Edited by: Alan G. Goodman, Washington State University, United States
Reviewed by: Long Yang, McGill University, Canada; Michael James Conway, Central Michigan University, United States
This article was submitted to Virus and Host, a section of the journal Frontiers in Cellular and Infection Microbiology
†These authors have contributed equally to this work
‡Present Address: Haoues Alout, ASTRE, INRA-CIRAD, Montpellier, France
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
West Nile Virus (WNV) is a flavivirus involved in many human infections worldwide. This arthropod-borne virus is directly co-inoculated with mosquito saliva through the epidermis and the dermis during blood meal. WNV starts replicating in the skin before migrating to the draining lymph node, leading to widespread viremia and in some cases to neurological symptoms. Skin is a complex organ composed of different cell types that together perform essential functions such as pathogen sensing, barrier maintenance and immunity. Keratinocytes, which represent 90% of the cells of the epidermis, are the organism's first line of defense, initiating innate immune response by recognizing pathogens through their pattern recognition receptors. Although WNV was previously known to replicate in human primary keratinocytes, the induced inflammatory response remains unknown. The aim of this study was first to characterize the inflammatory response of human primary keratinocytes to WNV infection and then, to assess the potential role of co-inoculated mosquito saliva on the keratinocyte immune response and viral replication. A type I and III interferon inflammatory response associated with an increase of IRF7 but not IRF3 mRNA expression, and dependent on infectious dose, was observed during keratinocyte infection with WNV. Expression of several interferon-stimulated gene mRNA was also increased at 24 h post-infection (p.i.); they included CXCL10 and interferon-induced proteins with tetratricopeptide repeats (IFIT)-2 sustained up until 48 h p.i. Moreover, WNV infection of keratinocyte resulted in a significant increase of pro-inflammatory cytokines (TNFα, IL-6) and various chemokines (CXCL1, CXCL2, CXCL8 and CCL20) expression. The addition of
Since its discovery in 1937 from a febrile woman in Uganda, West Nile virus (WNV) has been involved in mild febrile disease outbreaks in Africa, Asia and Europe (Lim et al.,
WNV is an arthropod-borne virus belonging to the
Virus inoculation in the skin is a key step in the pathophysiology of WNV infection. Thereby, skin constitutes not only the first site of viral replication in host but also the initiation site of the antiviral immune response. Skin is organized in three successive layers, the epidermis, the most superficial, the dermis and the hypodermis, the deepest. The multi-layered epidermis consists mainly of keratinocytes that express pathogen recognition receptors (PRRs) involved in the recognition of highly conserved pathogen molecular patterns (PAMPs) among microorganisms (Lebre et al.,
WNV is a positive-sense, single-stranded (ss) RNA virus transcribed in a complementary negative RNA, thereby constituting a double-stranded replicative form (ds-RF) (Brinton,
Thus, once injected in the skin and starting replicating, flaviviral RNAs are recognized as PAMPs in the cells either as ssRNA sensed by TLR7 and RIG-I or dsRNA recognized by TLR3, RIG-I and MDA5 (Westaway et al.,
The Ethics Committee of the Poitiers Hospital approved the use of human skin samples for research studies. All subjects gave written informed consent in accordance with the Declaration of Helsinki. Normal abdominal or breast skin was obtained from patients undergoing plastic surgery. Small pieces of skin were thoroughly washed with phosphate-buffered saline solution free of calcium and magnesium (PBS; Gibco) after removal of fat. The skin was minced into fragments of about 125 mm2 using scalpel blades. Skin samples were incubated overnight at 4°C in a dispase solution (25 U/mL; Life Technologies). Epidermal sheets were removed from the dermis, and keratinocytes were dissociated by trypsin digestion (trypsin-EDTA; Gibco) for 15 min at 37°C. The cell suspension was then filtered through a 280 μm sterile filter. Dulbecco's modified essential medium (DMEM; Gibco) supplemented with 10% of fetal bovine serum (FBS; Gibco) was added vol/vol and the suspension was centrifuged at 300 × g for 10 min. Keratinocytes were seeded at a density of 107 cells in 75-cm2 tissue culture flask in Keratinocyte-Serum Free Medium (K-SFM) supplemented with bovine pituitary extract (25 μg/mL) and recombinant epidermal growth factor (EGF) (0.25 ng/mL; all were purchased from Invitrogen, Life Technologies). The cultures were incubated at 37°C in a humidified atmosphere with 5% CO2 until confluence and then stored frozen in liquid nitrogen until use. Finally, keratinocytes were seeded in sterile 24-well culture plates at a density of 4 × 104 cells/well in K-SFM supplemented with bovine pituitary extract and EGF and cultured to 80% confluence. Cells were then starved overnight in K-SFM alone before stimulation.
