Recent RNA-seq analysis of neutrophils from COVID-19 patients revealed that Dok3 expression is elevated in severe disease cases, suggesting an association with SARS-CoV-2 infection in humans (17). To investigate if Dok3 is involved in calprotectin production in neutrophils during SARS-CoV-2 infection, we stimulated wild-type (WT) and Dok3^-/- neutrophils isolated from mouse bone marrow cells with the ancestral WT SARS-CoV-2 S protein, which has previously been shown to activate both mouse and human immune cells (18), and analyzed for the release of calprotectin (S100a8/9 heterodimer) into the culture medium by ELISA. We observed that treatment with S protein induces a significant increase in calprotectin secretion by Dok3^-/- but not WT neutrophils ( Figure 1A ). Similarly, we found that S100a8 and S100a9 expression were significantly higher in Dok3^-/- as compared to WT neutrophils upon S protein stimulation ( Figure 1B ), suggesting that Dok3 is required to suppress calprotectin production by neutrophils during SARS-CoV-2 infection. Since the S protein can activate immune responses in mouse neutrophils, we further examine the production of calprotectin in vivo upon intranasal instillation of S protein in mice. Our histological and flow cytometry analyses revealed higher levels of S100a8 and S100a9 expressed by Dok3^-/- as compared to WT neutrophils in the lungs 24h following S protein administration ( Figures 1C, D ). Moreover, circulating level of calprotectin is significantly increased in Dok3^-/- mice treated with the S protein ( Figure 1E ). Calprotectin are potent initiators and amplifiers of inflammation via activation and recruitment of circulating leukocytes. Indeed, we detected increased numbers of S100a8- and S100a9-producing cells, which are defined to be neutrophils via flow cytometry, accumulating in the lungs of Dok3^-/- mice ( Figure 1D and Supplementary Figure S1 ). These reflect a positive feedback loop, in which loss of Dok3 leads to elevated calprotectin production by neutrophils, which subsequently triggers further recruitment of calprotectin-producing neutrophils into the lungs, thereby amplifying aberrant immune responses. Taken together, our data indicate that Dok3 plays a key role in the negative regulation of calprotectin production by neutrophils in response to S protein of SARS-CoV-2.

The S protein of SARS-CoV-2 has been reported to interact with host receptors TLR2, TLR4 and ACE2 to activate inflammatory immune responses (18–21). To determine which receptor is responsible for sensing S protein upstream of Dok3, we treated WT and Dok3^-/- neutrophils with various inhibitors in the presence of S protein and compare their expression of calprotectin. Treatment with selective TLR4 inhibitor Resatorvid (TAK-242) abolished the enhanced production of S100a8 by Dok3^-/- neutrophils ( Figure 1F ), whereas inhibition of other receptors involved in viral recognition, such as the cell surface ACE2 and TLR2, and the intracellular TLR7 and TLR9, had no effect on S100a8 expression ( Supplementary Figure S2 ). These suggest that TLR4 signaling drives calprotectin production in Dok3^-/- neutrophils. To verify if S protein can interact directly with TLR4, we perform co-immunoprecipitation (co-IP) studies with overexpressed TLR4 and SARS-CoV-2 S protein, and observed that both mouse and human TLR4 could interact with the S protein ( Figure 1G ). Endogenous co-IP using lysates from mouse bone marrow neutrophils also revealed interaction between TLR4 and SARS-CoV-2 S protein ( Figure 1H ). Moreover, TLR4 agonist lipopolysaccharide (LPS) also induced a significant increase in S100a8 levels in Dok3^-/- neutrophils ( Figures 1G, I ). Collectively, these revealed that Dok3 inhibits neutrophil production of calprotectin during TLR4 sensing of SARS-CoV-2 S protein.

MD2 is a co-receptor of TLR4 involved in LPS sensing. To determine if MD2 plays a role during TLR4 sensing of SARS-CoV-2 S protein, we treated WT and Dok3^-/- neutrophils with a MD2 inhibitor MD2-IN-1. Here, we observed that MD2 inhibition can abolish the enhanced production of S100a8 by Dok3^-/- neutrophils ( Figure 1J ), suggesting that TLR4/MD2 complex is required for sensing of SARS-CoV-2 S protein in neutrophils.

