Edited by: Peter G. Zaphiropoulos, Karolinska Institutet (KI), Sweden
Reviewed by: Xu Chaoqian, Mudanjiang Medical University, China; Cao Yong, Capital Medical University, China
*Correspondence: Aiqun Ma,
This article was submitted to RNA, a section of the journal Frontiers in Genetics
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Heart failure (HF) is the end stage of various cardiovascular diseases, with high morbidity and mortality, leading to a significant burden on people’s health (
Long non-coding RNAs (lncRNAs) are a heterogeneous group of noncoding transcripts longer than 200 nucleotides (
Therefore, in the current study we subjected rats to transverse aortic constriction (TAC) surgery to develop a pressure overload-induced HF model. Then we investigated the complete characteristics of myocardial mRNA and lncRNA expression profiles in pressure overload-induced HF based on microarray data, compared with controls. In addition, we performed bioinformatics analyses of differentially expressed mRNAs to explore enriched pathways involved in HF. Moreover, we constructed a mRNA-lncRNA co-expression network of the myocardial transcript profiling in HF for detailed functional prediction. We further determined several target genes and regulatory transcription factors (TFs) by
Male Sprague-Dawley (SD) rats (180–200 g), obtained from the Laboratory Animal Center of Xi’an Jiaotong University Health Science Center (Xi’an, Shaanxi, China), were randomly divided into two groups: the HF group (n=10) and the sham-operated (SO) group (n = 10). The HF group underwent a TAC surgery, and the SO group underwent a similar surgery but without the aorta ligation. All animal experiments were performed following the guidelines for the care and use of laboratory animals and approved by the Ethical Committee of Xi’an Jiaotong University.
The pressure overload-induced HF model was induced by the TAC surgery conducted as described previously with modification (
Myocardial total RNA was isolated from myocardium tissues from the HF and control groups using TRIzol reagent (Invitrogen, CA, USA) following manufacturer’s instruction. The concentration and purity of the RNA were measured using NanoDrop ND-1000 spectrophotometer (Thermo Scientific). The integrity of the RNA was determined using denaturing gel electrophoresis (Agilent Technologies, CA, USA).
The Agilent Rat lncRNA+mRNA Array v1.0 was designed for profiling both mRNAs and lncRNAs of the rat genome containing a total of 30,254 rat mRNAs and 22,020 rat lncRNAs which were collected from multiple databases, including NCBI RefSeq, UCSC, Ensembl, and other literatures. The sample labeling and microarray hybridization were performed according to the CapitalBio cRNA Amplification and Labeling Kit (CapitalBio, Beijing, China). In brief, the extracted RNA was amplified and transcribed to complementary DNA (cDNA) using the CbcScript reverse transcriptase with cDNA synthesis system (CapitalBio, Beijing, China). The amplified RNAs were adopted Klenow enzyme labeling strategy using CbcScrip II reverse transcriptase. Furthermore, arrays hybridization was conducted in the Agilent Hybridization Oven. Then the hybridized mRNA+lncRNA arrays were washed and scanned using the Agilent Scanner G2505C (Agilent Technologies, CA, USA).
The array data were further analyzed using the GeneSpring software v13.0 (Agilent Technologies, CA, USA). Differentially expressed mRNAs and lncRNAs between two groups were selected with a threshold ≥2 or ≤−2 fold change (FC) and
In order to confirm the reliability of the reliability of the microarray data, several differentially expressed mRNAs and lncRNAs were selected for validation by quantitative real-time PCR (qPCR). All reactions were performed in triplicate. Actin was used as an internal control to normalize the data. The relative expression levels of mRNAs and lncRNAs were calculated using the 2−ΔΔCt method. The specific primers used for each gene were listed as follows: NM_031601 (Cacna1g), forward CAGTCCTGGTGTCTGCCTC and reverse GTGTCTTTCTTTGGGGAGGGT; NM_019266 (Scn8a), forward CCAGAAGAACGGGAACGGAA and reverse CCAGAAGAACGGGAACGGAA; NONRATT027756, forward AATGCACAGGGGAGGTTACG and reverse CTCCCAGCCTGTAGGTCTCT; actin, forward GTTGTCTCCTGCGACTTCA and reverse TGGTCCAGGGTTTCTTACTC.
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed to explore the functions of these differentially expressed mRNAs. GO analysis contained biological process (BP), cellular component (CC), and molecular function (MF). Differentially expressed mRNAs were classified to different GO terms which described gene functions and attributes based on the GO database (
Correlation analysis of the differentially expressed mRNAs and lncRNAs was performed to construct a mRNA-lncRNA co-expression network. For each pair of genes, the Pearson’s correlation coefficient was calculated and greater than 0.99 was considered significant. Those mRNAs and lncRNAs with significant correlation were selected for co-expression network construction using the bioinformatics software Cytoscape. The degree centrality was used to reveal the relative importance of genes in the network analysis.
Regulatory mechanisms of lncRNAs can be divided into
All results were presented as mean ± SD. Statistical analysis was performed using the Student’s
At 16 weeks after TAC surgery, the HF rats had significant left ventricular hypertrophy and systolic dysfunction compared with the SO rats based on the echocardiographic data, which indicated the presence of pressure-overload-induced HF. (
Characteristics of the sham-operated (SO) rats and pressure overload-induced HF rats at 16 weeks after transverse aortic constriction (TAC). Increased diastolic left ventricle wall thickness
To study the regulation of mRNAs expression and the probable role of lncRNAs in the HF rats, microarray analysis was conducted to determine the mRNA and lncRNA expression profiles of the HF rats compared with the SO rats. Furthermore, mRNA and lncRNA expression profiles were presented in scatter plots (
Scatter function of messenger RNA (RNA)
Volcano plots of messenger RNA (mRNA)
The mRNA profiling showed 147 of 22,279 mRNAs were tested to be differentially expressed according to significant levels of difference expression at least a two-fold change in the HF rats compared with the SO rats, with 49 up-regulated and 98 down-regulated respectively (
Relative differentially expressed messenger RNAs and long non-coding RNAs in heart failure compared with controls.
mRNA | lncRNA | |||
---|---|---|---|---|
Up-regulated | Down-regulated | Up-regulated | Down-regulated | |
Fold change 2–5 | 40 | 92 | 13 | 138 |
Fold change 5–10 | 7 | 6 | 3 | 7 |
Fold change >10 | 2 | 0 | 1 | 0 |
Total | 49 | 98 | 17 | 145 |
Differentially expressed RNAs | 147 | 162 |
Top 20 differentially expressed messenger RNAs in heart failure compared with controls.
GenBank accession | Gene symbol | Fold change |
|
Regulation |
---|---|---|---|---|
NM_017133 |
|
14.233 | 0.047 | Up |
NM_001106725 |
|
13.416 | 0.002 | Up |
NM_134401 |
|
8.966 | 0.030 | Up |
NM_001024742 |
|
8.897 | 0.006 | Up |
XR_361242 |
|
8.253 | 0.003 | Down |
NM_203325 |
|
7.395 | 0.026 | Up |
NM_001001508 |
|
6.151 | 0.023 | Down |
NM_001113335 |
|
6.038 | 0.007 | Down |
XM_006238223 |
|
5.916 | 0.019 | Up |
NM_012641 |
|
5.735 | 0.024 | Up |
NM_147212 |
|
5.548 | 0.019 | Up |
NM_001191822 |
|
5.272 | 0.028 | Down |
NM_147215 |
|
5.160 | 0.041 | Up |
NM_001134641 |
|
5.043 | 0.048 | Down |
BC088257 | 4.780 | 0.029 | Down | |
NM_147212 |
|
4.608 | 0.033 | Up |
NM_001012011 |
|
4.300 | 0.021 | Down |
NM_030840 |
|
4.196 | 0.048 | Up |
NM_001005897 |
|
4.155 | 0.045 | Up |
NM_012508 |
|
4.038 | 0.042 | Up |
Based on the same criteria to screen a total of 13,528 lncRNAs, 162 lncRNAs were found differentially expressed in the HF group compared to the control group. As shown in the scatter plot and volcano plot, 17 lncRNAs were up-regulated, while 145 lncRNAs were down-regulated (
Top 20 differentially expressed long non-coding RNAs in heart failure compared with controls.
Target ID | Fold change |
|
Regulation | Chromosome position |
---|---|---|---|---|
XR_344816.1 | 10.118 | 0.039 | Up | chr3: 1138511–1141696 |
XR_358422.2 | 8.891 | 0.010 | Up | chr11: 2304132–2305501 |
XR_591656.1 | 8.127 | 0.034 | Down | chr3: 1426625–1428019 |
NONRATT024270 | 7.241 | 0.034 | Down | chr6: 2114563–2115162 |
XR_590356.1 | 6.351 | 0.001 | Up | chr1: 3055953–3059354 |
XR_600156.1 | 6.005 | 0.000 | Down | chr3: 1232115–1240608 |
NONRATT025409 | 5.752 | 0.033 | Down | chr6: 407523–407990 |
NONRATT023839 | 5.695 | 0.013 | Down | chr5: 3692775–3693535 |
XR_593816.1 | 5.495 | 0.001 | Up | chr14: 4823160–4825467 |
NONRATT016350 | 5.269 | 0.043 | Down | chr2: 4722257–4727845 |
NONRATT026008 | 5.084 | 0.040 | Down | chr7: 3427462–3432042 |
NONRATT022872 | 4.932 | 0.000 | Down | chr5: 749024–749401 |
NONRATT000918 | 4.845 | 0.015 | Down | chr1: 3023674–3025708 |
NONRATT003405 | 4.828 | 0.025 | Down | chr1: 1319862–1320497 |
XR_591425.1 | 4.752 | 0.022 | Down | chr2: 114669–196442 |
XR_356919.2 | 4.666 | 0.028 | Down | chr9: 1097060–1116238 |
XR_357854.2 | 4.457 | 0.009 | Down | chr10: 4300924–4301531 |
NONRATT029506 | 4.451 | 0.030 | Down | chr9: 1507295–1508007 |
NONRATT013850 | 4.365 | 0.044 | Down | chr18: 1011665–1012798 |
XR_600157.1 | 4.354 | 0.011 | Down | chr3: 1232115–1235264 |
Cluster analyses were performed to show the expression patterns of mRNAs and lncRNAs. Heat maps revealed that hierarchical clustering of the expression of the 147 mRNAs and the 162 lncRNAs based on centered Pearson correlation clearly separated HF from control group (
Heat map and hierarchical clustering of messenger RNA (mRNA)
Several significantly differentially expressed mRNAs and lncRNAs of interest for further analysis were selected to prove the stability and precision of the microarray expression data by qPCR, including one up-regulated mRNA (Cacna1g), one down-regulated mRNA (Scn8a), and one up-regulated lncRNA (NONRATT027756). Verification results confirmed that the expression of Cacna1g was up-regulated and Scn8a was down-regulated, meanwhile NONRATT027756 was significantly up-regulated in the HF hearts compared with controls (
Quantitative PCR (qPCR) validation.
To predict the potential functions of the dysregulated mRNAs in HF, these mRNAs were detected by enrichment analysis, including GO analysis, KEGG, and PANTHER Pathway analyses.
GO analysis showed that complicated functional pathways were enriched in the HF group compared with the controls, which contained associated differentially expressed mRNAs with
Gene Ontology (GO) analysis of differentially expressed messenger RNAs (mRNAs) in heart failure. Enriched mRNAs were functionally classified by biological process (BP), cellular component (CP), and molecular function (MF). Top 20 significantly enriched GO terms of BP
Furthermore, KEGG and PANTHER Pathway analyses indicated that several significantly enriched pathways were associated with HF. The top 20 enriched KEGG (
Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway analysis of differentially expressed messenger RNAs in heart failure.
To explore the role and interaction of genes in HF, the mRNA-lncRNA co-expression network was constructed based on the correlation analysis between the differentially expressed mRNAs and lncRNAs. The Pearson’s correlation coefficients were calculated for each pair of genes and significantly correlated pairs of mRNAs and lncRNAs with Pearson’s correlation no less than 0.99 were chosen to build the network.
As shown in the network analysis (
The messenger RNA (mRNA)-long non-coding RNA (lncRNA) co-expression network in heart failure. The network displayed the correlations between the differentially expressed mRNA and lncRNA profiles. The yellow nodes represented the lncRNAs, and green nodes represented the mRNAs. The size of node represented the degree centrality of the gene in the network, defined as the link numbers of the node. The red lines indicated a positive correlation, while blue lines indicated a negative correlation.
To further clarify the potential functions and regulatory mechanisms of these differentially expressed lncRNAs, target prediction of lncRNAs including
The transcription factors (TFs)-long non-coding RNA (lncRNA) network in heart failure. The network was built on the base of interaction between the lncRNAs and TFs. The purple nodes represented TFs, and yellow nodes represented lncRNAs.
HF is the complex syndrome as a result of re-expression of comprehensive genes and protein synthesis (
Our study investigated the expression profiles of mRNAs and lncRNAs in the rat pressure overload-induced HF model and indicated that 147 mRNAs and 166 lncRNAs displayed significantly differential expression in HF compared with controls. The mRNA-lncRNA and TFs-lncRNA networks were constructed to predict the potential functions of lncRNAs in HF. Although most of these differentially expressed mRNAs and lncRNAs had not been functionally characterized, this study provided a comprehensive understanding of mRNA and lncRNA expression profiles regulation in HF and provided evidences for us to further elucidate the complex regulatory mechanisms underlying HF.
To further precisely clarify these differentially expressed mRNA genes, the GO and Pathway analyses were used to explore the potential biological pathways and functions. The GO analysis results revealed that the most enriched BPs included membrane depolarization, immune response, regulation of cell size, regulation of heart rate, inorganic ion transmembrane transport, artery smooth muscle contraction, response to salt. These BPs or CCs and MFs seemed to be mainly associated with the mechanisms of hypertension, cardiac hypertrophy, arrhythmia, and HF. HF involves diverse pathophysiologic processes in the failing heart, such as cardiomyocyte hypertrophy, cardiomyocyte proliferation, myocardial fibrosis, cardiac electrical remodeling, energetic metabolism, inflammation, and immune response (
Furthermore, this study was aimed to explore the relationship between lncRNA expression profiles and cardiac remodeling and dysfunction in HF. According to previous studies, lncRNA expression profiles were significantly dysregulated in ischemic heart disease (
Up to now, functions of most lncRNAs have not been clearly illustrated. Therefore, we performed target gene prediction based on
HF is a clinical syndrome that is heterogeneous in both pathophysiology and etiology. In summary, we provided a comprehensive understanding of mRNA and lncRNA expression profiles regulation in pressure overload-induced HF rats. We found that the lncRNA NONRATT013999 was predicted to
In conclusion, we explored the comprehensive characteristics of mRNAs and lncRNAs in pressure overload-induced HF. The mRNA and lncRNA expression profiles were significantly dysregulated in the HF rat hearts compared with controls. Variety of differentially expressed mRNAs were involved in diverse biological pathways related to the mechanisms of cardiac hypertrophy and HF. Through the co-expression network, complex interactions between mRNAs and lncRNAs were demonstrated and several lncRNAs were identified as key regulating elements. Several target mRNAs and regulatory TFs were identified by
All datasets generated for this study are included in the article/
The animal study was reviewed and approved by the Ethical Committee of Xi’an Jiaotong University.
LB and AM conceived the study. SC, QM, YX, JZ, GY performed the experiments. SC and TW analyzed the data. SC wrote the manuscript. TW, AM, and LB reviewed and revised the manuscript.
This study was supported by the National Natural Science Foundation of China (No. 81270235) and the Science and Technology Project of Shaanxi Province (No. 2012K15-01-01).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The Supplementary Material for this article can be found online at: