Edited by: Robert J. Schaefer, University of Minnesota Twin Cities, United States
Reviewed by: Carl Joseph Schmidt, University of Delaware, United States; Xiangdong Ding, China Agricultural University (CAU), China
*Correspondence: Zhaoyu Geng,
This article was submitted to Livestock Genomics, a section of the journal Frontiers in Genetics
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
The yolk cholesterol has been reported to affect egg quality and breeding performance in chickens. However, the genetic parameters and molecular mechanisms regulating yolk cholesterol remain largely unknown. Here, we used the Wenchang chicken, a Chinese indigenous breed with a complete pedigree, as an experimental model, and we examined 24 sire families (24 males and 240 females) and their 362 daughters. First, egg quality and yolk cholesterol content were determined in 40-week-old chickens of two consecutive generations, and the heritability of these parameters was analyzed using the half-sib correlation method. Among first-generation individuals, the egg weight, egg shape index, shell strength, shell thickness, yolk weight, egg white height, Haugh unit, and cholesterol content were 45.36 ± 4.44 g, 0.81 ± 0.12, 3.07 ± 0.92 kg/cm2, 0.340 ± 0.032 mm, 15.57 ± 1.64 g, 3.36 ± 1.15 mm, 58.70 ± 12.33, and 274.3 ± 36.73 mg/egg, respectively. When these indexes were compared to those of the following generation, no statistically significant difference was detected. Although yolk cholesterol content was not associated with egg quality in females, an increase in yolk cholesterol content was correlated with increased yolk weight and albumin height in sire families (
On the day of hatch, most of the yolk sac has been absorbed by the bird, which provides sufficient nutrition for the first days (0–3 days) posthatch (
Yolk cholesterol is mainly derived from
In mice, oocyte-derived bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) have been shown to promote cholesterol biosynthesis in cumulus cells as a compensation mechanism for cholesterol production deficiencies in the oocyte (
In this study, we used as an experimental model a group of Wenchang chickens, an indigenous Chinese breed with a detailed pedigree. Egg quality was determined in two consecutive generations, and genetic parameters were evaluated in individuals and sire families. Moreover, follicular membrane was collected from hens with either low or high yolk cholesterol content, and transcriptional sequencing was used to screen for candidate genes and signal pathways involved in the regulation of cholesterol synthesis.
All birds used in this study were Wenchang chickens, a Chinese indigenous breed with a complete pedigree. A total of 24 sire families (24 males and 240 females) and 362 daughters (equality distributed among the sire families with pure breeding) were raised with one bird
All experimental procedures were performed following guidelines developed by the China Council on Animal Care and Protocols and were approved by the Animal Care and Use Committee of Anhui Agricultural University, China (permission no. SYDW-P2017062801).
Three eggs were collected from each bird within five consecutive days, and egg quality was assessed within 24 h after collection. A digital scale (accuracy: 0.01 g) was used to measure the weight of each egg. An electronic digital caliper was used to measure the longitudinal diameter (LE) and the transverse diameter (WE) of each egg, and the egg shape index was defined as the WE/LE ratio. Shell strength was measured using an eggshell force gauge (model II, Robotmation, Tokyo, Japan). Then, the egg was broken onto a flat surface, and the height of the inner thick albumen (egg white) was measured using an egg analyzer (model EA-01, ORKA Food Technology, Ramat HaSharon, Israel). The yolk was separated from the albumen, weighed, and stored at -20°C for cholesterol determination. The shell thickness was measured using a digital Vernier caliper (model NFN380, Fujihira Industry, Tokyo, Japan).
After weighing the yolk, ∼0.1 g of yolk was transferred to a 1.5-ml tube. Nine times by weight of anhydrous ethanol were added to the yolk, and the mixture was mechanically homogenized for 30 s at 50 Hz in an ice water bath. Next, all samples were centrifuged for 10 min at 2,500 rpm, and 25 µl of the supernatant was transferred into a well of a 96-well plate. After adding 250 μl of working solution (50 mmol/L Good’s buffer, 5 mmol/L phenol, 0.3 mmol/L 4-AAP, ≥50 KU/L cholesteryl esterase, ≥25 KU/L cholesterol oxidase, and ≥1.3 KU/L peroxidase) to each well, the solution was mixed and incubated for 10 min. The optical density (OD) was measured at wavelength of 510 nm, and the cholesterol content was calculated using the following formula: cholesterol content (mg) = (sample OD - blank OD)/(corrected OD - blank OD) × dilution factor × yolk weight × 386.6535/1,000.
