Clinically isolated S. aureus strains that were used to amplify coding sequences of leukocidins are listed in Supplementary Table 1 . Polyhistidine-tagged HlgA, HlgB, HlgC, LukS-PV, and LukF-PV in this study were cloned and expressed by pET303-6x-His plasmid, as described elsewhere (15). Briefly, the coding sequences without encoding the signal peptide were cloned and transformed into E. coli BL21-pLyss. To obtain the high expression of polyhistidine-tagged protein, isopropyl-β-d-thiogalactoside (IPTG) was added during exponential growth of transformed E. coli. Target proteins were purified from supernatants of cell lysates using a HisPur™ Ni-NTA kit (Thermo Scientific, no. 90099). The E. coli endotoxin Lipopolysaccharide (LPS) was removed using a Pierce™ kit (Thermo Scientific, no. 88276).

Isolated S. aureus strains used during this study are shown in Supplementary Table 1 . In-frame deletion of gamma toxin genes (ΔhlgABC) from the clinically isolated S. aureus CI6 strain were constructed by the use of a pMAD plasmid, as described previously (16). The method to produce implementation of HlgACB mutants is described in a previous study (7). Specific primers that were designed are shown in Supplementary Table 2 . Clinical S. aureus strains CI6, isolated from bronchoalveolar lavage fluids, were originated from patients admitted to the Respiratory Intensive Care Unit of The First Affiliated Hospital of Chengdu Medical College, China. The vitek 2 automatic microbiological identification analyzer and 16s ribosomal RNA (rRNA) sequencing were applied for microbial identification, and disk diffusion was used to perform antimicrobial susceptibility. All strains were cultured in trypticase soy broth or brain heart infusion broth, and overnight supernatants of S. aureus culture were filter-sterilized. For animal experiments, mid-exponential subcultures of experimental strain were washed adequately in Phosphate Buffer Saline (PBS). All isolated S. aureus strains were typed using the multilocus sequence typing method (17). PCRs were performed on S. aureus genomic DNA for amplifying leukocidin S component, and specific primers that were designed are shown in Supplementary Table 3 .

RNA was extracted from S. aureus samples by a TRIzol kit (Thermo scientific) following the manufacturer’s instructions. Overnight cultured bacteria were diluted in fresh medium and continue to culture until early stationary phase (6.5 h; OD660 ± 1.5). Bacteria were centrifuged at 12,000 rpm for 30 s. Centrifugal precipitation were kept in −80°C to stop cell metabolism and resuspended in TRIzol buffer. Contaminating DNA was eliminated by consecutive mix of samples with a DNase I, RNase-free kit (Thermo Scientific). Total RNA quantification was detected by an ultraviolet spectrophotometer Evolution 350 (Thermo Scientific), and quality was verified again on agarose gel eletrophoresis. Contamination with DNA was excluded by a PCR against chromosomal DNA. Isolated equal RNA was used for synthesis of complementary DNA (cDNA) by the cDNA Synthesis Kit for RT-qPCR (Thermo Scientific).

Lungs were excised, and the right lungs were fixed in 4% formaldehyde for 24 h and then embedded in paraffin. The paraffin-embedded lung tissues were cut and stained by hematoxylin and eosin. Immunoblotting assay was performed, as described previously (18).

Phagocyte receptor expression levels were quantified, as described elsewhere (7). Briefly, THP-1 cells were suspended in a total of 5 mL at 5 × 10⁶/mL with mouse anti-human monoclonal antibodies (mAbs; 10 µg/mL) for C5aR1 (sulfation-independent clone S5/1, AbD Serotec, Kidlington, UK) and mouse anti-human mAbs for C5aR1 (sulfation-dependent clone 347214, R&D Systems, Abingdon, UK), followed by the fluorescein isothiocyanate–conjugated goat anti-mouse secondary antibody (1:50, LifeSpan BioSciences, Seattle, WA, USA). Samples were subsequently analyzed by flow cytometry. To measure the leukocidin S-component binding on THP-1 cells, they were incubated with polyhistidine-tagged HlgC or LukS-PV (20 µg/mL) for 25–30 min at room temperature followed by mouse anti–his-fluorescein isothiocyanate (FITC) antibody (1:30, LifeSpan BioSciences, Seattle, WA, USA). Cells were subsequently analyzed by flow cytometry.