Activation of TLR4 signaling by LPS has been reported to induce Dok3 degradation in macrophages (22). To determine if Dok3 is also degraded upon TLR4 activation in neutrophils, we examined Dok3 protein expression in WT neutrophils upon stimulation with S protein or LPS. However, Dok3 expression in TLR4 ligands-stimulated neutrophils remained stable over time, unlike that in LPS-treated macrophages ( Supplementary Figure S3 ). This suggest that Dok3 in neutrophils might function in a distinct signaling pathway from macrophages downstream of TLR4.

MyD88 is a central adaptor protein crucially involved in relaying signals downstream of TLR4 to initiate kinase-dependent signaling during innate immune responses. Recent clinical data suggest that increased expression of MyD88 is associated with the development of severe COVID-19 (23, 24). As such, we postulate that Dok3 may exert an effect on MyD88 during the regulation of TLR4-dependent calprotectin production. To examine possible interactions between Dok3 and MyD88, we overexpressed Dok3 and MyD88 in HEK293T cells, and observed that Dok3 co-IP with MyD88, suggesting an interaction between the two molecules ( Figure 2A ). Similarly, co-IP experiment using cell lysates from mouse bone marrow neutrophils revealed that Dok3 and MyD88 form a complex endogenously ( Figure 2B ). Hence, Dok3 is likely to suppress calprotectin production in neutrophils through a MyD88-dependent mechanism.

Dok3 is a non-catalytic adaptor molecule which controls post-translational regulation by directing various enzymes to their target proteins downstream of immuno-receptors (15, 16). A recent study demonstrated that the activity of MyD88 can be regulated post-translationally via phosphorylation of tyrosine residues (25). Indeed, we observed that loss of Dok3 led to elevated phosphorylation of MyD88 at Y257 in Dok3^-/- as compared to WT neutrophils upon stimulation with S protein, indicating that Dok3 mediates the de-phosphorylation of MyD88 in response to SARS-CoV-2 S protein stimulation ( Figure 2C ).

To delineate the functional role of MyD88 Y257 phosphorylation, we investigated NF-kB and MAPK signaling pathways downstream of MyD88 which are involved in the regulation of inflammatory cytokine production during SARS-CoV-2 infection (24). However, no difference in Erk, NF-kB and p38 activation were observed, and the transcription of inflammatory cytokine genes such as il1b, il6 and tnfa were comparable between WT and Dok3^-/- neutrophils ( Supplementary Figures S4A, B ). We next examined JAK2-STAT3 signaling which was previously implicated in calprotectin production in Dok3^-/- colonic neutrophils (26), and detected higher levels of phospho-JAK2 (Y1007/1008) ( Figures 2, D, E ) and its downstream target, phospho-STAT3 (Y705) ( Figures 2F, G ), in Dok3^-/- neutrophils upon stimulation with S protein. On the other hand, phosphorylation of STAT3 at inactivating residue S727 remains unaffected ( Supplementary Figure S4C ). In addition, treatment with a selective STAT3 inhibitor, STATTIC, was able to block S100a8 upregulation in Dok3^-/- neutrophils efficiently in the presence of S protein ( Figure 2H ), thus validating the direct involvement of JAK2-STAT3 pathway in calprotectin production. Previous studies revealed that JAK2 can be activated via direct association with the TLR4-MyD88 complex during LPS signaling (27), but how this complex formation is being regulated remains unknown. Since the highly phylogenetically conserved Y²⁵⁷KXM motif in MyD88 is a putative SH2 binding site (28), we investigated if phosphorylation of MyD88 at Y257 can regulate JAK2 binding with MyD88. To this end, we performed an endogenous co-IP in neutrophil cell lysates with anti-MyD88 antibody, and found an increased association of JAK2 with MyD88 in Dok3^-/- neutrophils, and these MyD88 molecules were more highly phosphorylated on Y257 than those in WT neutrophils ( Figure 2I ). Collectively, these data indicate that Y257 phosphorylation on MyD88 acts as a molecular switch to turn on downstream JAK2-STAT3 signaling for calprotectin production upon TLR4 recognition of SARS-CoV-2 S protein.

Since Dok3 is an adaptor protein which lacks intrinsic catalytic activity, we postulate that it could act as a scaffold to recruit a protein tyrosine phosphatase (PTP) to mediate the de-phosphorylation of MyD88 at Y257. SH2 domain-containing protein tyrosine phosphatase-2 (SHP-2) is a PTP highly expressed in hematopoietic cells. To examine possible interactions among Dok3, SHP-2 and MyD88, we overexpress them in HEK293T cells, and observed that Dok3 interacts with MyD88, while SHP-2 co-IP with MyD88 only in the presence of Dok3 ( Figure 3A ). These data indicate that Dok3 is required to bridge the interaction between SHP-2 and MyD88.

Dok3 is a multidomain adaptor protein containing a N-terminal PH, a central PTB and C-terminal tyrosine-rich SH2 domain ( Figure 3B ). To further characterize the interaction between Dok3, MyD88 and SHP-2, we overexpressed variants of Dok3 bearing specific domains together with MyD88 or SHP-2 and examined their physical associations via co-IP experiments. We observed that MyD88 can co-IP with full-length Dok3 as well as the truncated variant bearing the PH domain of Dok3 ( Figure 3C ). Similarly, SHP-2 was observed to bind full-length Dok3 and the variant bearing the PH domain of Dok3 ( Figure 3D ). Hence, Dok3 interacts with both MyD88 and SHP-2 via its N-terminal PH domain.

To determine the role of SHP-2 in the de-phosphorylation of MyD88, we treated WT neutrophils with SHP-2 inhibitor PHPS1, and observed a dose-dependent increase in Y257 phosphorylation on MyD88, thus confirming that SHP-2 can act specifically on MyD88 ( Figure 3E ). Moreover, PHPS1 treatment enhances JAK2 association with MyD88 and results in an increased S100a8 and S100a9 production by WT neutrophils in a dose-dependent manner upon stimulation with the S protein ( Figures 3E-G ). We further showed that phosphorylation of SHP-2 on Y580 ( Supplementary Figure S5 ), and hence its activity, is not affected by loss of Dok3, implying that altered SHP-2 activity is unlikely to be responsible for enhanced MyD88 Y257 phosphorylation in the absence of Dok3. Taken together, our results suggest that Dok3 is required to recruit SHP-2 to de-phosphorylate Y257 on MyD88 for the suppression of calprotectin production during SARS-CoV-2 infection.

JAK inhibitors have been proposed as therapy for severe COVID-19 patients on the basis that JAKs are important mediators in the cytokine storm (29–31). However, whether these inhibitors can modulate calprotectin levels to improve COVID-19 outcome remains unknown. To this end, we treated WT and Dok3^-/- neutrophils with clinically approved JAK2 and STAT3 inhibitors, including Ruxolitinib, Baricitinib, Fedratinib, Momelotinib and Atovaquone, in the presence of S protein. Among them, we observed that Fedratinib and Momelotinib were able to significantly reduce S100a8 expression by Dok3^-/- neutrophils to WT levels ( Figure 4A ), suggesting that these 2 inhibitors can efficiently block the JAK2-STAT3 signaling pathway downstream of Dok3 to prevent aberrant release of calprotectin in response to SARS-CoV-2 S protein.

To further examine the relevance of our study in human context, we stimulated human neutrophils isolated from peripheral blood of healthy donors with the S protein of SARS-CoV-2. In line with our mouse data, we do not see an induction of S100a8 by human neutrophils in response to S protein ( Figure 4B ). This is also consistent with clinical data which shows that plasma calprotectin levels in COVID-19 patients with mild disease are not elevated as compared to healthy controls (8). Consequently, Fedratinib and Momelotinib treatment only resulted in a minor decrease in S100a8 level ( Figure 4B ). Since our earlier findings indicated that SHP-2 negatively regulates calprotectin production through de-phosphorylating MyD88, we treated human neutrophils with PHPS1 and observed a significant increase in S100a8 production. Moreover, Fedratinib and Momelotinib can block PHPS1-induced S100a8 production ( Figure 4B ), further confirming that JAK2 functions downstream of SHP-2 during calprotectin production. Together, these findings provide a rationale for the use of JAK2 inhibitors Fedratinib and Momelotinib to treat severe COVID-19 patients since they can attenuate calprotectin production in neutrophils.

