described (Li et al., 2016). Briefly, the disk diffusion method was used to qualitatively measure the differences in H2O2 and SDS sensitivities between Ms_Rv1016c and Ms_pNIT. The indicated amount of H2O2 and SDS was spotted on 5.5 mm-diameter Whatman filter disks placed on the bacterial lawn. After 3–4 days incubation, the diameter of zone of complete inhibition was measured. All experiments were performed at least three times.

Apoptosis was assayed by either TUNEL assay or annexin V-PE staining as previously described (Lopez et al., 2003). TUNEL assays were analyzed using BD PharMingen kit (Mississauga, Ontario, Canada), according to the manufacturer's instructions. Cells were considered apoptotic if they were TUNEL positive (green fluorescent nuclear staining). Cells incubated with actinomycin D were as positive controls. For annexin V-PE assays, cells were treated with annexin V-PE buffer (10 mM HEPES, pH 7.4), and then incubated for 15 min at room temperature in the dark. After washed, and the volume of cells was increased to 400 μl with binding buffer for analysis by flow cytometry.

Macrophages isolated from wild type, TLR2^−/− and TLR4^−/− mouse were grown overnight on coverslips and then incubated for 30 min at 37°C with Rv1016c (20 μg/ml) in Hank's buffer. For flow cytometer, after washed with PBS and fixed for 15 min using 4% paraformaldehyde, the cells were stained with mouse anti-His IgG conjugated with Alexa 488 (Santa Cruz Biotechnology), then the cells were collected and 10,000 total events per sample were analyzed by using a BD FACScan calibrator (BD Biosciences, San Jose, CA). For confocal microscopy assay, macrophages were stained with anti-Rv1016c and anti-mouse TLR2 for 2 h at 37°C in PBS containing 2% BSA. After washing, the cells were stained with appropriate Alexa 488− or Alexa 555-conjugated secondary antibodies for 1 h at 37°C, and then they were incubated with 0.1 μg/ml DAPI for 5 min at room temperature. Finally, cells were mounted on slides using Mowiol solution (Sigma-Aldrich) and observed using a 63x oil objective on an LSM 710 microscope (Carl Zeiss, Munich, Germany).

Macrophages from WT, TLR2^−/− or TLR4^−/− mouse were incubated with Rv1016c (20 μg/ml) for 6 h and lysed with RIPA lysis buffer (Sangon, China). The lysates were pre-cleared by adding protein A or G sepharose beads (Santa Cruz, CA, USA) for 2 h. After centrifugation at 10,000 × g for 5 min at 4°C, the supernatant was incubated with Isotype IgG, anti-TLR2 or anti-His overnight at 4°C. After harvested and washed, the beads were boiled in 5x sample buffer for 5 min. The proteins were separated on 10% SDS-PAGE and probed with anti-TLR2 (BioLegend, CA, USA), or anti-His Abs (Santa Cruz, CA, USA) as indicated, followed by incubation with HRP-conjugated mouse anti-rat or rabbit anti-mouse IgG Abs. Immunoreactive bands were detected using an ECL reagent (Thermo Fisher Scientific, MA, USA) and visualized by exposure to x-ray film.

MHC-II expression assay was performed as previously described (Noss et al., 2001). Macrophages (2 × 10⁶cells/well in a 6-well plate) were cultured for 24 h with 15 ng/ml IFN-γ, and then cultured for 24 or 48 h with IFN-γ with or without Rv1016c protein (20 μg/ml). Cells were harvested by vigorous pipetting and trypsinization, incubated for 30 min on ice with Fc Block (BD Pharmingen) at 1/100 in PBS with 0.1% BSA and for 1 h on ice with FITC-conjugated anti-MHC-II (e Bioscience), or isotype negative control Ig G (e Bioscience). After washed three times in PBS, cells were analyzed with a BD FACScan flow cytometer.

