The B. bovis strain S74-T3Bo, which originated from the parental T2Bo strain (26), was used in this study. A batch of the S74-T3Bo strain has been maintained in culture, under standard conditions, as previously described (39), for more than 10 years. This strain has been shown to be attenuated for cattle and non-tick transmissible (37, 38), and consequently, termed Att-S74-T3Bo in this present study. Stabilates with the homologous virulent S74-T3Bo strain (Vir-S74-T3Bo), derived from experimentally infected cattle, were used to infect calves, as described in previous studies (19, 38, 40).

A group of three male Holstein calves, 6 months of age, were inoculated intravenously (IV) with Att-S74-T3Bo iRBC (10⁶ iRBC/calf). Inoculum was prepared from a fresh parasite culture. Another group of three male Holstein calves, 6 months of age, were inoculated IV with 10⁶ normal RBC/calf and served as controls. After inoculation, all animals were monitored daily for signs of acute bovine babesiosis, including temperature, packed cell volume (PCV), B. bovis load in peripheral blood, and behavioral alterations. At day 46 after Att-S74-T3Bo inoculation, infected and control calves were infected IV with 10⁷ Vir-74-T3Bo iRBC. This parasite dose has been shown to induce severe acute disease in cattle in previous studies (40–43). Following Vir-74-T3Bo infection, all calves were monitored daily for clinical signs of acute bovine babesiosis, as described above. All animal experiments were approved by the University of Idaho Institutional Animal Care and Use Committee (IACUC protocol number 2020-51).

Parasite load in peripheral blood of animals after infection was measured by real-time quantitative PCR (qPCR), as previously described (42). Briefly, peripheral blood from experimental animals was collected via jugular venipuncture into Vacutainer^® tubes containing ethylenediamine tetra acetic acid (EDTA) (BD Company, Franklin Lakes, NJ) at several time-points after infection. Total genomic DNA from whole blood was extracted using the QIAamp^® DNA Blood Mini Kit (QIAGen, Valencia, CA) following the manufacture’s protocol. Genomic DNA was used for qPCR to amplify the single copy B. bovis msa-1 gene. For the msa-1 qPCR, specific primers (5’ gatgcgtttgcacatgctaag 3’ and 5’ cgggtacttcggtgctctca 3’) and probe (FAM 5’-cacgctcaagtaggaaattttgttaaacctgga-3’ TAMRA) were used following the assay conditions described elsewhere (42).

The presence of antibodies in serum of infected animals against the C-terminal segment of the immunodominant antigen rhoptry associated protein 1 (RAP-1 CT) was evaluated by indirect ELISA (iELISA), as previously described (44). Briefly, peripheral blood was collected in Vacutainer^® tubes with no anticoagulant, and serum samples were obtained by standard procedures. For iELISA, 96-well Immulon™ 2HB microtiter plates (Thermo Fisher Scientific, Waltham, MA) were coated overnight at 4 °C with 50 µl of recombinant B. bovis RAP-1 CT (2 µg/ml). Plates were then washed three times using 200 µl blocking buffer (0.2% I-Block™ in 1xPBS with 0.1% Tween 20) and blocked with 300 µl of the same buffer for one hour at 30 °CC. After blocking, bovine serum samples were diluted 1/10 in blocking buffer, and 50 µl was added to triplicate individual wells. Plates were incubated for one hour at 30 °CC and then washed five times in 200 µl blocking buffer. After that, 50 µl of a 1/1000 dilution of anti-bovine total IgG, IgG1, IgG2, or IgM peroxidase labeled secondary antibodies (SeraCare, Milford, MA) were added to each well, and plates were incubated for 45 minutes at 30 °CC. After incubation, plates were washed four times using 200 µl blocking buffer and two times with 200 µl 1xPBS with 0.1% Tween 20. Fifty-five µl of SureBlue™ TMB (SeraCare, Milford, MA) was then added to each well and plates were incubated for 10 minutes. Reaction was stopped by adding 55 µl TMB stop solution (SeraCare, Milford, MA), and absorbance was measured at 450 nm using the SpectraMax^® 190 plate reader (Molecular Devices, San Jose, CA). Average values with standard deviations were then calculated and plotted to a chart.