After yolk cholesterol been determined, birds with the lowest (L group) and highest (H group) yolk cholesterol content were selected for follicular tissue collection. For each group, three hens at 41 weeks of age were killed ∼22 h after ovulation, and then, the ovaries were collected rapidly and kept on ice. Three largest (25–30 mm) yellow preovulatory follicles were isolated from each ovary. The yolk was squeezed out, and the granulosa layer was collected, divided into two parts, and immediately stored in liquid nitrogen for RNA isolation.
Total RNA was isolated from individual samples using the OMEGA total RNA extraction kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s recommendations. RNA integrity number and quality were analyzed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, US). Then, qualified total RNA was further purified using an RNase-Free DNase Set (Qiagen, Hilden, Germany). Purified total RNA was used for the construction of a complementary DNA (cDNA) library and subsequent sequencing (NEB Next Ultra Directional RNA Library Prep Kit for Illumina; New England Biolabs, Ipswich, MA, USA). The remaining RNA from each sample was reverse transcribed and stored at -80°C for RNA sequencing (RNA-Seq) results validation
Following messenger RNA purification using Agencourt AMPure XP beads (Beckman, Brea, CA, USA), the first and second cDNA strands were synthesized using the SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendations. Next, double-stranded cDNA was end repaired, adenylated, and ligated to NEBNext Adaptors (New England Biolabs) according to the manufacturer’s recommendations. The cDNA fragments of 150–200 bp were selected using the Agencourt AMPure XP system (Beckman), and PCR was performed using the Phusion High-Fidelity DNA polymerase (New England Biolabs), universal PCR primers, and an Index (X) primer. Clustering of the index-coded samples was performed on a cBot Cluster Generation System using the TruSeq PE Cluster Kit v3-cBot-HS (Illumina, San Diego, CA, USA) according to the manufacturer’s recommendations. After clustering, the libraries were sequenced using a paired-end 2 × 125 bp lane on an Illumina HiSeq 4000 platform (Shanghai Personal Biotechnology, Shanghai, China).
Six libraries from each group (
Gene expression level was calculated using the Cufflinks suite (version 2.1.1) on Tophat output. In brief, the specific gene location was obtained using gene annotation, and the number of reads covering this location was counted. Then, the gene expression level was normalized using the following formula: fragments
The normalized FPKM values were used as gene expression levels for the analysis of differentially expressed genes (DEGs) using the Cuffdiff program of the Cufflinks suite (v2.1.1). The differences in gene expression were evaluated using the fold change (≥2.0) and Fisher’s exact test (false discovery rate ≤ 0.05).
For the analysis of Gene Ontology (GO) term enrichment, the DEGs were first annotated with GO terms, and the number of DEGs for each GO term was calculated. Then, the hypergeometric test was used to identify GO terms that were significantly enriched in DEGs when compared to the chicken reference genome. The enrichment was calculated using the following formula: enrichment = (
RT-qPCR was performed to validate the RNA-Seq results, using the TB Green Premix Ex Taq (Takara, Shiga, Japan) with SYBR Green Dye and the same RNA samples that were used for RNA-Seq. Seven genes were selected for RT-qPCR verification. The primers used for these genes are listed in
Primers used for RT-qPCR verification of the RNA-Seq data.
No. | Gene symbol | Ensembl accession no. | Primer sequence (5′–3′) | Annealing temperature (°C) |
---|---|---|---|---|
1 | CCL19 | ENSGALG00000028256 | GAAGCTTTAGGGGGAGCCAATCCTCTAAGACCTCTCCGGG | 57 |
2 | OSMR | ENSGALG00000003747 | TAACTAAAGCAGCGGAGTGCTTTCCCGGGGAGGGTTATCA | 55 |
3 | ALOX5 | ENSGALG00000005857 | CAAACACACGGGAAACCACCCCACCGTCACATCGTAGGAG | 57 |
4 | FABP3 | ENSGALG00000037050 | CCTGGAAGCTGGTGGATACGCCGTGGTCTCATCGAACTCC | 59 |
5 | ApoA1 | ENSGALG00000007114 | GGACCGCATTCGGGATATGGACTTGGCGGAGAACTGGTC | 57 |
6 | CYP19A | ENSGALG00000013294 | ATGGGGATTGGAAGTGCCTGTCATGAAGAAAGGGCGGACC | 57 |
7 | LPL | ENSGALG00000015425 | CCCACTGAAACTTTTTCGCCGCTGTCCAGGAACCAGGTAGC | 57 |
All statistical analyses were performed using the SAS 9.3 software (SAS, Cary, NC, USA). Heritability was analyzed using the half-sib correlation method and evaluated using the VARCOMP procedure with the restricted maximum likelihood option. Differences in egg quality among individuals and sire families were compared using the ANOVA procedure. Differences in egg quality between the two consecutive generations were compared using the independent
Among first-generation female individuals, the egg weight, egg shape index, shell strength, shell thickness, yolk weight, egg white height, Haugh unit, and cholesterol content were 45.36 g, 0.81, 3.07 kg/cm2, 0.340 mm, 15.57 g, 3.36 mm, 58.70, and 45.86 mmol/L, respectively. Among second-generation female individuals, the egg weight, egg shape index, shell strength, shell thickness, yolk weight, egg white height, Haugh unit, and cholesterol content were 45.16 g, 0.80, 2.97 kg/cm2, 0.338 mm, 15.57 g, 3.32 mm, 58.42, and 45.25 mmol/L, respectively (
Egg quality among first- and second-generation female individuals and sire families.