Ag processing and presentation assays were performed as previously described (Noss et al., 2001). Macrophages (5 × 10⁵cells/well) were incubated with increasing concentrations of Rv1016c protein or control buffer in the presence of 15 ng/ml IFN-γ for 24 h. Then, cells were washed and incubated with indicated concentration of OVA_323−339for 3 h. After fixed in 1% paraformaldehyde and washed extensively, the cells were finally incubated with DOBW T hybridoma cells (1 × 10⁶/well for 24 h). Supernatants from the T hybridoma assay were assessed for IL-2 using a CTLL-2 cell bioassay with a colorimetric determination using Alamar Blue (Alamar Biosciences, Sacramento, CA) and a Bio-Rad 550 microplate reader (Bio-Rad). Briefly, 5 × 10³ CTLL-2 cells in 50 μl of complete DMEM were incubated with 100 μl of culture supernatant for 16–20 h. Proliferation of CTLL-2 cells in each well was measured by a colorimetric assay using Alamar blue (15 μl; Trek Diagnostics, Westlake, OH) and a Versamax tunable microplate reader. Positive and negative controls were included in each experiment to monitor CTLL-2 cell responsiveness. All data presented for Ag processing assays compared controls with experimental conditions within the same experiment, measuring the effects of lipoprotein exposure relative to macrophages exposed to control buffer. IL-2 production was expressed as OD at 550 nm minus OD at 595 nm.

For IL-2 level assay, macrophages (1 × 10⁵cells/well) from wild type, TRL2^−/− or TRL4^−/− were incubated with Rv1016c (20 μg/ml) or medium in the presence of IFN-γ (15 ng/ml) for 24 h at 37°C. The cells were then washed with PBS and fixed for 20 min in in 1% paraformaldehyde. After Rv1016c antigen-specific CD4⁺ T cells were isolated from mice immunized with Rv1016c proteins, 1 × 10⁶cells were co-cultured with macrophages for 48 h at 37°C. Finally, the concentration of IL-2 in each supernatant sample was examined using ELISA according to manufacturer's instructions. All results of experiments represent the mean response of triplicate wells plus SD.

For Western blotting, equal amounts of protein were boiled in SDS-PAGE sample buffer under reducing conditions, and electrophoresed on 12% polyacrylamide gels. Protein was transferred to polyvinylidene difluoride membrane (Millipore), blocked in 5% BSA for 1 h at room temperature, and incubated with primary Abs in PBS with 0.1% Tween 20 overnight at 4°C, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary Abs for 1 h at room temperature. The primary Abs included rabbit antiERK2, rabbit anti-p38, rabbit anti-JNK, rabbit anti-phosphoERK1/2, rabbit anti-phospho-p38, rabbit anti-phospho-JNK, and rabbit anti-phospho-IκB-α (Cell Signalling Technology). The secondary Ab was goat anti-rabbit IgG (Cell Signalling Technology). Pierce ECL Western Blotting Substrate was used to assay target bands (Thermo Fisher Scientific, Waltham, MA).

Macrophages (2 × 10⁶cells/well) were incubated with or without Rv1016c (20 μg/ml), and then with IFN-γ (15 ng/ml) in the continued presence or absence of Rv1016c for various periods. Block of the MAPK signaling pathway experiments involved the pretreatment of THP-1 cells with inhibitors to p38 (SB203580, 10 μM), ERK (U0126, 10 μM), JNK (SP600125, 10 μM) for 1 h at 37°C, followed by incubation with Rv1016c for 36 h at 37°C. Total RNA was obtained using the RNeasy kit (Qiagen) and dissolved in RNase-free water. First-strand cDNA was synthesized using the SuperScript preamplification system (Life Technologies). The quantitative real-time PCR was performed using a high-speed thermal cycler (LightCycler; Roche Diagnostics, Indianapolis, IN), and product was assayed by FastStart Master SYBR Green I (Roche Molecular Biochemicals, Indianapolis, IN). All primers were synthesized by Sangon (Shanghai, China), and their sequences were as follows: CIITA IV sense, 5′-3′ACG CTT TCT GGC TGG ATT AGT; CIITA IV antisense, 5′-3′- TCA ACG CCA GTC TGA CGA AGG; GAPDH, sense, 5′–3′ AACGACCCCTTCATTGAC, and antisense, 5′–3′ TCCACGACATACTCAGCAC. RNA amount of genes were normalized to the level of GAPDH in each sample.

