Edited by: Thomas E. Hanson, University of Delaware, USA
Reviewed by: Kathleen Scott, University of South Florida, USA; Dimitry Y. Sorokin, Delft University of Technology, Netherlands
*Correspondence: Stefanie Mangold, Department of Molecular Biology, Umeå University, SE-901 87 Umeå, Sweden. e-mail:
†Current address: Jorge Valdés, Bio-Computing Laboratory, Fraunhofer-Chile Research Foundation, Santiago, Chile; Mark Dopson, Institution for Natural Sciences, Linnaeus University, 391 82 Kalmar, Sweden.
This article was submitted to Frontiers in Microbial Physiology and Metabolism, a specialty of Frontiers in Microbiology.
This is an open-access article subject to an exclusive license agreement between the authors and Frontiers Media SA, which permits unrestricted use, distribution, and reproduction in any medium, provided the original authors and source are credited.
Given the challenges to life at low pH, an analysis of inorganic sulfur compound (ISC) oxidation was initiated in the chemolithoautotrophic extremophile
Inorganic sulfur compounds (ISCs) in acidic, sulfide mineral environments are produced as a result of abiotic Fe(III) oxidation of sulfide minerals such as pyrite (FeS2; initial ISC product is thiosulfate) or chalcopyrite (CuFeS2; initial product is polysulfide sulfur). Their subsequent biooxidation produces sulfuric acid as the final product (Schippers and Sand,
A diverse range of acidophilic or neutrophilic photo- and chemolithotrophs can oxidize ISCs from sulfide (oxidation state of −2) to sulfate (+6; reviewed in Ghosh and Dam,
In contrast to the well studied Sox enzyme complex, the ISC oxidations pathways in acidophiles are not very well understood. As described in recent reviews (Rohwerder and Sand,
Owing to the fact that
Genes and metabolic pathways involved in ISC and S0 oxidation/reduction were obtained from Metacyc
Primers targeting selected genes putatively involved in ISC metabolism were designed for semi quantitative reverse transcription (RT-) PCR amplification (product sizes 98–530 bp; Table
Primer name | Primer sequence | Targeted gene | Product size [bp] | Melting temp. [°C] |
---|---|---|---|---|
ACA0302For | TTCGAGCAACTCCTGCAGACG | 271 | 55.5 | |
ACA0302Rev | CGTCCGTCATACCCATGATCC | ACA_0302 | ||
ACA1632For | GATCCAGGCGATTCATATACGG | 337 | 55.5 | |
ACA1632Rev | TGATCCCCATAGCGAAATTAGAG | ACA_1632 | ||
ACA1633For | TTTTGCGCGTTTGTACCTACCC | 223 | 55.5 | |
ACA1633Rev | AACGCCGTCTACTTGAGCTCC | ACA_1633 | ||
ACA2312For | TGGCGATCTTACCTTGAGCGAGG | 436 | 55.5 | |
ACA2312Rev | TGCGCTCTGCCCCAAAAGTGG | ACA_2312 | ||
ACA2392For | ATCTACCCTTCGACAAGTATGC | 527 | 55.5 | |
ACA2392Rev | TGTGCCGTCTCGCCTTGCAAG | ACA_2392 | ||
ACA2317For | GAAGCCGGTACTGATCAACAAG | 437 | 55.5 | |
ACA2317Rev | CGTGTACTCCGTAACCGTAACC | ACA_2317 | ||
ACA2394For | TCCGTCCTCAACCAGACGCCC | 467 | 55.5 | |
ACA2394Rev | ACAGCGATTTTGCGACCGCTG | ACA_2394 | ||
ACA2319For | CTCGCGCCGCAAATGTTCCCG | 180 | 55.5 | |
ACA2319Rev | TGATCGACATCCACGGTAACCG | ACA_2319 | ||
ACA2390For | ATCGGCACAAGCCTCGTTGCG | 340 | 55.5 | |
ACA2390Re2 | CTGGGGTGAGATCGAACTGGC | ACA_2390 | ||
ACA2313For | GTGCAGTTTATTTACGACCCGG | 98 | 58 | |
ACA2313Rev | ACCAAGCCAATCTGGTGATCCG | ACA_2313 | ||
ACA2389For | ACTCGATACCATCGTTCGTGC | 256 | 58 | |
ACA2389Rev | TCTGGAACATCTGCTGGAAGG | ACA_2389 | ||
ACA2318For | AGAGGTCCGTTCGTTGATCATG | 269 | 58 | |
ACA2318Rev | TCAGGCGACGGTGATCTTTGCC | ACA_2318 | ||
ACA2391For | ATGGCAGACAATATTGGTAACCC | 197 | 58 | |
ACA2391Rev | TCGATGTCCAGCAGCTTTGCAC | ACA_2391 | ||
ACAgyrA-F4 | CAGCCTCGAAAAAGAAATGC | 431 | 55.5 | |
ACAgyrA-R4 | CCACCTCCTTCTCGTCGTAG | ACA_1592 |
For the preparation of the total soluble proteome, cell pellets from 200 mL culture were re-suspended in lysis buffer (7 M urea, 2 M thiourea, 30 mM Tris, 1 mM EDTA, 1.5% Triton X-100, pH 8.5), broken by sonication (2 min, 5 s pulse, 5 s break, 30% amplitude), cell debris removed by centrifugation (10 min, 10 000 rpm, 4°C), and the lysate stored at −80°C. Isoelectric focusing (IEF) was performed using pre-cast, 18 cm, Immobiline DryStrip IPG gels (GE Healthcare) with a non-linear pH gradient from 3 to 10 in an Ettan IPGphor IEF unit (GE Healthcare). Protein samples (200 μg) were applied to the IPG strip in rehydration buffer (7 M urea, 2 M thiourea, and 1.5% Triton X-100) with 1.45% dithiothreitol (DTT) and 0.5% IPG buffer (GE Healthcare). After passive rehydration for 16 h at 25°C, IEF was run for a total of 42 kVh with stepwise increasing voltage according to supplier's recommendation. Following IEF, the gel strips were equilibrated in two steps using equilibration buffer (75 mM Tris, 6 M urea, 30% glycerol, 2% SDS) with additional 100 mM DTT in the first step and equilibration buffer with 2.5% iodoacetamide in the second step. The gel strips were then applied to 12% Duracryl (NextGene Genomic Solutions) SDS-polyacrylamide gels and sealed with 1.5% (wt/vol) agarose solution containing bromophenol blue. Electrophoresis was run in an Ettan DALTsix apparatus (GE Healthcare). The gels were fixed and stained to saturation with colloidal Coomassie (Anderson,