THP-1 cells (a human monocytic leukemia cell line) stably transfected with C5aR1 or an empty expression vector. Human C5aR1, residing on a single exon, was cloned into a pcDNA3.1 vector (Invitrogen), as described previously (11). Amplification reactions were performed on Applied Biosystems of the previous cloned humanized cells using PrimeSTAR^® Max DNA Polymerase (TaKaRa). Primers and restriction sites used during the study are listed in Supplementary Table 4 . For stable expression, the target plasmids were transfected into THP-1 cells using Lipofectamine 3000 (Invitrogen). Cells 24 h after transfection were cultured under antibiotic selective pressure using puromycin (1 µg/mL) in Dulbecco's modified eagle medium (DMEM) with 10% fetal calf serum. After 2 to 3 weeks, cells were subcloned and tested for stable expression of C5aR1 using flow cytometry. The expression of human C5aR1 on transfected THP-1 cells was defined using mouse anti-human mAbs (10 µg/mL) for C5aR1, followed by the Allophycocyanin (APC)-labeled goat anti-mouse secondary antibody (1:50, DAKO). Receptor expression was subsequently analyzed by flow cytometry. The human promyelocytic leukemia cell line HL-60 was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco, Grand Island, NY, USA) with 10% Foetal Bovine Serum (FBS) (Gibco, Grand Island, NY, USA) and 2 mM L-glutamine (HyClone, Logan, UT, USA) in a 37°C incubator with a humidified 5% CO₂ atmosphere. The murine macrophage cells RAW264.7 were stored in our laboratory. The cells were cultured in DMEM with 10% FBS, streptomycin (100 µg/mL), and penicillin (100 U/mL) and at 37°C with 5% CO₂. For experiments, the above cells (seeded at 4 × 10⁵ cells/mL) were challenged by LPS (100 ng/mL) for 8 h, as described previously (19).

We used Clustered regularly interspaced short palindromic repeats--associated protein 9 (CRISPR-cas9) technique to construct TPST2^flox+/− and Cre mice. The guide RNA (gRNA) (gRNA1 reverse: GTCCTCTGTGCCCGACGTCAGGG; gRNA2 forward: ACATAAAAGTCACCCACGTGTGG) to mouse TPST2 gene, the donor vector containing loxP sites, and Cas9 mRNA were co-injected into fertilized mouse eggs to generate targeted conditional knockout (cko) offspring. F0 founder animals were identified by PCR (5′ arm forward primer (F1): 5′-CTGTGTCAGTCACCAGCCATAG-3′; 3′ loxP reverse primer (R1): 5′-GTGGATTCGGACCAGTCTGA-3′) followed by sequence analysis, which were bred to wild-type (WT) mice to test germline transmission and F1 animal generation. Heterozygous TPST2^flox+/− targeted mice were inter-crossed to generate homozygous targeted TPST2^flox+/+ mice; then, homozygous TPST2^flox+/+ targeted mouse was breed with a myeloid-specific Lyz-Cre delete mouse to generate mice that are hemizygous for a targeted allele and a hemizygous for the Cre transgene. Hemizygous Cre⁺ mice were breed with homozygous mice; approximately 25% of the progeny from this mating will be homozygous for the targeted allele and hemizygous for the Cre transgene. The pups can be screened by the PCR (F: 5′-CTTGAGTGCCAACTAAGTCCCAAG-3′; R: 5′-AATGATGGGATGAGTGCCTGAATG-3′; homozygous: one band with 308 bp; heterozygous: two bands with 308 and 240 bp; WT: one band with 240 bp) and immunoblot assay. The tissue-specific gene deletion can be confirmed by adding one additional primers (F: 5′-CTTGAGTGCCAACTAAGTCCCAAG-3′; R: 5′-AATGATGGGATGAGTGCCTGAATG-3′; wild type: one band with 240 bp; no Cre activity: one band with 308 bp) and primer (F: 5′-CTTGAGTGCCAACTAAGTCCCAAG-3′, R: 5′-TAACTTCAGTGTGCCCGGTTAG-3′; with Cre activity: one band with 293 bp) to the PCR assay.