Source | Generation | Egg weight (g) | Egg shape index | Shell strength (kg/cm2) | Shell thickness (mm) | Yolk weight (g) | Egg white height (mm) | Haugh unit | Cholesterol (mg/egg) |
---|---|---|---|---|---|---|---|---|---|
Females | 1 | 45.36 ± 4.44 | 0.81 ± 0.12 | 3.07 ± 0.92 | 0.340 ± 0.032 | 15.57 ± 1.64 | 3.36 ± 1.15 | 58.70 ± 12.33 | 274.3 ± 36.73 |
2 | 45.16 ± 4.02 | 0.80 ± 0.08 | 2.97 ± 0.84 | 0.338 ± 0.031 | 15.57 ± 1.57 | 3.32 ± 0.86 | 58.42 ± 8.90 | 265.2 ± 22.88 | |
Sire families | 1 | 44.81 ± 2.89 | 0.82 ± 0.06 | 3.07 ± 0.51 | 0.337 ± 1.72 | 15.52 ± 0.77 | 3.36 ± 0.26 | 58.86 ± 3.08 | 285.2 ± 128.1 |
2 | 43.88 ± 1.87 | 0.78 ± 0.02 | 3.83 ± 0.403 | 0.373 ± 0.016 | 13.72 ± 0.61 | 4.68 ± 0.301 | 60.20 ± 3.52 | 282.7 ± 53.5 |
Phenotypic correlation analyses (
Correlation between the level of cholesterol in egg yolk and egg quality indexes.
Source | Trait | Egg weight | Yolk weight | Egg shape index | Shell thickness | Shell strength | Egg white height | Haugh unit |
---|---|---|---|---|---|---|---|---|
Females | Cholesterol | 0.573 | 0.978 | 0.412 | 0.152 | 0.432 | 0.155 | 0.142 |
Egg weight | <0.001 | <0.001 | <0.001 | 0.607 | 0.520 | 0.101 | ||
Yolk weight | <0.001 | <0.001 | 0.082 | 0.042 | 0.238 | |||
Sire families | Cholesterol | 0.375 | <0.001 | 0.118 | <0.001 | 0.387 | <0.001 | 0.341 |
Egg weight | <0.001 | <0.001 | <0.001 | 0.006 | 0.010 | 0.653 | ||
Yolk weight | <0.001 | <0.001 | 0.747 | 0.405 | 0.572 |
Among female individuals, the heritability estimates for egg weight, egg shape index, shell strength, shell thickness, yolk weight, and cholesterol content were 0.432, 0.024, 0.030, 0.374, 0.146, and 0.328, respectively (
Paternal half-sib family structure and heritability estimates.
Trait | Egg weight (g) | Egg shape index | Shell strength (kg/cm2) | Shell thickness (mm) | Yolk weight (g) | Egg white height (mm) | Haugh unit | Cholesterol (mg/egg) |
---|---|---|---|---|---|---|---|---|
Sires | 24 | 24 | 24 | 24 | 24 | 24 | 24 | 24 |
|
7.27 | 7.27 | 7.27 | 7.27 | 7.27 | 7.27 | 7.27 | 7.27 |
Progeny | 362 | 362 | 362 | 362 | 362 | 362 | 362 | 362 |
Heritability | ||||||||
Females | 0.432 | 0.024 | 0.030 | 0.374 | 0.146 | / | / | 0.328 |
Sire families | 0.354 | 0.070 | 0.206 | 0.516 | 0.176 | / | / | 0.530 |
K = (N - Σni2/N)/(S - 1), N = total number of progeny, ni = number of progeny for sire i, and S = number of sires.
The sequenced libraries generated an average of 42,290,686 ± 870,109 raw reads
The data from two groups, chickens with the highest and lowest levels of yolk cholesterol, were compared to identify genes with differing reads
Heatmap analysis of key genes involved in yolk cholesterol deposition. Each row represents a single gene, and each column corresponds to a sequenced sample. The level of expression of each gene is color coded with green and red representing low and high expression levels, respectively.