Protein spots were regarded as differentially expressed if they showed the following characteristics: (i) reproducibility in all three gels of the same condition; (ii) the fold change between the two conditions was ≥2.0; and (iii) the fold change between conditions was significant with a probability of 95% according to one-way ANOVA testing. Spots of interest were excised from the gel, destained, and digested with sequencing grade modified trypsin (Promega) according to standard procedures for matrix-assisted laser desorption/ionization time-of-flight (MALDI-ToF) mass spectrometry (Shevchenko et al.,
In order to rule out any contaminating proteins originating from the biological S0, 2D gels were run from samples prepared by suspending the S0 in lysis buffer and sonicating. Control gels were stained with silver (Blum et al.,
A detailed analysis of the genes present in the draft genome sequence of
The first documented step in ISC oxidation is the transition of sulfide to S°. In Gram-negative bacteria, this reaction is carried out by the usually membrane bound Sqr. This reaction can also be catalyzed by membrane bound FCC sulfide dehydrogenase. The enzymatic activity of Sqr (EC 1.8.5.-) has been purified from
In contrast to the enzymes described above, the Sox sulfur oxidizing system has not been found in any microorganisms from the
Another enzyme involved in
It has been shown that sulfur oxidizing bacteria which lack Sox(CD)2 utilize the reverse dissimilatory sulfite reductase (DsrAB) for the oxidation of S0 to sulfite (reviewed in Friedrich et al.,
Reverse transcription-PCR showed that all assayed genes were transcribed during growth on tetrathionate and S0 (Figure
Proteomic analysis yielded 115 identifications of differentially expressed protein spots (Figures
No putative proteins belonging to NADH quinine-oxidoreductase or terminal oxidases were found differentially expressed in the various conditions tested. However, based on the bioinformatic reconstruction the involvement of NADH quinone-oxidoreductase complex and terminal oxidases in the
Proteins encoded within the two Sox clusters were up-regulated in gels from tetrathionate grown bacteria including SoxB-I (M793) and hypothetical protein ACA_2320 (S524) encoded in
Several proteins relevant in signal transduction were up-regulated in tetrathionate grown cells, i.e., chemotaxis protein CheV (S151, M735), putative sensory histidine kinase YfhA (S577), nitrogen regulation protein NRI (M 776), and hypothetical protein ACA_1270 (M277) containing a PAS domain fold involved in signaling proteins. However, the signature feature of the tetrathionate grown proteome was up-regulation of proteins involved in central carbon metabolism, cell division, amino acid biosynthesis, fatty acid biosynthesis, translation, and DNA repair. The up-regulated central carbon metabolism proteins included aspartate aminotransferase (S571), dihydrolipoamide dehydrogenase (S594), fructose bisphosphate aldolase (M248), and phophoglucomutase (M368). A few proteins of central carbon metabolism were up-regulated in S0 grown cells those including 6-phosphogluconate dehydrogenase (S154) and HAD-superfamily hydrolase (M71). Proteins involved in cell division were solely found up-regulated on gels of tetrathionate grown cells such as FtsA (M262), FtsZ (M227), and FtsH (M386, M388, M513). Four proteins involved in amino acid biosynthesis and degradation (S549, S694, M353, M755) and three involved in fatty acid biosynthesis (M179, M309, M726) were up-regulated in tetrathionate grown cells. No proteins of this group were up-regulated in S0 grown cells. Another characteristic group consisted of translation related proteins which included two different translation elongation factors (S217, S388, M254, M521), four different tRNA synthetases (S572, S625, M431, M508), and one amidotransferase (S702) up-regulated on tetrathionate; whereas only one ribosomal protein (S338) was detected up-regulated in S0 grown cells. Proteins involved in DNA repair included a MutS2 family protein identified in two protein spots (M344, M781) and DNA repair protein RecN (M362).