Eight- to 12-week-old age- and gender-matched mice were intraperitoneally injected with 1 mL of PBS containing 5 × 10⁸ colony-forming units (CFU) of bacteria or intravenously injected with 0.5 mL of PBS containing 1 × 10⁸ CFU of bacteria. At 24 h after infection, peripheral blood was obtained, and mice were killed to obtain the lung and spleen tissues. Peripheral blood samples were plated to evaluate the bacterial burden. The lung and spleen tissues (1 g) were fully milled with a tissue homogenizer and then suspended in 1 mL of PBS and plated to evaluate the bacterial burden. In the sepsis mice with intraperitoneally infection, mortality was compared between different groups.

For permeability assays, THP-1 cell line (1 × 10⁷ cells/mL in RPMI with 10% FBS) was exposed to recombinant toxins and incubated for 30 min at 37°C. The cell lines were subsequently analyzed by flow cytometry, and pore formation was determined by intracellular staining with 4′0,6-diamidino-2- phenylindole (DAPI; 2.5 µg/mL) (20). As HlgAB, HlgCB, and PVL are bicomponent toxins, equimolar concentrations of polyhistidine-tagged S-component and F-component proteins were used. Pore formation ability was defined as the collective DAPI internalization at different concentrations during 30 min. A lactate dehydrogenase (LDH) release assay kit (Merck, Darmstadt, Germany), operating according to the manufacturer’s instruction, was also used to evaluate the cell cytotoxicity by toxins.

Flow cytometry analyses were performed by FlowJo 10. Data analyses were performed by Graphpad Prism 9.0. Statistical significance was calculated using ANOVA and Student’s t-tests with standard error of mean (SEM) where appropriate. Determination of half-maximal effective lytic concentrations of leukocidins was used in nonlinear regression analyses. All comparisons survival analyses were performed using Gehan–Breslow–Wilcoxon test, unless otherwise indicated. P-values are stated as follows: *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

To identify host protein modifications that are implicated in leukocidin S-component binding, we first screened siRNA library (Horizon/Dharmacon) containing 25 customized sulfation-related genes with THP-1 cells, which are HlgAB-sensitive macrophage-like cells differentiated from the human leukemia cell line (21). After solute carrier family 35 member B2 (SLC35B2), 3'-phosphoadenosine 5'-phosphosulfate synthase 1 (PAPSS1), or tyrosylprotein sulfotransferase 2 (TPST2) siRNA interference, THP-1 cells became highly resistant to purified HlgAB (HlgA + HlgB), as measured by an LDH release assay in vitro ( Figure 1A ), which suggested that PAPSS1/SCL35B2/TPST2 tyrosine sulfation signal pathway might regulate the cytolytic activity of leukocidins. After shRNA knockdown of TPST2 gene in THP-1, HL-60, and RAW264.7, the cytotoxicity of HlgAB, HlgCB, and PVL on THP-1 or HL-60 cells was decreased significantly, and the cytotoxicity of HlgAB on RAW264.7 cells was also decreased significantly ( Figures 1B–E ). Meanwhile, we found that heparinase II (HPA) did not affect the cytolytic activity of HlgAB, HlgCB, and PVL on those cells, and the effect of heparin (HS) on leukocidin cytotoxicity was excluded ( Figures 1B–E ).

C5aR1⁻, C5aR1⁻TPST2⁻, C5aR1⁺TPST2⁻, and C5aR1⁺ cells were challenged with HlgCB and PVL. Consistent with the screening results, C5aR1⁻, C5aR1⁻TPST2⁻, and C5aR1⁺TPST2⁻ cells showed resistance to pore formation induced by both HlgCB and PVL ( Figures 2A, B ). To investigate the mechanism of TPST2 regulating HlgCB and PVL cytotoxicity, single-knockdown cells were generated in THP-1 cells. Single-knockdown cells were incubated with specific antibodies to detect the expression of specific targets and analyzed using flow cytometry (20). Knockdown of TPST2 did not affect the C5aR1 expression, as determined using a sulfation-independent anti-C5aR1 antibody (Invitrogen, clone 20/70; Figure 2C ) but downregulated cell surface C5aR1 tyrosine sulfation, as determined using an anti-sulfotyrosine antibody (R&D Systems, clone 347214; Figure 2D ) (22). Lack of tyrosine sulfation did not affect the overall levels of C5aR1 expression. These results identify tyrosine sulfation, as a conservative post-translational modification (PTM) mediates the interaction between leukocidins and host cells.

Previous study reported that the binding of the S-component LukS-PV to a synthetic N-terminal C5aR1-peptide was regulated by sulfation of two peptide-tyrosine residues (11). We hypothesized that TPST2 knockdown in THP-1 cells reduces C5aR1 sulfation and subsequent binding of the S components HlgC and LukS-PV. Finally, we found that the binding of HlgC and LukS-PV on cell surface receptor C5aR1 was impaired in C5aR1⁺TPST2⁻ and C5aR1⁻TPST2⁻ cells as expected ( Figures 2E, F ). Thus, these results show that C5aR1 post-translational sulfation modification mediates the host cell susceptibility to both HlgCB and PVL.

To identify the role of host TPST2 in the immunopathological change of mice infected with S. aureus in vivo, the WT and myeloid cell TPST2-cko mice were infected with equal amounts of control (clinical isolated S. aureus strains express bicomponent leukocidins HlgA, HlgB, and HlgC), HlgACB-knockout (△HlgACB), and HlgACB-complemented (pHlgACB) S. aureus strains intraperitoneally. The lung injury was examined in experimental mice at 24 h after infection; we found that myeloid TPST2 knockout could attenuate the inflammation response of acute lung injury in mice infected by different types of S. aureus and that the pathogenicity of △HlgACB S. aureus infection was significantly lowered in experimental mice compared with that of control and complemented pHlgACB S. aureus ( Figures 3A, B ). In addition, the bacterial load in the blood, lung, and spleen was further detected. In WT mice, HlgACB knockout in S. aureus significantly lowered the bacterial load in the blood and lung compared with that in control and pHlgACB S. aureus, and the bacterial load was slightly reduced in the spleen infected by △HlgACB S. aureus compared with that by others may be because of its immune organ property ( Figure 3Ca ). There exists no difference for bacterial load in the blood, lung, and spleen in TPST2-cko mice infected by different types of S. aureus ( Figure 3Cb ).

Having identified that TPST2 promotes the infection and pathogenicity of S. aureus, next, we further investigated whether the TPST2 could accelerate the death of mice infected by S. aureus. For these in vivo experiments, we used control, △HlgACB, and pHlgACB S. aureus strains to intraperitoneally infected WT and myeloid TPST2-cko mice and then recorded and analyzed the overall survival of experimental mice. We found that knockout of HlgACB toxin could improve survival of WT mice infected by S. aureus compared with that by control and pHlgACB S. aureus strains ( Figure 4A ). However, once we knocked out the TPST2 gene in myeloid cells, the survival rates of knockout mice infected by different strains were raised, and there exists no distinct difference ( Figure 4B ). Furthermore, we found that the survival rates of myeloid TPST2-cko mice infected by control, △HlgACB, and pHlgACB S. aureus strains were significant elevated compared with that of WT mice, which suggests that TPST2 knockout protect mice from infection and lethality by S. aureus ( Figures 4C–E ).