All experiments were repeated 3 times at least with consistent results, which were calculated as the mean ± SD of 3 experiments. Statistical analysis was performed using a one-way ANOVA followed by Tukey's test using the origin 8.0 software (Origin Lab, USA). For all tests, p ≤ 0.05 was considered statistically significant.

To define whether Rv1016c is essential for MTB pathogenesis, the Rv1016c gene was firstly amplified from MTB H37Rv genome DNA to generate E.coli BL21_PET28_ Rv1016c strains expressed a 6x his-tagged Rv1016c protein (Figure 1A). Western blotting also confirmed that the Rv1016c protein (~24 kDa Rv1169c-His protein) was successfully produced from E.coli BL21_PET28_ Rv1016c (Figure 1B). Secondly, the recombinant M. smegmatis strains were used to investigate the role of Rv1016c. The semi-RT-PCR demonstrated that Rv1016c could only be detected in Ms_Rv1016c (Figure 1C). Western Blot analysis using the anti-Rv1016c antibody further confirmed only Ms_Rv1016c strain expressed Rv1016c protein in the cell lysates, while absent in Ms_pNIT strain (Figure 1D).

Finally, MTB H37Rv strain and recombinant Ms_Rv1016c were subjected to cell fractionation experiments, followed by Western blot analysis with anti-Rv1016c antibody, to determine the location of Rv1016c. The results showed that Rv1016c lipoproteins were present in the cell wall fraction, indicating that Rv1016c may be associated with the cell wall similar to the localization of Rv3425, as Rv2145c (cytoplasmic proteins) was detected only in the cytoplasm (Figure 1E). Proteinase K assays further confirmed the cell surface association of Rv1016c, as the Rv2145c was not degraded at all (Figure 1F). Taken together, these results demonstrate that Rv1016c may be a cell wall-associated lipoprotein and exposed at the cell surface.

To examine whether Rv1016c can modulate the intracellular mycobacterial invasion, growth and survival, we compared the growth rate of Ms_Rv1016c and Ms_pNIT in macrophages. The infection experiment was carried out at an MOI of 10 (10 bacterium per 1 macrophages). Our results demonstrated that macrophages infected with Ms_pNIT and Ms_Rv1016c show the same invasion ratio (Figure 2A), and there was no significant difference in growth rates of the two strains (Figure 2B). However, Ms_Rv1016c showed significantly higher bacillary counts in THP-1 cells 24–72 h after infection (Figure 2C). The results demonstrate that the presence of Rv1016c does not influence uptake but can enhance the intracellular survival of M. smegmatis within macrophages.

To further determine how Rv1195 enhanced the intracellular survival in macrophages, we compared the survival rate of the Ms_pNIT and Ms_Rv1016c under stresses in vitro. As shown in Figure 2D, the survival percentage of Ms_Rv1016c was significantly higher than Ms_pNIT under acid stress (pH = 3). For reactive oxygen resistance assay, the square of the zone was smaller in Ms_Rv1016c than those of the Ms_pNIT after H₂O₂ treatment (Figure 2E). Moreover, the percentage of survival of Ms_Rv1016c was significantly higher than that of Ms_pNIT after SDS treatment (Figure 2F). These findings indicate that Rv1016c may be involved in virulence, leading to increased resistance to stresses during mycobacteria infection.