Increased expression of proteins with central functions is commonly attributed to an increased growth rate. However, the samples originated from continuous cultures grown at identical dilution rates, meaning that bacteria were theoretically maintained at the same growth rate. Therefore, it was more likely that the observed trends signified down-regulation of central functions in the S0 grown cells due to a stress response. Nevertheless, the observed results motivated the proteomic investigation of sessile and planktonic
The most striking characteristic of the proteome of S0 grown cells was the high number of up-regulated chaperones and proteases: GroEL (S114, S146, S409, S413, S416, S425, S428, S429, S435, S436), heat shock protein Hsp20 (S26, S46), DnaK (M397), ClpB (M441), and protease Do (M605). In contrast, the only chaperone up-regulated during growth on tetrathionate was HscA (S624). This indicated a stress response during growth on S0. It should be noted that GroEL has been detected in many protein spots most of them with low molecular weight in 2D gels (Figure
In one case, a two component protein was identified in both conditions whereas in other cases proteins sharing a similar function could not be clearly attributed to either condition. Those included proteins involved in protein transport such as an efflux transporter (M180, M740) and Twin-arginine translocation protein TatA (S37, M32) which were up-regulated in tetrathionate grown cells. While in S0 grown cells protein export chaperone (S25) and Type I secretion outer membrane protein, TolC precursor (M497) were up-regulated. A two component protein was found up-regulated on tetrathionate (M291) and as a unique spot in S0 gels (M607). The two spots were in close proximity on the gels; however the unique spot traveled with slightly larger molecular weight and more basic isoelectric point suggesting post translational modification. This protein is encoded together with the signal transduction histidine kinase up-stream of
In 2D gels of planktonic
Several of the proteins identified from planktonic cells were also found up-regulated in tetrathionate grown cells, i.e., TatA (64), Sqr-1 (492), and hypothetical protein ACA_0867 (826 and 827). In addition, SoxY-I (841) and hypothetical protein ACA_2219 (118) were identified. Proteins up-regulated in gels of sessile cells comprised characteristic proteins from tetrathionate grown and S0 grown proteomes as well as proteins not identified from other gels. S0 characteristic proteins included the chaperones GroEL and DnaK (329, 541, 543, and 556), HdrA (382; ACA_2418), and proteins involved in CO2 fixation such as ribulose bisphosphate carboxylase large chain (258) and rubisco activation protein CbbQ (280). Tetrathionate associated proteins consisted of peptidyl-prolyl cis-trans isomerase ppiD (213), CoB–CoM HdrC (238; ACA_2420), proteins involved in amino acid biosynthesis (442, 447, 455, 515), two central carbon metabolism proteins (364, 408), and a single-stranded DNA-binding protein involved in DNA replication (70). The up-regulation of proteins involved in amino acid biosynthesis and central carbon metabolism suggests that sessile cells are less starved than planktonic cells. CoB–CoM HdrB (395; ACA_2421) was not previously detected but was found up-regulated in gels of sessile bacteria. Additionally, twitching motility protein (325) and 40-residue YVTN family β-propeller repeat protein (404) were up-regulated in gels of sessile cells. Twitching motility protein is required for twitching motility and social gliding which allows Gram-negative bacteria to move along surfaces (Merz et al.,
A model has been constructed for ISC oxidation and electron transport based upon gene predictions and proteomics data (Figure
The metabolism of S0 is complicated by its hydrophobic nature which makes an activation of S0 prior to its oxidation necessary. Potentially the DsbC (up-regulated in S0 grown cells) was involved in transferring the S0 equivalent from the membrane to the S0 oxidizing enzyme as suggested for green sulfur bacteria (Sakurai et al.,
Clear trends in the protein expression of cells grown on tetrathionate versus S0 were observed. In S0 grown cells this included up-regulation of chaperones and a protease and down-regulation of proteins involved in central carbon metabolism, amino acid biosynthesis, fatty acid biosynthesis, cell division proteins, and DNA repair. The latter changes can be attributed to the cell's effort to conserve energy which is a feature of the general stress response.