A lineage 1 clinical strain of WNV was used in this study. The strain isolated from a human brain during the epidemic that occurred in Tunisia in 1997 was provided by Dr I. Leparc Goffart (French National Reference Center on Arboviruses, Marseille, France). The viral stock was produced on the
Saliva were obtained from 7-day-old adult females
Human primary keratinocyte cultures (60–80% of confluency) from 6 to 8 different patients were infected at MOI of 0.1, 1, and 10 and incubated for 24, 48, and 72 h at 37°C in 5% CO2 in K-SFM medium. Mocked-infected keratinocytes incubated with uninfected C6/36 cell supernatant were used as control. For experiments assessing the role of saliva, keratinocytes were infected as previously described in presence of 0.5 μg/L of mosquito saliva for 24 or 48 h.
Cell culture supernatants and cell monolayers were collected at each point of the time course infection in order to perform viral quantification by RT-qPCR and transcriptomic analysis of inflammatory marker expression as described below.
For viral RNA quantification in cell supernatant, Total DNA/RNA of 200 μL of keratinocyte supernatant was extracted on NucliSENS easyMAG® automated system (bioMérieux) according to manufacturer's recommendations. For intracellular viral RNA quantification and evaluation of the host inflammatory response, total RNA extraction from keratinocyte monolayer was performed using the Nucleo-Spin XS RNA extraction kit according to the manufacturer's instructions (Macherey-Nagel). RNA concentrations and purity were determined using the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific).
Viral quantification in cell supernatants and keratinocytes was performed using a one-step real time RT-PCR assay from 5 μL of total RNA in 96-well plates on Applied Biosystems 7500 thermocyler. Reaction mixtures consisted of 12.5 μL of Master Mix (Invitrogen), 0.5 μL (0.2 μM) of forward (5′-3′ GTGCGGTCTACGATCAGTTT) and reverse primers (5′-3′ CACTAAGGTCCACACCATTCTC), and 0.25 μL (0.1 μM) of 5′FAM and 3′Dark Quencher probe (5′-3′ AATGTGGGAAGCAGTGAAGGACGA), 0.5 μL of SuperScript III reverse transcriptase (Invitrogen) and DNA polymerase platinium Taq (Invitrogen), 0.5 μL of RNase out (Invitrogen) and 5.25 μL of water. The calibration range was performed using a transcript produced using a plasmid containing WNV genome deleted from genes coding structural proteins provided by Dr P.W. Mason (Microbiology and Immunology department, Texas University, Galveston, USA). The transcripts were diluted in order to get a calibration range allowing the quantification of viral load from 102 to 107 RNA copies/mL. Each standard of the calibration curve was added in duplicate to each analysis.