The presence of anti-B. bovis antibodies after infection was also examined by immunoblot. Briefly, total antigens (2 µg/lane) from uninfected bovine RBC, Att-S74-T3Bo iRBC (2% percentage of parasitized erythrocytes, PPE), or Vir-S74-T3Bo iRBC (2% PPE) were ran through 4-20% TGX™ gels (Bio-Rad Laboratories, Hercules, CA). Antigens were then transferred to nitrocellulose membranes using iBlot 2™ (Invitrogen, Waltham, MA), and the membranes were blocked in 5% milk overnight. Membranes were then washed one time in 1xPBS with 0.1% Tween 20 (PBS-T) and incubated with a 1/50 dilution of bovine serum in 5% milk for one hour rocking at 30 °CC. After that, membranes were washed three times using PBS-T and incubated with a 1/1000 dilution of anti-bovine IgG peroxidase labeled secondary antibodies (SeraCare, Milford, MA) in 5% milk for 30 minutes rocking at 30 °CC. Membranes were then washed again three times in PBS-T and sprayed with WesternBright^® ECL-spray (Advansta, San Jose, CA). Visualization of immune complexes was performed using the Azure™ Imaging System (Azure Biosystems, Dublin, CA).

Cell blood count was evaluated in all experimental animals after B. bovis infection using the ProCyte One™ Hematology Analyzer (IDEXX Laboratories, Westbrook, ME). Peripheral blood from the experimental animals was collected at several time-points after infection, as described above into Vacutainer^® tubes containing EDTA (BD Company, Franklin Lakes, NJ). After collection, whole blood samples were homogenized for 5 minutes and the numbers of total leukocytes, lymphocytes, monocytes, neutrophils, RBC, and reticulocytes were measured. Results of each leukocyte population are presented as 1,000 cells/μl of blood, and RBC and reticulocyte are shown as 1,000,000 cells/μl of blood.

Peripheral blood from all experimental animals was collected at several time-points after infection in Vacutainer^® tubes containing EDTA. Peripheral blood mononuclear cells (PBMC) were isolated using Histopaque^®-1077 (Sigma, St. Louis, MO), as per a standard protocol. Cells were then labeled with monoclonal antibodies to surface markers (Table S1), followed by secondary antibodies (Table S2) using standard flow cytometry protocols, as previously described (45). Flow cytometric analysis was performed using the Guava^® easyCyte™ flow cytometer (Luminex, Austin, TX), and data were acquired using the InCyte™ guavaSoft™ software version 3.1.1 (Luminex, Austin, TX). A single-color panel was used for phenotyping CD14⁺ monocytes, CD335⁺ NK cells, CD4⁺ T cells, CD8⁺ T cells, γδ T cells, and B cells in PBMC. A minimum of 20,000 events were collected for each cell population. After acquisition, data were analyzed using FCS Express™, version 6 (DeNovo™ Software, Pasadena, CA). Results are presented as percentage of target cell populations in PBMC.

Concentration of cytokines in serum from infected animals was measured by ELISA. Bovine IFNγ was assessed by a single-metabolite assay (Bio-Rad Laboratories, Hercules, CA) following the manufacture’s protocol, using the SpectraMax^® 190 plate reader (Molecular Devices, San Jose, CA). Results for IFNγ are presented as pg/ml and minimal detectable level was 25 pg/ml. Bovine IL-1β, IL-4, IL-6, IL-8, IL-10, CXCL10, and TNFα were evaluated by MILLIPLEX^® Bovine Cytokine/Chemokine Magnetic Bead (Millipore-Sigma, Burlington, MA) following the manufacture’s protocol. Minimal detectable levels were as follows: 0.1 pg/ml IL-1β, 12.8 pg/ml IL-4, 2.6 pg/ml IL-6, 2.2 pg/ml IL-8, 0.96 pg/ml IL-10, 0.6 pg/ml CXCL10, and 12.8 pg/ml TNFα. Standard curves and quality controls for each cytokine in the multiplex assay were prepared following the manufacture’s protocol. The LX-200™ instrument (Luminex, Austin, TX) was used for the multiplex analysis. Data acquisition was done by xPONENT^® software (Luminex, Austin, TX), and results were analyzed by Belysa^® software (Millipore-Sigma, Burlington, MA).

Graphpad Prism software version 9 (GraphPad Software, San Diego, CA) was used for data analysis and to generate graphs. Results of temperature, PCV, parasite load, percentage of cells in blood, percentage of PBMC, and cytokines in serum are shown as mean and standard deviation of experimental and control samples. Means were compared with a two-tailed t test, and a P value of <0.05 was considered significant.

We have previously shown that the Att-S74-T3Bo B. bovis strain has an attenuated phenotype in cattle, and it is not tick transmissible (37, 38). However, no previous experiments have been performed to investigate the ability of this strain to induce a protective immune response in cattle against experimental infection with a virulent B. bovis strain. Therefore, as a starting point of our study, we systematically defined the characteristics of the Att-S74-T3Bo acute infection in cattle. A group of three calves was inoculated IV with 10⁶ iRBC and monitored daily for signs of acute bovine babesiosis. Att-S74-T3Bo-inoculated animals showed mild but significant (P<0.05) elevation of temperature on days 6 (39.2 °CC [±0.41]) and 7 (39.1 °CC [±0.34]) post-infection compared to uninfected control calves ( Figure 1A ). Concomitantly, infected animals had decreased PCV on days 6 to 10 after infection; however, no statistical significance was observed compared to control animals ( Figure 1B ). Peak of parasite load (approx. 5x10³ parasites/100 µl of blood) occurred at day 6 after Att-S74-T3Bo inoculation. Parasite DNA was then intermittently detected from days 12 to 30 post-inoculation ( Figure 1C ). Despite the increase in temperature, drop in PCV, and parasitemia, the Att-S74-T3Bo-infected calves did not develop additional signs of acute babesiosis, such as anorexia and neurological symptoms, and were able to control acute infection, transitioning to subclinical infection without the administration of anti-pyretic or babesicidal therapeutics. Collectively, results confirmed that the Att-S74-T3Bo B. bovis strain establishes infection in calves, which is characterized by moderate parasite replication in peripheral blood, significant increase in temperature, and marginal drop in PCV.

After demonstrating that Att-S74-T3Bo infected calves without causing severe acute disease, we further investigated whether these animals were protected against the homologous virulent strain Vir-S74-T3Bo. To test this proposition, Att-S74-T3Bo-inoculated and control calves were infected IV with 10⁷ Vir-S74-T3Bo iRBC at day 46 after the Att-S74-T3Bo infection. All animals were monitored daily for clinal signs of acute bovine babesiosis and parasite load in peripheral blood. A significant increase (P<0.05) in temperature, combined with a marked drop in PCV, was observed in all three control animals starting at day 11 after Vir-S74-T3Bo infection compared to the calves previously inoculated with Att-S74-T3Bo ( Figures 2A, B ). Following the regulations of the approved IACUC protocol, two calves in the control group were humanely euthanized at days 13 and 14 after Vir-S74-T3Bo infection due to the severity of the acute disease. Temperature of the control calf that did not succumb to acute disease returned to physiological levels around day 16 post-infection; however, the animal’s PCV values remained low until day 21 after infection ( Figure 2B ). No significant alterations in temperature and PCV were observed in the calves previously infected with Att-S74-T3Bo ( Figures 2A, B ). Parasite load in Att-S74-T3Bo-infected calves reached a peak of 5x10³ copies of B. bovis msa-1/100 µl of blood at day 9 after Vir-S74-T3Bo superinfection, and then it was intermittently detected until 45 days post-superinfection when the experiment was terminated ( Figure 2C ). In contrast, control animals showed a significant increase (P<0.05) in parasite load starting at day 10 after Vir-S74-T3Bo infection, which peaked at day 13 post-infection (approximately 10⁶ copies of B. bovis msa-1/100 µl of blood). The control calf that survived acute disease exhibited a decrease in parasite load to approximately 10⁴-10⁵ copies of B. bovis msa-1/100 µl of blood, starting at day 15 post-Vir-S74-T3Bo infection ( Figure 2C ). Altogether, results demonstrate that calves previously infected with Att-S74-T3Bo were fully protected against the virulent homologous strain Vir-S74-T3Bo.

The observation that Att-S74-T3Bo infection protects cattle against a homologous virulent strain prompted us to investigate alterations in blood cells in the protected animals ( Figure 3 ). Despite a marginal decreased in total leukocytes and lymphocytes at day 3 after Att-S74-T3Bo infection, and subsequently through days 10 and 14 after Vir-S74-T3Bo infection in control animals, no significant alterations were observed in these cell populations among experimental animals ( Figures 3A–D ). In contrast, data demonstrated a significant (P<0.05) monocytosis on days 7 and 10 post-Att-S74-T3Bo infection ( Figure 3E ). No alterations in monocytes were detected in Att-S74-T3Bo-inoculated calves after superinfection; however, the one control animal that survived Vir-S74-T3Bo infection showed an increase of monocytes starting at day 16 after infection ( Figure 3F ). A significant decrease in neutrophils in peripheral blood was observed starting at day 3 post-Att-S74-T3Bo inoculation, which returned to physiological levels at day 10 post-infection ( Figure 3G ). Neutrophils also decreased significantly in the control animals starting at 12 days after Vir-S74-T3Bo infection, but no alterations were detected in Att-S74-T3Bo-inoculated animals post-Vir-S74-T3Bo superinfection ( Figure 3H ). Att-S74-T3Bo infection did not alter the total number of RBC ( Figure 3I ), confirming our observation of the absence of significant changes in PCV after infection. On the other hand, control animals developed a dramatic and significant decrease in the number of RBC starting at day 12 after Vir-S74-T3Bo infection ( Figure 3J ). No significant changes in the absolute numbers of reticulocytes after infections with Att-S74-T3Bo and Vir-S74-T3Bo were observed, except for the one control calf that survived Vir-S74-T3Bo infection that showed a peak of reticulocytes at day 18 post-infection ( Figures 3K, L ). Combined, these results demonstrate significant alterations of monocytes and neutrophils in peripheral blood starting at day 3 after Att-S74-T3Bo infection. No significant changes were observed in blood cells of the protected Att-S74-T3Bo-inoculated animals after superinfection with Vir-S74-T3Bo. Interestingly, the control calf that did not succumb to Vir-S74-T3Bo infection developed a similar but delayed pattern of alterations for neutrophils and monocytes compared to protected Att-S74-T3Bo-infected animals.

After showing significant alterations in monocytes and neutrophils in whole blood of protected calves, we investigated in more details the dynamics of PBMC populations in Att-S74-T3Bo-infected animals following Vir-S74-T3Bo superinfection. To that end, we used flow cytometric analysis to examine the percentage of CD4⁺ T cells, CD8⁺ T cells, γδ T cells, B cells, NK cells, and monocytes in PBMC during acute infection with Att-S74-T3Bo following superinfection with Vir-S74-T3Bo ( Figure 4 ). Flow cytometry results of PBMC stained for CD4⁺ T cells, CD8⁺ T cells, γδ T cells, B cells, NK cells, and monocytes from a representative uninfected calf are presented in Figure 4A . Calves infected with Att-S74-T3Bo developed a moderate but significant lymphocytopenia of CD4⁺ T cells at day 7 post-infection ( Figure 4B ). No alterations in CD8⁺ T cells, γδ T cells, B cells, and NK cells were observed after Att-S74-T3Bo inoculation ( Figure 4B ). Percentage of monocytes in PBMC increased significantly in Att-S74-T3Bo-infected calves at day 7 post-infection compared to controls ( Figure 4B ), confirming our previous results in whole blood. No significant alterations were detected in CD4⁺ T cells, CD8⁺ T cells, γ™; T cells, B cells, and monocytes after Vir-S74-T3Bo infection ( Figure 4C ). A significant decrease in NK cells at day 9 after Vir-S74-T3Bo infection was observed in control calves in comparison to Att-S74-T3Bo-inoculated animals ( Figure 4C ). As demonstrated in whole blood, the calf that survived Vir-S74-T3Bo infection presented a marked increase of monocytes in PBMC; however, this alteration was delayed compared to the Att-S74-T3Bo-inoculated animals and occurred at day 15 post-Vir-S74-T3Bo infection ( Figure 4C ). In summary, data demonstrated early monocytosis combined with decrease of neutrophils and CD4⁺ T cells in peripheral blood of Att-S74-T3Bo-inoculated calves that were protected against Vir-S74-T3Bo. In addition, the control calf that survived infection did present monocytosis and neutropenia late after Vir-S74-T3Bo inoculation compared to Att-S74-T3Bo-inoculated protected animals.

After demonstrating alterations in the profile of blood cells following infections with Att-S74-T3Bo and Vir-S74-T3Bo, we investigated the immune responses induced in Att-S74-T3Bo-inoculated protected animals. Immunoblot results indicated that all three Att-S74-T3Bo-infected animals developed IgG antibodies to parasite antigens ( Figure S1 ). Immunoblot data also showed that no antibodies to B. bovis antigens were detected in serum of the control calves 14 days after Vir-S74-T3Bo infection, when all three animals were exhibiting marked signs of acute babesiosis and two of them were euthanized due to the severity of the disease ( Figure S1 ). In fact, antibodies to parasite antigens were detected in serum of the control calf that survived Vir-S74-T3Bo infection only at day 21 post-inoculation, by the time that acute disease had been resolved. iELISA was performed using the immune dominant B. bovis RAP-1 CT as antigen to investigate the level of IgM, total IgG, IgG1, and IgG2 after Att-S74-T3Bo and Vir-S74-T3Bo infections. Data demonstrated detectable levels of anti-RAP-1 CT IgM in all three Att-S74-T3Bo-infected animals starting at 10 days post-infection ( Figure 5A ). After that, the levels of IgM remained marginal and peaked dramatically again at day 21 after Vir-S74-T3Bo superinfection (67 days after Att-S74-T3Bo infection). Levels of total IgG and IgG1 against RAP-1 CT showed a sharp increase starting at day 30 after Att-S74-T3Bo infection, and it remained at those levels until the end of the experiment at 21 days post-Vir-S74-T3Bo superinfection ( Figures 5B, C ). Comparatively, anti-RAP-1 CT IgG2 levels were lower than IgG1, and one Att-S74-T3Bo-infected animal developed only marginal levels of this immunoglobulin subclass ( Figure 5D ). Noteworthy, no boost effect was observed in the levels of anti-RAP-1 CT IgG after Vir-S74-T3Bo superinfection. No presence of IgM, total IgG, IgG1, and IgG2 to RAP-1 CT were detected in control calves in the first 14 days after Vir-S74-T3Bo infection ( Figure 5 ), confirming our immunoblot results described above. In fact, the control calf that survived Vir-S74-T3Bo infection developed only minimal levels of IgM and IgG starting at day 21 after inoculation when the symptoms of acute disease had been resolved ( Figures 2 , 3 , 5 ). Next, we evaluated the presence of soluble polypeptides for IFNγ, IL-1β, IL-4, IL-6, IL-8, IL-10, CXCL10, and TNFα in serum of animals following infections with Att-S74-T3Bo and Vir-S74-T3Bo ( Figure 6 ). Quantitative analysis revealed significant levels of the pro-inflammatory cytokines TNFα, IFNγ, and CXCL10 at day 6 after Att-S74-T3Bo infection compared to uninfected control animals ( Figure 6A ). Also, the Att-S74-T3Bo-infected calves developed significant levels of IL-10 at days 3 and 6 post-infection, and IL-4 at day 12 post-infection ( Figure 6A ). IL-6 and IL-8 were not detected in sera from Att-S74-T3Bo-infected animals (data not shown). No significant differences were found in the levels of TNFα, CXCL10, and IFNγ after infection with Vir-S74-T3Bo, despite the slightly higher concentration of these cytokines in serum from calves previously inoculated with Att-S74-T3Bo compared to controls ( Figure 6B ). No significant levels of IL-10 were detected in Att-S74-T3Bo-infected and control animals after Vir-S74-T3Bo infection, except for an increase of this cytokine in control calves at 13 days post-infection, at the time two control animals were euthanized due to the severity of acute disease ( Figure 6B ). Interestingly, Att-S74-T3Bo-inoculated animals showed significant levels of IL-4 at days 3 and 6 post-Vir-S74-T3Bo infection compared to controls ( Figure 6B ). No detectable levels of IL-6 and IL-8 were found in sera after Vir-S74-T3Bo infection (data not shown). Altogether, these data indicate that Att-S74-T3Bo infection results in the development of protective immune responses in calves characterized by early expression of a balance of inflammatory and regulatory cytokines in peripheral blood, and significant levels of antibodies to B. bovis antigen late during infection. In addition, no significant alteration in the levels of IFNγ, IL-1β, IL-4, IL-6, IL-8, IL-10, CXCL10, and TNFα was observed in peripheral blood after Vir-S74-T3Bo infection by comparing Att-S74-T3Bo-inoculated and naïve control animals.