It is believed that the stress response observed in S0 grown sessile cells (compared to planktonic) was due to a biological phenomenon and not due to sample treatment. Several points argue in favor of this view: (i) the stress response was also apparent in S0 grown cells when compared to tetrathionate grown cells although the treatment for both conditions was identical; and (ii) sessile cells were frozen prior to detachment which probably killed most cells conserving their proteome and making changes in the proteome of sessile cells during detachment treatment unlikely.
The
Typically, planktonic and sessile sub-populations are stable (Vilain et al.,
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Mark Dopson wishes to thank the Swedish Research Council for financial support (Vetenskapsrådet contract number 621-2007-3537). David S. Holmes acknowledges Fondecyt 1050063, DI-UNAB 34-06, DI-UNAB 15-06/I, and a Microsoft Sponsored Research Award.
Theoretical | Experimental | Mowse score |
Coverage |
Fold | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Match ID |
Accession |
Protein identification | MW (kDa) |
pI |
MW (kDa) |
pI |
E-value |
difference |
ANOVA |
||
S10 | ACA_2391 | Sulfur oxidation protein SoxZ | 12 | 9.30 | 12 | 9.32 | 70 | 60 | 2.6e − 04 | 4.0 | 1.5e − 02 |
S17 | ACA_0867 | Hypothetical protein ACA_0867 | 18 | 9.07 | 13 | 7.76 | 63 | 34 | 1.4e − 03 | 4.2 | 3.5e − 03 |
S37 | ACA_1726 | Twin-arginine translocation protein TatA | 8 | 6.40 | 16 | 6.12 | 78 | 51 | 4.0e − 05 | 3.8 | 8.3e − 03 |
S127 | ACA_2632 | Pyridoxine 5′-phosphate synthase | 26 | 6.15 | 29 | 6,05 | 131 | 54 | 2.2e − 10 | 10.5 | 1.6e − 03 |
S162 | ACA_1144 | Hypothetical protein ACA_1144 | 31 | 5.83 | 36 | 5.95 | 62 | 32 | 1.7e − 03 | 2.1 | 2.1e − 02 |
S217 | ACA_0247 | Translation elongation factor Tu | 43 | 5.37 | 44 | 5.22 | 114 | 38 | 1.1e − 08 | 2.3 | 1.2e − 02 |
S260 | ACA_0303 | Sulfide-quinone reductase, sqr-1 | 47 | 5.57 | 54 | 5.44 | 56 | 17 | 7.6e − 03 | 2.2 | 1.2e − 03 |
S356 | ACA_2392 | Sulfur oxidation protein SoxA | 32 | 8.77 | 28 | 8.44 | 49 | 26 | 3.8e − 02 | 2.8 | 2.9e − 02 |
S388 | ACA_0248 | Translation elongation factor G | 64 | 5.12 | 83 | 5.15 | 150 | 25 | 2.8e − 12 | 3.5 | 1.1e − 02 |
S22 | ACA_1957 | Hypothetical protein ACA_1957 | 12 | 8.64 | 14 | 8.57 | 76 | 58 | 6.6e − 05 | 6.1 | 2.9e − 02 |
S34 | ACA_2393 | Protein of unknown function DUF302 | 19 | 8.96 | 16 | 8.63 | 89 | 55 | 3.7e − 06 | 6.9 | 4.7e − 03 |
S151 | ACA_0832 | Chemotaxis protein CheV | 30 | 5.19 | 34 | 5.17 | 70 | 27 | 9.8e − 05 | 4.9 | 2.4e − 02 |
S518 | ACA_0867 | Hypothetical protein ACA_0867 | 18 | 9.07 | 13 | 7.15 | 59 | 34 | 3.6e − 03 | unique | 9.4e − 03 |
S524 | ACA_2320 | Hypothetical protein ACA_2320 | 17 | 9.15 | 17 | 9.1 | 73 | 34 | 1.4e − 04 | unique | 1.8e − 02 |
S528 | ACA_0688 | Transposase, IS4 | 40 | 9.48 | 19 | 5.85 | 52 | 16 | 1.6e − 02 | unique | 2.4e − 03 |
S537 | ACA_1235 | Peptidyl-prolyl cis-trans isomerase ppiD | 28 | 8.54 | 27 | 7.42 | 61 | 27 | 2.3e − 03 | unique | 2.7e − 4 |
S538 | ACA_2392 | Sulfur oxidation protein SoxA | 32 | 8.77 | 27 | 8.06 | 74 | 34 | 1.2e − 04 | unique | 1.8e − 02 |
S539 | ACA_2392 | Sulfur oxidation protein SoxA | 32 | 8.77 | 28 | 7.23 | 69 | 24 | 3.7e − 04 | unique | 3.2e − 03 |
S543 | ACA_2420 | CoB–CoM heterodisulfide reductase subunit C | 27 | 6.2 | 29 | 6.44 | 69 | 31 | 3.8e − 04 | unique | 1.6e − 03 |
S544 | ACA_2420 | CoB–CoM heterodisulfide reductase subunit C | 27 | 6.2 | 29 | 6.18 | 68 | 29 | 4.1e − 04 | unique | 2.3e − 4 |
S549 | ACA_0761 | 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate |
30 | 6.45 | 31 | 6.57 | 58 | 21 | 4.0e − 03 | unique | 1.3e − 03 |
S551 | ACA_2027 | Methylenetetrahydrofolate dehydrogenase (NADP+)/Methenyltetrahydrofolate cyclohydrolase | 32 | 6.62 | 32 | 6.76 | 101 | 20 | 2.2e − 07 | unique | 3.9e − 02 |
S556 | ACA_1144 | Hypothetical protein ACA_1144 | 31 | 5.83 | 36 | 5.77 | 58 | 25 | 4.2e − 03 | unique | 5.0e − 5 |
S563 | ACA_2428 | Radical SAM domain protein | 43 | 5.17 | 42 | 5.08 | 66 | 20 | 7.6e − 04 | unique | 2.6e − 5 |
S571 | ACA_0032 | Aspartate aminotransferase | 44 | 7.1 | 45 | 7.13 | 79 | 15 | 3.8e − 05 | unique | 2.4e − 4 |
S572 | ACA_1795 | Tyrosyl-tRNA synthetase | 46 | 6.16 | 46 | 6.34 | 118 | 28 | 4.5e − 09 | unique | 4.5e − 4 |
S577 | ACA_1668 | Putative sensory histidine kinase YfhA | 50 | 6.06 | 48 | 6.02 | 85 | 15 | 8.9e − 06 | unique | 2.1e − 7 |
S579 | Mixture | 49 | 6.43 | 111 | 2.2e − 08 | unique | 1.3e − 03 | ||||
ACA_0441 | Fe–S protein, lactate dehydrogenase SO1521-like protein | 48 | 6.43 | 49 | 6.43 | 97 | 30 | 6.2e − 07 | |||
ACA_0113 | Serine hydroxymethyltransferase | 45 | 6.40 | 49 | 6.43 | 34 | 18 | 1.2e + 00 | |||
S594 | ACA_2840 | Dihydrolipoamide dehydrogenase | 49 | 6.15 | 53 | 6.14 | 81 | 20 | 2.5e − 05 | unique | 2.0e − 7 |
S624 | ACA_1178 | Chaperone protein HscA | 66 | 4.99 | 69 | 4.83 | 102 | 34 | 3.6e − 08 | unique | 4.2e − 4 |
S625 | ACA_1107 | Prolyl-tRNA synthetase | 64 | 5.74 | 70 | 5.70 | 165 | 34 | 8.9e − 14 | unique | 3.4e − 02 |
S694 | ACA_0585 | 2-Keto-3-deoxy-d-manno-octulosonate- 8-phosphate synthase | 31 | 6.18 | 32 | 6.39 | 67 | 22 | 5.9e − 04 | unique | 3.6e − 02 |
S702 | ACA_0705 | Aspartyl-tRNA(Asn)/Glutamyl-tRNA(Gln) amidotransferase subunit B | 53 | 5.23 | 55 | 5.11 | 49 | 9 | 3.7e − 02 | unique | 1.5e − 4 |
S9 | ACA_1583 | Hypothetical protein ACA_1583 | 13 | 4.68 | 12 | 4.55 | 110 | 90 | 2.8e − 08 | 2.3 | 2.5e − 02 |
S25 | ACA_1132 | Protein export cytoplasm chaperone protein (SecB, maintains protein to be exported in unfolded state) | 16 | 4.68 | 15 | 4.65 | 60 | 45 | 3.1e − 03 | 3.2 | 2.4e − 02 |
S26 | ACA_0889 | Heat shock protein Hsp20 | 17 | 5.46 | 15 | 5.35 | 60 | 31 | 3.0e − 03 | 8.6 | 9.9e − 4 |
S46 | ACA_0889 | Heat shock protein Hsp20 | 17 | 5.46 | 17 | 4.86 | 52 | 31 | 1.7e − 02 | 3.5 | 3.4e − 02 |