Although recognition of mycobacterial lipoproteins such as Lpq H, Lpr G, and Lpr A are known to signal through TLR, Rv1016c has not been tested for TLR ligand activity. To analyze whether Rv1016c can bind to TLR2, macrophages from WT, TLR2^−/− and TLR4^−/− mice were incubated for 24 h with Rv1016c. Cells were then stained with mouse anti-His IgG conjugated with Alexa 488. Flow cytometry analysis showed that Rv1016c bound to the surface of WT and TLR4^−/− mouse macrophages but not to the surface of TLR2^−/− cells (Figures 3A,B). Immunofluorescence analysis also showed strong fluorescence of anti-Rv1016c on the surface of WT, and TLR4^−/− mice cells exposed to Rv1016c but no fluorescence on the surface of TLR2^−/− macrophages cells (Figure 3C). To further ascertain whether Rv1016c physically binds to the TLR2 molecule, we conducted an immunoprecipitation assay using whole-cell extracts from THP-1 cells. Western blots probed with anti-TLR2 showed that Rv1016c was able to interact with TLR2. No band was visible in the beads alone group or Rv1016c alone group (Figure 3D). These results demonstrate that Rv1016c interacts specifically and predominantly with TLR2.

To detect whether Rv1016c induces macrophages apoptosis, THP-1 cells or monocytes derived macrophages (MDMs) were treated with a range of concentrations of recombinant Rv1016c. Apoptosis was determined by flow cytometric analysis of annexin V-PE binding or by TUNEL assay. As shown in Figure 4A, increased levels of apoptosis were apparent with 20 μg/ml Rv1016c and continued to increase through 250 μg/ml, indicating that Rv1016c significantly induced apoptosis both in THP-1 cells and MDMs in a dose dependent manner. Apoptosis kinetics analysis showed that 20 μg/ml Rv1016c significantly induced apoptosis as early as 1 h after exposure and continued to increase through 24 h (Figure 4B). Recombinant Rv1016c–induced apoptosis was specific, as the frequency of annexin V-PE-positive cells after treatment with the Histagged β-galactosidase was similar to that observed for untreated control cells (Figure 4C). In addition, to exclude whether LPS contamination leads to apoptosis, the recombinant Rv1016c protein was exposed to either heat treatment or to polymyxin B before addition to cells. As shown in Figure 4D, LPS- induced apoptosis changed little due to its resistant to heat treatment not its sensitive to polymyxin B. In contrast, the apoptotic effects of recombinant Rv1016c protein were completely abrogated after heat treatment. We further determined the role of TLR2 in Rv1016c-induced apoptosis. THP-1 cells were incubated with Isotype IgG, anti-TLR2 Abs or anti-TLR4 Abs for 18 h before Rv1016c treatment, and apoptosis was analyzed as previously described. As shown in Figure 4E, incubation with anti-TLR2 Abs significantly abrogated the proapoptotic effects of Rv1016c lipoprotein. Similarly, when compared with wild type or TLR4 knockout cells, apoptosis induced by Rv1016c was completely abrogated in TLR2 knockout cells (Figure 4F). Taken together, these results indicate that Rv1016c-induced apoptosis is dependent on TLR-2.

Prolonged incubation of macrophages with mycobacterial lipoproteins modulates IFN-γ-induced MHC-II expression and antigen-presentation activity (Pennini et al., 2006). To clarify whether the Rv1016c lipoprotein regulates MHC-II expression, IFN-γ-stimulated THP-1 cells were treated with or without Rv1016c for 24–48 h, and then flow cytometry was used to analyze MHC-II expression. As shown in Figure 5A, the level of MHC-II was low in Rv1016c-pusled macrophages compared to cells cultured in medium, indicating that Rv1016c lipoprotein inhibited IFN-γ–enhanced MHC-II expression. Similar observations were also made for the endogenous MHC II mRNA levels in THP-1 cells (Figure 5B). To further assess whether Rv1016c affects the ability of Ag processing and presentation of mouse macrophages, THP-1 cells or monocyte-derived macrophages (MDMs) were incubated for 24 h with or without Rv1016c, exposed to OVA_323−339 for 3 h, fixed, and incubated with DOBW T hybridoma cells for 24 h. IL-2 secretion was determined using a CTLL-2 assay. The results showed that exposure of macrophages to increasing concentrations of Rv1016c for 24 h inhibited MHC-II Ag processing of OVA_323−339(Figures 5C,E). Kinetic analysis demonstrated that substantial inhibition was first noted at 300 ng/ml with almost complete inhibition by 2000 ng/ml OVA_323−339 (Figures 5D,F). These findings may identify Rv1016c as an inhibitor of MHC-II expression and Ag processing.

To examine whether Rv1016c inhibits MHC-II Ag processing through TLR2, THP-1 cells were pretreated with Isotype Ig G (30 μg/ml) or Anti-TLR2 blocking Abs (30 μg/ml) for 18 h, followed by treated with IFN-γ (15 ng/ml) for 24 h at 37°C, and then treated with or without Rv1016c-His (20 μg/ml) for 24 h, flow cytometry was finally used to analyze. As shown in Figure 6A, Rv1016c-mediated inhibition of IFN-γ-induced MHC-II expression was reversed in those macrophages, which were incubated with blocking anti-TLR-2 Abs. Additionally, Rv1016c lipoprotein decreased expression of MHC-II by C57BL/6 and TLR4^−/− mice but not TLR2^−/− mice (Figure 6B). To further assess whether Rv1016c affects the ability of Ag processing and presentation via TLR2, macrophages from wild type, TLR2^−/− or TLR4^−/− mouse were incubated for 24 h with or without Rv1016c (20 μg/ml), exposed to a range concentration of OVA_323−339 for 3 h, fixed, and incubated with DOBW T hybridoma cells. IL-2 secretion was determined using a CTLL-2 assay. Inhibition of MHC-II Ag processing of OVA_323−339 was reserved in TLR2^−/− mouse macrophages (Figure 6C). Furthermore, THP-1 cells were pretreated with Isotype Ig G, Anti-TLR2 blocking Abs or Anti-TLR4 blocking Abs for 18 h, followed by treated with or without Rv1016c (20 μg/ml) for 24 h in the presence of IFN-γ (15 ng/ml), and then incubated with Rv1016c-specific splenic CD4⁺ T cells. Supernatant levels of IL-2 were measured using ELISA. The result showed that Rv1016c-induced decrease in MHC-II presentation of Rv1016c peptide was blocked by anti-TLR2 Abs but not by anti-TLR4 or the isotype Abs, as reflected by increased IL-2 levels (Figure 6D). Similarly, Rv1016c inhibited the processing and presentation of Rv1016c peptide by C57BL/6 and TLR4^−/−macrophages but not TLR 2^−/− macrophages (Figure 6D). These findings indicate that Rv1016c lipoprotein may inhibit expression of MHC-II molecules and the processing of Ag for presentation to CD4⁺ cells dependent on TLR2, independent on TLR4.

As an essential IFN-γ-associated immuneregulator, class II transactivator (CIITA) IV regulates MHC II expression. Previous study demonstrated that 19-kDa lipoprotein inhibited the expression of CIITA induced by IFN-γ. To determine whether Rv1016c has similar effects on CIITA IV, we incubated macrophages with Rv1016c for 18 h, and then treated the cells with IFN-γ for the indicated time. As shown in Figure 7A, CIITA expression induced by IFN-γ was inhibited by Rv1016c treatment. In addition, we used macrophages from C57BL/6, TLR2^−/− or TLR4^−/− mice to examine whether inhibition of CIITA IV requires TLR2 signaling through. Q-PCR results showed that the ability of Rv1016c to inhibit IFN-γ-induced CIITA expression was abrogated in TLR2^−/− macrophages (Figure 7B).

MAPK signaling is the key mediators of TLR2 pathway. In this context, MAPK was activated by Rv1016c incubation, as reflected by the increased phosphorylation of p38, ERK, and JNK (Figure 7C). To further determine whether MAPK plays a key role in Rv1016c-mediated inhibition of CIITA expression, we treated macrophages with p38 inhibitor (SB203580), ERK1/2 inhibitor (U0126), JNK inhibitor (SP600125) for 1 h prior to stimulation with Rv1016c. Levels of CIITA IV mRNA expression induced by IFN-γ was measured by Q-PCR. As shown in Figure 7D, three inhibitors could attenuate Rv1016c-mediated inhibition of CIITA IV expression. These results indicate that Rv1016c may inhibit CIITA IV expression dependent on TLR2 and MAPK signaling.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.