All the DEGs were subjected to GO term and KEGG pathway enrichment analyses. In total, 559 genes were assigned to 2,251 biological processes, 316 cellular components, and 434 molecular functions (
Gene Ontology (GO) term enrichment analysis of candidate genes. The scatter plot presents the results of the GO term enrichment analysis for the candidate genes. The
Among the various biological processes assigned, positive regulation of response to stimulus (GO:0048584) is the largest category with a total of 749 genes included, and ∼13.36% (72 out of 539) of the candidate genes were annotated with this term. Furthermore, two categories of GO terms associated with biological processes were highly represented: GO terms related to cell–cell adhesion (9 GO terms) and the immune response (25 GO terms). Out of these, the GO terms immune system process (GO:0002376) and immune response (GO:0006955) were significantly enriched (
Regarding cellular component categories, membrane (GO:0016020) and membrane part (GO:0044425) were the two most represented GO terms with 4,104 and 3,114 genes included, respectively. Out of 559 candidate genes, 284 and 228 were assigned to the membrane and membrane part categories, respectively. Furthermore, genes annotated with the GO term condensin complex (GO:0000796) were highly enriched (
Lastly, five molecular function categories were enriched (
In total, 27 KEGG pathways were significantly enriched (
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of differentially expressed genes. The x-axis shows the enrichment score, the size of a bubble indicates the log value of the number of genes enriched in a pathway, and the color shade represents the
We found that many DEGs were involved in the development of follicles with different cholesterol contents, including
Next, the highly enriched DEGs were mapped to the chicken protein–protein interaction networks of the STRING database (
Protein–protein interaction network analysis of selected differentially expressed genes. Proteins highlighted in red and green were significantly down- and upregulated, respectively, while proteins highlighted in yellow showed no significant difference. In the network, each line represents the strength of the relationship between two proteins. Strong interactions are indicated by high STRING combined scores and wide lines, while weak interactions are indicated by low STRING combined scores and narrow lines.
We selected seven DEGs (both up- or downregulated in chicken follicular cells with the highest level of cholesterol) and compared the messenger RNA quantification from the transcriptional sequencing results with the expression level assessed by RT-qPCR. Globally, we found a good correlation for the expression trend of the selected genes, as measured by RNA-Seq and RT-qPCR (
Validation of the RNA-Seq results
In agreement with a previous report by
In this study, the heritability estimate for the egg weight in Wenchang chickens was 0.432 in females and 0.354 in sire families. Overall, these estimates are in agreement with a previous study by
Ovarian follicle development requires markedly increased DNA and protein synthesis in the granulosa cells of the follicle membrane (
The expression of LPL in the ovarian follicles of domestic chicken was first identified by
In mammals, pregnancy will improve the innate and adaptive immunity during gestation to increase pregnancy outcomes (
Energy and substrate sources are also required for ovarian folliculogenesis (
The yolk cholesterol content was most affected by the sire family with a heritability estimate of 0.530. Furthermore, the ovarian steroidogenesis pathway appeared to affect the yolk cholesterol content, with the downregulation of the
The data used in this manuscript can be found according to the link below:
All experimental procedures were performed following guidelines developed by the China Council on Animal Care and Protocols and were approved by the Animal Care and Use Committee of Anhui Agricultural University, China (permission No. SYDW-P2017062801).
XC designed the study, analyzed and interpreted the data, and wrote the paper. WZ conducted egg quality measurement and follicle membrane collection. YD conducted qPCR experiments. XL extracted RNA from follicle membrane. ZG designed the study.
Support for this project was provided in part by the Major Scientific and Technological Special Project in Anhui Province (18030701174), the Open Fund of Anhui Province Key Laboratory of Local Livestock and Poultry, Genetical Resource Conservation and Breeding (AKLGRCB2017001), and the Key project of natural fund of Anhui Provincial Education Department (KJ2018A951).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We thank Ms. Boni G. Funmilayo, from Anhui Province Key Laboratory of Local Livestock and Poultry Genetic Resource Conservation and Bio-breeding, for correcting the grammar of the manuscript. We also thank Anhui Huadong Mountain Fresh Agricultural Development Co., Ltd for providing all the experimental materials.
The Supplementary Material for this article can be found online at:
Directed acyclic graph (DAG)display of GO highly enriched biological process results with candidate targeted genes. The enrichment of GO terms is color coded from low (light yellow) to high (red).
Directed acyclic graph (DAG) display of GO highly enriched cellular component results with candidate targeted genes. The enrichment of GO terms is color coded from low (light yellow) to high (red).
Directed acyclic graph (DAG) display of GO highly enriched molecular function results with candidate targeted genes. The enrichment of GO terms is color coded from low (light yellow) to high (red).