S53 | ACA_1343 | Peptidoglycan-associated outer membrane lipoprotein | 20 | 6.41 | 18 | 5.53 | 91 | 43 | 2.2e − 06 | 2.9 | 2.9e − 02 |
S64 | ACA_1478 | Hypothetical protein ACA_1478 | 20 | 5.52 | 22 | 5.51 | 62 | 47 | 1.8e − 03 | 3.6 | 4.1e − 02 |
S102 | ACA_1210 | Stringent starvation protein A | 24 | 5.51 | 27 | 5.51 | 54 | 30 | 1.0e − 02 | 2.3 | 1.9e − 02 |
S114 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 29 | 5.56 | 57 | 15 | 5.5e − 03 | 3.4 | 5.0e − 02 |
S146 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 33 | 5.63 | 141 | 36 | 2.2e − 11 | 2.3 | 1.0e − 02 |
S154 | ACA_0563 | 6-phosphogluconate dehydrogenase, NAD-binding | 32 | 5.88 | 33 | 5.94 | 106 | 56 | 7.1e − 08 | 2.3 | 1.8e − 03 |
S175 | Mixture | 38 | 6.86 | 123 | 1.4e − 09 | 4.5 | 5.4e − 02 | ||||
ACA_2530 | Membrane-fusion protein | 38 | 7.9 | 38 | 6.86 | 89 | 40 | 3.3e − 06 | |||
ACA_2096 | Glyceraldehyde-3-phosphate dehydrogenase/erythrose -4-phosphate dehydrogenase | 37 | 7.14 | 38 | 6.86 | 51 | 33 | 2.5e − 02 | |||
S205 | ACA_0861 | Flagellar basal-body rod protein FlgC | 14 | 7.88 | 43 | 6.15 | 58 | 63 | 4.3e − 03 | 2.5 | 4.1e − 02 |
S285 | ACA_1087 | IMP cyclohydrolase/Phosphoribosylaminoimidazolecarboxamide formyltransferase | 57 | 5.6 | 60 | 5.52 | 103 | 26 | 1.4e − 07 | 3.1 | 6.5e − 03 |
S338 | ACA_0241 | LSU ribosomal protein L7/L12 (L23e) | 13 | 4.64 | 13 | 4.57 | 144 | 83 | 1.1e − 11 | 2.0 | 1.5e − 02 |
S358 | ACA_2033 | Thiol:disulfide interchange protein DsbG precursor | 30 | 5.68 | 30 | 5.25 | 75 | 47 | 8.5e − 05 | 2.0 | 5.5e − 4 |
S398 | ACA_1343 | Peptidoglycan-associated outer membrane lipoprotein | 20 | 6.41 | 16 | 5.55 | 57 | 30 | 5.5e − 03 | unique | 8.1e − 5 |
S409 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 27 | 4.97 | 83 | 23 | 1.5e − 05 | unique | 5.7e − 03 |
S413 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 28 | 5.2 | 50 | 15 | 3.0e − 02 | unique | 5.5e − 03 |
S416 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 29 | 5.13 | 75 | 24 | 9.3e − 05 | unique | 1.2e − 02 |
S418 | ACA_2632 | Pyridoxine 5′-phosphate synthase | 26 | 6.15 | 29 | 6.15 | 126 | 48 | 7.1e − 10 | unique | 3.0e − 03 |
S425 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 33 | 5.17 | 68 | 24 | 4.2e − 04 | unique | 1.4e − 4 |
S428 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 33 | 5.56 | 49 | 21 | 3.2e − 02 | unique | 3.2e − 03 |
S429 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 34 | 5.44 | 56 | 15 | 6.5e − 03 | unique | 5.8e − 03 |
S435 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 36 | 5.32 | 85 | 26 | 8.1e − 06 | unique | 2.7e − 03 |
S436 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.41 | 37 | 5.33 | 68 | 22 | 4.6e − 04 | unique | 3.1e − 03 |
S462 | ACA_2418 | Heterodisulfide reductase subunit A | 38 | 6.03 | 52 | 5.50 | 63 | 26 | 1.4e − 03 | unique | 1.9e − 02 |
M13 | ACA_0867 | Hypothetical protein ACA_0867 | 18 | 9.07 | 12 | 8.69 | 69 | 34 | 3.6e − 04 | 2.3 | 9.9e − 03 |
M19 | ACA_1957 | Hypothetical protein ACA_1957 | 12 | 8.64 | 13 | 9.00 | 55 | 44 | 8.5e − 03 | 7.4 | 1.2e − 03 |
M32 | ACA_1726 | Twin-arginine translocation protein TatA | 8 | 6.40 | 16 | 6.08 | 74 | 55 | 1.0e − 04 | 3.8 | 2.3e − 4 |
M49 | ACA_1466 | Putative lipoprotein | 22 | 6.49 | 20 | 6.17 | 68 | 58 | 4.6e − 04 | 10.3 | 1.1e − 4 |
M163 | ACA_2593 | Hypothetical protein ACA_2593 | 39 | 8.71 | 33 | 6.10 | 49 | 18 | 3.9e − 02 | 5.9 | 3.0e − 03 |
M179 | ACA_2091 | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | 34 | 5.43 | 36 | 5.43 | 54 | 21 | 1.1e − 02 | 2.1 | 1.8e − 02 |
M180 | ACA_1142 | Efflux transporter, RND family, MFP subunit | 39 | 9.39 | 36 | 9.36 | 78 | 28 | 4.5e − 05 | 15.0 | 2.3e − 03 |
M193 | ACA_2096 | NAD-dependent glyceraldehyde-3-phosphate dehydrogenase | 37 | 7.14 | 37 | 8.17 | 99 | 48 | 3.4e − 07 | 2.9 | 6.2e − 6 |
M227 | ACA_1229 | Cell division protein FtsZ | 40 | 4.95 | 41 | 4.98 | 112 | 28 | 1.8e − 08 | 2.2 | 7.7e − 4 |
M248 | ACA_2100 | Fructose-bisphosphate aldolase class II | 38 | 5.69 | 43 | 5.74 | 147 | 35 | 5.6e − 12 | 2.1 | 2.6e − 4 |
M254 | ACA_0247 | Translation elongation factor Tu | 43 | 5.37 | 44 | 5.31 | 101 | 30 | 2.2e − 07 | 4.1 | 3.9e − 4 |
ACA_1874 | Translation elongation factor Tu | 21 | 6.21 | 44 | 5.31 | 72 | 39 | 1.8e − 04 | |||
M262 | ACA_1228 | Cell division protein FtsA | 45 | 5.41 | 46 | 5.41 | 165 | 40 | 8.9e − 14 | 4.5 | 3.1e − 4 |
M277 | ACA_1270 | Hypothetical protein ACA_1270 | 44 | 6.00 | 50 | 6.08 | 140 | 36 | 2.8e − 11 | 2.3 | 1.5e − 02 |
M291 | ACA_2388 | Two component, sigma54 specific, transcriptional regulator, Fis family | 50 | 5.47 | 51 | 5.43 | 162 | 33 | 1.8e − 13 | 3.0 | 3.0e − 4 |
M300 | ACA_2485 | Sulfide–quinone reductase, sqr-2 | 48 | 6.53 | 52 | 7.42 | 108 | 25 | 4.5e − 08 | 2.5 | 2.7e − 02 |
M309 | ACA_0933 | Biotin carboxylase of acetyl-CoA carboxylase | 49 | 6.18 | 53 | 6.22 | 56 | 20 | 6.6e − 03 | 2.1 | 1.5e − 02 |
M344 | ACA_2548 | MutS2 family protein | 55 | 6.24 | 59 | 6.52 | 48 | 16 | 4.2e − 02 | 2.3 | 1.0e − 02 |
M353 | ACA_2547 | Acetolactate synthase large subunit | 63 | 5.69 | 63 | 5.60 | 52 | 8 | 1.7e − 02 | 2.7 | 1.5e − 02 |
M357 | ACA_2234 | Uptake hydrogenase large subunit | 50 | 6.11 | 64 | 5.76 | 66 | 21 | 7.8e − 04 | 3.1 | 3.2e − 02 |
M362 | ACA_1776 | DNA repair protein RecN | 62 | 5.26 | 66 | 5.27 | 136 | 33 | 7.1e − 11 | 2.5 | 9.2e − 03 |
M368 | ACA_0098 | Phosphoglucomutase | 59 | 5.88 | 69 | 5.79 | 56 | 17 | 7.4e − 03 | 3.0 | 1.9e − 03 |
M383 | ACA_2179 | GTPase subunit of restriction endonuclease-like protein | 73 | 5.38 | 74 | 5.37 | 74 | 18 | 1.2e − 04 | 2.8 | 6.1e − 03 |
M386 | ACA_1482 | Cell division protein FtsH | 69 | 5.98 | 75 | 5.85 | 114 | 18 | 1.1e − 08 | 4.1 | 6.4e − 5 |
M388 | ACA_1482 | Cell division protein FtsH | 69 | 5.98 | 76 | 5.78 | 80 | 17 | 2.8e − 05 | 9.1 | 9.7e − 4 |