Total RNA (1 μg) was reverse transcribed using SuperScript II kit (Invitrogen). Quantitative real time PCR was performed in 96-well plates using LightCycler-FastStart DNA MasterPlusSYBR GREEN I kit (Roche) on LightCycler 480 (Roche). Reaction mixtures consisted of 1X DNA Master Mix, 1 μM forward and reverse primers designed using Primer 3 software and 12.5 ng of cDNA template in a total volume of 10 μl. PCR conditions were as follows: 5 min at 95°C, 40 amplification cycles comprising 20 s at 95°C, 15 s at 64°C, and 20 s at 72°C. Samples were normalized with regard to two independent control housekeeping genes (Glyceraldehyde-Phospho-Dehydrogenase and 28S rRNA gene) and reported according to the ΔΔCT method as RNA fold increase: 2ΔΔ CT = 2ΔCTsample−ΔCTreference.
Vero cells were seeded, in 96-well plates, the day before titration at the rate of 4 × 103 cells/well in DMEM (Gibco) supplemented with 2% SVF. The suspension was successively diluted from 10−1 to 10−9 in DMEM medium supplemented with 2% SVF. Then, 100 μL of each dilution were deposited in a row of 6 wells. A reading was performed after 96 h of incubation at 37°C in an atmosphere containing 5% CO2. The wells in which the cells had a cytopathic effect were considered positive for viral infection. The titer of the viral suspension was then determined using the Kärber's method for assessing the 50% tissue culture infective dose (TCID50).
Cell culture supernatants were UV inactivated at 2 joules/cm2 for 10 min using a Bio-Link crosslinker in order to inactivate virus. Levels of IFNβ and CCL20 in cell culture supernatants were determined for each sample using human ELISA kits (R&D systems for IFNβ; PeproTech for CXCL10) in accordance with the manufacturers' specifications.
Results were analyzed by GraphPad Prism version 5. The statistical significance of the difference between two groups was evaluated by the Wilcoxon's test. Differences were considered to be significant at
In a first step, the capacity of WNV to replicate in epidermal keratinocytes from different patients was evaluated at MOI of 0.1, 1, and 10.
The viral quantification of WNV in keratinocyte supernatant using RT-PCR analysis showed an increase of WNV viral load of about 1 log per 24 h during the 48 first hours of keratinocyte infection for all the MOI tested (Figure
WNV amplification in RNA copies/ml in 24 and 48 h-infected keratinocyte supernatants at MOI of 0.1, 1, and 10. Data are represented as mean + SEM of 6–8 independent experiments. *
The IFN antiviral response was then characterized in keratinocytes infected with WNV at MOI of 0.1, 1, and 10. A significant induction of type I and III IFN expression such as IFNβ, IFNλ1 (interleukin (IL)-29) and λ2 (IL-28A) was observed as soon as 24 h p.i. and sustained at 48 h p.i. in a MOI-dependent manner (Figure
IFN and ISG mRNA expression in response to keratinocyte infection by WNV. IFNβ, IL-29, IL-28A, IFIT2, and IRF7 mRNA expression in human primary keratinocytes infected with WNV for 24 and 48 h, at MOI of 0.1, 1, and 10. mRNA expression levels are expressed as the fold increase above mock-infected cultures. Data are represented as mean + SEM of four independent experiments. *
The profile of inflammatory mediators induced by WNV infection was completed by focusing on cytokines and chemokines known to be expressed by keratinocytes. Messenger RNA expression of pro-inflammatory cytokines such as TNFα, IL-6 and chemokines such as CXCL1, CXCL2 CXCL8, CXCL10, and CCL20 was MOI- and time-dependently increased (Figure
Cytokine and chemokine mRNA expression in response to keratinocyte infection by WNV. TNFα, IL-6, CXCL1, CXCL2, CXCL8, CXCL10, and CCL20 mRNA expression by human primary keratinocytes infected with WNV for 24 and 48 h, at MOI of 0.1, 1, and 10. mRNA expression levels are expressed as the fold increase above mock-infected cultures. Data are represented as mean + SEM of four independent experiments. *
As PRR signaling is crucial to initiate innate antiviral and proinflammatory responses following flaviviral infection, modulation of their expression during WNV replication was studied. The transmembranar TLR3, and the cytosolic helicases MDA5 and RIG-I PRR mRNA expression was increased in infected keratinocytes after 24 and 48 h of infection (Figure
TLR3, MDA5, and RIG-I mRNA expression by human primary keratinocytes infected with WNV for 24 and 48 h, at MOI of 0.1, 1, and 10. mRNA expression levels are expressed as the fold increase above mock-infected cultures. Data are represented as mean + SEM of four independent experiments. *
As WNV is a virus transmitted through the bite of a hematophagous arthropod, we wanted to assess the potential role of saliva from two distinct mosquito species on viral replication in human primary keratinocytes and on the inflammatory response induced. Saliva from
Keratinocyte infection with WNV in presence of
Effect of 0.5 μg/L of
As a parallel to the viral replication, a significant decrease of inflammatory mediator mRNA levels such as IL-28A, IFIT2, CXCL10, and CCL20 was observed at 24 h p.i. in cells treated with
Effect of 0.5 μg/L of
Interestingly,
Adjunction of
Effect of 0.5 μg/L of
Nonetheless, a significant decrease of inflammatory mediator expression such as IFNβ, IL-28A, IFIT2, M-CSF and the PRRs TLR3 and RIG-I was observed at 24 h p.i. and tend to be sustained at 48 h p.i. (Figure
Effect of 0.5 μg/L of
Contrary to
WNV is transmitted through the inoculation by a mosquito bite mainly in the extravascular compartment of the dermis and the epidermis (Styer et al.,
The inflammatory response of human primary keratinocytes to WNV infection was described for the first time in this work. Keratinocytes are resident skin cells with innate immune functions, harboring numerous PRRs involved in the detection of PAMPs in order to initiate an inflammatory response to microbial infection (Briant et al.,
The innate antiviral cellular response involves IRF-family transcription factors as regulators of host defense by inducing production of IFNs and ISGs. In human keratinocytes, Kalali
IRF3 and IRF7 are phosphorylated after recruitment of the adaptor molecule interferon promoter-stimulating factor 1 (IPS-1) by dsRNA-activated RLRs, MDA5 and RIG-I (Sato et al.,
The inflammatory response induced in infected human primary keratinocytes also consisted in mRNA level increase of the pleiotropic cytokines TNFα and IL-6 as well as chemokines, such as CXCL1, CXCL2, CXCL8, CXCL10, and CCL20. CCL20 plays an important role in the homing of lymphocytes and dendritic cells to inflammation site, and CXCL1, CXCL2, and CXCL8 are polymorphonuclear (PMN) leucocytes attracting chemokines. CXCL1 mRNA expression has been described to be induced by WNV infection
Taken together, our results highlight the role of primary keratinocytes as innate immune cells able to establish a cutaneous antiviral response and attract different types of leukocytes, including PMN, T and dendritic cells, in the area of virus inoculation.
WNV contained in a mosquito's salivary glands is inoculated with saliva during mosquito blood meal after probing the skin (Styer et al.,
On the one hand, adjunction of
On the other hand, adjunction of
Concerning the effect of saliva on uninfected human primary keratinocytes,
This work highlights for the first time the inflammatory response of human primary keratinocytes infected by WNV. These skin resident cells permissive to WNV, are able to sense viral PAMPs and initiate immune response through expression of various inflammatory mediators and antiviral effectors. This may lead to prompt induction of an antiviral state in infected as well as in uninfected neighboring cells, thereby helping to limit viral spread. We also showed that the saliva from two potential vectors of the infection exerts an inhibitory effect on the antiviral response of WNV-infected keratinocytes with adverse effects enhancing knowledge of WNV pathophysiology in the skin.
MG, NL, and CB conceived and designed the study. MG performed the experiments and wrote the draft. HA and MW provided
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We would like to thank V. Lerat and L. Lebeau for technical support, Dr. I. Leparc-Goffart for providing us WNV strain and Dr. P.W. Mason for providing us the plasmid of lineage 1 WNV.
The Supplementary Material for this article can be found online at: