Edited by: Qiu-Ning Liu, Yancheng Teachers University, China
Reviewed by: Malgorzata Kloc, Houston Methodist Research Institute, United States; Jinshan Wo, The Affiliated Hospital of Qingdao University, China
†These authors have contributed equally to this work
This article was submitted to RNA, a section of the journal Frontiers in Genetics
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Circular RNAs (circRNAs) are novel non-coding RNAs, which show abnormal expression in several diseases, such as atherosclerosis (AS). The purpose of the present study was to reveal the association between hsa_circ_0004543 and AS. In the present study, hsa_circ_0004543 was overexpressed in human umbilical vein endothelial cells (HUVECs) induced by oxidized low-density lipoprotein (oxLDL). Inhibition of hsa_circ_0004543 expression facilitated the proliferation, migration, and invasion of HUVECs and significantly reduced their apoptotic rate following treatment with oxLDL. Furthermore, silencing of hsa_circ_0004543 activated the PI3K/AKT/NOS3 pathway in oxLDL-induced HUVECs. Collectively, these results demonstrated that hsa_circ_0004543 may play a vital role in the development of AS and affect the proliferation of HUVECs, providing a potential target for treating endothelial cell damage in AS.
Atherosclerosis (AS) is the main cause of coronary heart disease, cerebral infarction, and peripheral vascular disease (
Circular RNAs (circRNAs) are a novel type of non-coding RNA mainly composed of exons. To date, previous studies have shown that these are associated with a variety of human diseases, including malignant tumors, cardiovascular diseases, diabetes, and chronic inflammatory diseases (
In the present study, differentially expressed circRNAs were identified in human umbilical vein endothelial cells (HUVECs). Their function was assessed with regard to cell proliferation and angiogenesis, and their mechanism of action involved the circRNA/miRNA/mRNA axis (
The present study was approved by the Ethics Committee of Minhang Hospital, Fudan University. HUVECs were obtained from the Chinese Academy of Sciences Cell Bank (Shanghai, China). These cells are usually used for angiogenesis experiments. Apoptosis of vascular endothelial cells (VECs) is a common event involved in the initiation of the pathogenesis of AS. The cells were cultured in RPMI-1640 medium in the presence of 10% FBS and at 37°C with 5% CO2. When HUVECs were in the logarithmic growth phase, they were treated with specific concentrations (0, 20, 40, 60, 80, and 100 mg/L) of oxLDL at specific time points (0, 0.5, 1, and 2 days). The expression levels of hsa_circ_0004543 were measured via qPCR. Small interfering (si)RNA sequences were used to knockdown hsa_circ_0004543 expression and si-normal control (si-NC) sequences were used as a control, which were purchased from Sangon Biotech (Shanghai, China). In order to construct the hsa_circ_0004543 overexpression plasmid, the hsa_circ_0004543 full-length complementary DNA (cDNA) was inserted into the pLCDH-CIR vector (BGI, Qingdao, China) and the normal vector was used as a control. Copanlisib is used as an inhibitor of the PI3K/AKT/NO3 pathway. According to the manufacturer’s instructions, Polyplus-transfection® (Polyplus-transfection SA, Illkirch, France) was used to transfect HUVECs with the aforementioned RNA sequences at appropriate doses.
The TRIzol® reagent (Invitrogen, Thermo Fisher Scientific, Inc., Shanghai, China) was applied to extract total RNA from cells. cDNA was obtained from RNA using a cDNA synthesis kit (Takara Biotechnology Co., Ltd., Beijing, China). The SYBR Green PCR Kit (Takara Biotechnology Co., Ltd., Beijing, China) was used for qPCR. The primers and their sequences are listed in
Primer sequences of the genes examined.
Hsa_circ0004543 | F: ACCATCAGTGACCTGGACCTCTC |
R: ATCTCCTCAATGGCTGCCTTCT | |
PI3K | F: CCACGACCATCATCAGGTGAA |
R: CCTCACGGAGGCATTCTAAAGT | |
AKT | F: AGCGACGTGGCTATTGTGAAG |
R: GCCATCATTCTTGAGGAGGAAGT | |
eNOS | F: TGATGGCGAAGCGAGTGAAG |
R: ACTCATCCATACACAGGACCC | |
GAPDH | F: GGAGCGAGATCCCTCCAAAAT |
R: GGCTGTTGTCATACTTCTCATGG |
The CCK-8 (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was used to measure cell viability. In brief, HUVECs were cultured in 96-well plates with 5 × 104 cells per well. Following incubation for 1–3 days, the microplate spectrophotometer was used to measure the absorbance at 450 nm.
The induction of apoptosis was detected by the Annexin V-FITC apoptosis detection kit (Invitrogen, Thermo Fisher Scientific, Inc., CA, United States). In short, HUVECs were stained with 1 μl of PI and 5 μl of Annexin V-FITC. The samples were incubated at room temperature in the dark for 20 min. The samples were analyzed by the ACCURI C6 flow cytometry software (BD Biosciences, CA, United States).
Following transfection, HUVECs (5 × 104 cells/well) were incubated in the six-well plate and cultured until approximately 80% confluence. The cells were scraped and cultured for 1 day. Inverted microscopy was used to image the cells at 0 and 24 h.
The cell migratory activity was measured using the Transwell assay (Corning, Inc., New York, United States). Briefly, 1 × 104 cells were seeded in the upper chamber with free medium, while medium with 10% FBS was used in the lower chamber. Following culture at 5% CO2 with 37°C for 24 h, the cells were fixed with 70% ethanol and stained with 0.1% crystal violet. Images were captured under a microscope (Nikon Ti-s, Nikon Corporation, Shanghai, China), and the migrated cells were counted.
The total protein was extracted from HUVECs using the ExKine cytoplasmic protein extraction kit (Abbkine Scientific, Co., Ltd., CA, United States) and quantified by the BCA protein analysis kit (Thermo Fisher Science, Inc.). The membrane containing 5% skimmed milk was sealed at room temperature for 60 min and incubated with the following antibodies: anti-PI3K, anti-AKT, anti-NOS3 (Univ, Shanghai, China), and β-actin (Univ, Shanghai China). The membrane was subsequently incubated with the secondary antibody and imaged.
The SPSS V23.0 and R (version 4.0.3) was used for statistical analysis. The difference in the mean between the groups was analyzed by the
HUVECs were divided into two groups, those treated with oxLDL or without oxLDL, to compare the expression levels of hsa_circ_0004543. The results indicated that the expression levels of hsa_circ_0004543 in HUVECs treated with oxLDL (80 mg/L) were significantly higher than those without oxLDL (
The expression of hsa_circ_0004543 is upregulated in HUVECs treated with oxLDL.
To detect the biological function of hsa_circ_0004543 on HUVECs, siRNAs were used to inhibit hsa_circ_0004543 expression and examine its fold change. Surprisingly, both siRNAs designed could effectively suppress the expression of hsa_circ_0004543 (
Silencing of hsa_circ_0004543 increases the proliferation of HUVECs induced by oxLDL.
In order to elucidate the biological role of hsa_circ_0004543 in HUVECs induced by oxLDL, their angiogenic activity was assessed following transfection with si-circ1 and si-circ2. The wound-healing assay indicated that the control group exhibited significantly lower migratory activity than that of the oxLDL-induced HUVECs previously transfected with siRNAs (
Effects of hsa_circ_0004543 knockdown on invasion and migration of HUVECs induced by oxLDL.
In order to further clarify the mechanism of hsa_circ_0004543 involved in cell invasion, the mRNA and protein expression levels of PI3K, AKT, and NOS3 were assessed. Knockdown of hsa_circ_0004543 led to a significant increase in the mRNA expression levels of PI3K, AKT, and NOS3 in HUVECs induced by oxidized low-density lipoprotein (
The knockdown and overexpression of hsa_circ_0004543 was influenced by the PI3K/AKT/eNOS pathway.
Schematic diagram demonstrating that the decrease in hsa_circ_0004543 expression activates the PI3K/AKT/eNOS pathway.
VECs are the most vulnerable cells of the blood vessels. The destruction of the surface cells and the cellular dysfunction are considered to be the initial and crucial steps in the pathogenesis of AS. The function of circRNAs in VEC biology has been rarely reported. The present study examined the effects of hsa_circ_0004543 on HUVECs treated with oxLDL, which play a significant role in the initiation of AS. The data were consistent with the results of a previous study (
Cumulative evidence has shown that circRNAs can exert their biological functions by regulating gene transcription, translation, and expression of regulatory proteins, and by sponging various miRNAs, which are deregulated in human cardiovascular diseases (
The association between hsa_circ_0004543 and endothelial cell invasion was assessed by monitoring HUVEC invasion. NOS3 (also named eNOS) is an important downstream mediator of the PI3K/AKT pathway (
circPIP5K1A can activate KRT80 and the PI3K/AKT pathway to promote gastric cancer by regulating miR-671-5p (
In summary, the present study demonstrated that the expression levels of hsa_circ_0004543 were upregulated in HUVECs induced by oxLDL. Its abnormal expression suppressed the proliferation, migration, invasion, and the activation of the PI3K/AKT/eNOS pathway in VECs. These findings improve the current understanding of the association between circRNAs and AS and support their application as therapeutic targets for the treatment of AS.
The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.
LH and WH contributed to the design of the present study. DL, YH, XZ, JL, XB, YL, PZ, MZ, and ZW performed the experiments. WH critically revised the manuscript. All authors drafted the manuscript.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.