The SARS-CoV-2 Delta (B.1.617.2) and Omicron (B.1.1.529) variants harbor distinct amino acid mutations in their S proteins which result in the evasion of host immune responses. As such, we evaluate if these variant S proteins are able to trigger TLR4 signaling in neutrophils by performing co-IP experiments using overexpressed or endogenous TLR4 and Delta or Omicron variant S protein. Interestingly, both Delta and Omicron variant S proteins retained their ability to bind mouse and human TLR4 ( Figures 5A–D ), and this resulted in an enhanced production of S100a8 and S100a9 by Dok3^-/- as compared to WT neutrophils ( Figures 5E, F ). Together, these show that likewise to WT SARS-CoV-2, both Delta and Omicron variant S proteins can activate TLR4-driven calprotectin production in Dok3^-/- neutrophils.

C57BL/6 mice were purchased from The Jackson Laboratory. Dok3^-/- mice were generated as described previously (43). Dok3^-/- mice were backcrossed to C57BL/6 mice for more than 10 generations. Male and female mice were used at 8 to 10 weeks of age unless otherwise stated. All mice were maintained under specific pathogen-free conditions at A*STAR Biological Resource Centre (BRC).

Neutrophils were isolated from tibias and femurs of mice using EasySEP Mouse Neutrophil Enrichment Kit (Stem Cell Technologies). Purity of isolated cells was confirmed by flow cytometry. Cells were stimulated with 1μg/ml recombinant SARS-CoV-2 S protein (10549-CV, R&D Systems), B.1.617.2 S protein (10942-CV), B.1.1.529 S protein (SPN,C52Hz, Acro Biosystems) or LPS for indicated time periods.

Venous blood of healthy human donors was collected and diluted 1:1 in PBS before overlaying on Ficoll-Paque Plus (Cytiva). After density gradient centrifugation, the polymorphonuclear and erythrocyte-rich pellet was collected, and cells were treated with red blood cell lysis buffer for 15 min at room temperature. Cells were subsequently washed with PBS, and neutrophils obtained were resuspended in PBS and rested at 37°C for 1 h.

Purified neutrophils were treated with the following inhibitors for 2-4 hours at 37°C: TAK-242 (HY-11109, MedChem Express), STATTIC (sc-202818, Santa Cruz Biotechnology Inc.), Ruxolitinib (HY-50856, MedChem Express), Baricitinib (HY-15315, MedChem Express), Fedratinib (HY-10409, MedChem Express), Momelotinib (HY-10961, MedChem Express), Atovaquone (HY-13832, MedChem Express), MLN-4760, C29 (HY-100461, MedChem Express) and AT791 (HY-124603, MedChem Express).

Cell suspensions were surface labelled with fluorochrome-conjugated antibodies for 10 minutes at 4°C in staining buffer (PBS containing 1% BSA). For phosphoprotein staining, cells were fixed and permeabilized using the Phosflow kit (BD) according to manufacturer’s protocol before staining for 1 hour at room temperature. Data were acquired using LSRII (BD Biosciences) and analyzed using FlowJo software (Tree Star). The following antibodies were used for flow cytometry analysis: anti-CD45 APC/Cy7 (clone 30-F11; BioLegend), anti-Ly6G PE/biotin (clone 1A8; BD, BioLegend), anti-STAT3 (Y705) PE (clone 4/P-STAT3, BD Biosciences), anti-STAT3 (S727) PE (clone 49/P-STAT3, BD Biosciences), anti-pJAK2 (Y1007,1008) Alexa Fluor 647 (clone E132, abcam), anti-Erk1/2 (pT202/Yp204) PE (612593, BD Biosciences), anti-pIKKα/β (S176/180) PE (14938S, Cell Signaling Technology), anti-p-p38 (T180/Y182) FITC (612594, BD Biosciences), anti-S100a8 (clone E4F8V; Cell Signaling Technology), anti-S100a9 (clone D3U8M; Cell Signaling Technology), anti-pSHP2 (Y580) PE (MA5-28045, Invitrogen), goat anti-rabbit IgG (H+L) secondary antibody FITC (Invitrogen).

20μg of S protein was administered intranasally to WT and Dok3^-/- mice. PBS was used as a negative control. At 24h post-administration, lungs were harvested for flow cytometry analysis or fixed in 4% PFA overnight. For immunohistochemistry, lung sections were stained with anti-S100a8 (clone E4F8V; Cell Signaling Technology), anti-S100a9 (clone D3U8M; Cell Signaling Technology), according to manufacturer’s instructions.

Neutrophils were stimulated with or without S protein in RPMI (Gibco), and cell culture medium was collected after 5 hours. The release of calprotectin into the supernatant was measured by ELISA (ab263885), according to the manufacturer’s instructions.

For endogenous co-IP, purified neutrophils were stimulated with S protein for 15 minutes before lysis with cell lysis buffer (Cell Signaling Technology) containing protease and phosphatase inhibitors (Cell Signaling Technology). For overexpression studies, HEK293T cells were transfected with the plasmid overnight using lipofectamine (Invitrogen) before lysis with cell lysis buffer. Cell lysates were IP overnight using the indicated antibodies and pulled down using Protein A/G Plus Agarose beads (Santa Cruz Biotechnology Inc.): anti-His (clone H-3; Santa Cruz Biotechnology Inc.), anti-HA (clone F-7; Santa Cruz Biotechnology Inc.), anti-MyD88 (clone E-11; Santa Cruz Biotechnology Inc.), anti-Dok3 (clone H-5; Santa Cruz Biotechnology Inc.), anti-SHP-2 (clone B-1; Santa Cruz Biotechnology Inc.). Precipitates were analyzed by Western blotting according to standard protocol.

Cells were lysed with cell lysis buffer (Cell Signaling Technology) containing protease and phosphatase inhibitors (Cell Signaling Technology). Cell lysates were analyzed by Western blotting according to standard protocol using the indicated antibodies: anti-pSTAT3 (Y705) (clone D3A7; Cell Signaling Technology), anti-STAT3 (clone 79D7; Cell Signaling Technology), anti-pJAK2 (Y1007/1008) (3771S; Cell Signaling Technology), anti-JAK2 (clone C-10; Santa Cruz Biotechnology Inc.), anti-pMyD88 (Y257) (PA5-64835; Invitrogen), anti-MyD88 (clone E-11; Santa Cruz Biotechnology Inc.), anti-S100a8 (clone E4F8V; Cell Signaling Technology), anti-S100a9 (clone D3U8M; Cell Signaling Technology), anti-Dok3 (clone H-5; Santa Cruz Biotechnology Inc.), anti-β actin (clone C-4; Santa Cruz Biotechnology Inc.), anti-GAPDH (clone 1D4; Santa Cruz Biotechnology Inc.), peroxidase affinipure goat anti-rabbit IgG (H+L) (Jackson ImmunoResearch), m-IgGκ BP-HRP (Santa Cruz Biotechnology Inc.).

Purified neutrophils were lysed with TRIzol (Life Technologies), and RNA was purified using phenol/chloroform extraction. Complementary DNA was reversed transcribed using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The following primers were used for real-time PCR using SYBR Green PCR Master Mix (Applied Biosystems): IL6 (forward): GAGGATACCACTCCCAACAGACC; IL6 (reverse): AAGTGCATCATCGTTGTTCATACA; IL1β (forward): CAACCAACAAGTGATATTCTCCATG; IL1β (reverse): GATCCACACTCTCCAGCTGCA; TNFα (forward): GCCTCTTCTCATTCCTGCTTG; TNFα (reverse): CTGATGAGAGGGAGGCCATT; β-actin (forward): AGATGACCCAGATCATGTTTGAGA; β-actin (reverse): CACAGCCTGGATGGCTACGTA.

Figures and statistical analyses were generated using Graphpad Prism software. Mice were allocated to experimental groups based on genotypes and were randomized within their sex- and age-matched groups. No mouse was excluded from the analyses. Unpaired 2-tailed Student’s t test was performed. A P value of less than 0.05 was considered significant.

All mouse protocols were conducted in accordance with guidelines from and approved by the A*STAR BRC Institutional Animal Care and Use Committee. Human blood was obtained for research with approval from the Centralised Institutional Research Board of the Singapore Health Services in Singapore.