M431 | ACA_2689 | Phenylalanyl-tRNA synthetase beta chain | 88 | 5.89 | 92 | 5.81 | 151 | 19 | 2.2e − 12 | 2.1 | 4.8e − 4 |
M476 | ACA_2096 | NAD-dependent glyceraldehyde-3-phosphate dehydrogenase | 37 | 7.14 | 38 | 7.81 | 93 | 50 | 1.5e − 6 | 2.5 | 1.1e − 03 |
M482 | ACA_1144 | Hypothetical protein ACA_1144 | 31 | 5.83 | 35 | 5.91 | 77 | 32 | 5.1e − 05 | 10.7 | 7.9e − 5 |
M508 | ACA_0293 | Cysteinyl-tRNA synthetase | 53 | 5.83 | 57 | 5.79 | 80 | 25 | 2.9e − 05 | 2.7 | 2.5e − 03 |
M512 | ACA_0317 | Chemotaxis regulator - transmits chemoreceptor signals to flagelllar motor components CheY | 16 | 6.60 | 80 | 5.96 | 65 | 36 | 8.3e − 04 | 2.4 | 4.7e − 02 |
ACA_0548 | Hypothetical protein ACA_0548 | 73 | 6.02 | 80 | 5.96 | 59 | 14 | 3.8e − 03 | |||
M513 | ACA_1482 | Cell division protein FtsH | 69 | 5.98 | 76 | 5.74 | 128 | 27 | 4.5e − 10 | 3.5 | 1.2e − 4 |
M521 | ACA_0247 | Translation elongation factor Tu | 43 | 5.37 | 46 | 5.27 | 70 | 22 | 2.9e − 04 | 2.1 | 1.4e − 03 |
ACA_1874 | Translation elongation factor Tu | 21 | 6.21 | 46 | 5.27 | 62 | 40 | 1.8e − 03 | |||
M706 | ACA_1957 | Hypothetical protein ACA_1957 | 12 | 8.64 | 13 | 9.39 | 71 | 58 | 2.0e − 04 | unique | 1.4e − 02 |
M726 | ACA_0186 | Enoyl-[acyl-carrier-protein] reductase [NADH] | 27 | 5.70 | 28 | 5.69 | 122 | 40 | 1.8e − 09 | unique | 1.5e − 02 |
M735 | ACA_0832 | Chemotaxis protein CheV | 30 | 5.19 | 34 | 5.27 | 78 | 24 | 4.7e − 05 | unique | 3.3e − 6 |
M738 | ACA_1144 | Hypothetical protein ACA_1144 | 31 | 5.83 | 36 | 5.72 | 55 | 34 | 9.8e − 03 | unique | 2.1e − 4 |
M740 | ACA_1142 | Efflux transporter, RND family, MFP subunit | 39 | 9.39 | 36 | 8.90 | 88 | 23 | 4.7e − 06 | unique | 8.8e − 4 |
M755 | ACA_2748 | Aminomethyltransferase | 42 | 6.73 | 45 | 7.45 | 128 | 49 | 4.5e − 10 | unique | 7.7e − 5 |
M776 | ACA_1984 | Nitrogen regulation protein NR(I) | 54 | 5.84 | 58 | 5.74 | 104 | 25 | 1.1e − 07 | unique | 1.8e − 4 |
M781 | ACA_2548 | MutS2 family protein | 55 | 6.24 | 60 | 6.23 | 50 | 13 | 2.9e − 02 | unique | 9.9e − 5 |
M793 | ACA_2317 | 5′-Nucleotidase domain protein | 64 | 6.66 | 66 | 7.41 | 83 | 11 | 1.3e − 05 | unique | 8.7e − 7 |
M71 | ACA_2067 | HAD-superfamily hydrolase, subfamily IA, variant 3 | 24 | 6.08 | 24 | 5.97 | 160 | 64 | 2.8e − 13 | 2.1 | 1.6e − 02 |
M85 | ACA_0146 | Alkyl hydroperoxide reductase subunit C-like protein | 24 | 5.67 | 26 | 5.55 | 60 | 23 | 2.8e − 03 | 2.6 | 4.1e − 02 |
M263 | ACA_2773 | Carboxysome shell protein CsoS1 | 10 | 5.52 | 47 | 5.00 | 58 | 41 | 4.5e − 03 | 6.1 | 6.9e − 3 |
M397 | ACA_1454 | Chaperone protein DnaK | 68 | 5.06 | 79 | 5.01 | 59 | 18 | 3.9e − 03 | 3.6 | 8.4e − 03 |
M441 | ACA_2034 | ClpB protein | 97 | 5.52 | 100 | 5.49 | 198 | 25 | 4.5e − 17 | 2.7 | 9.0e − 4 |
M493 | ACA_2352 | Phosphate-selective porin O and P | 42 | 5.87 | 39 | 6.70 | 96 | 29 | 6.9e − 07 | 3.3 | 1.6e − 02 |
M497 | ACA_0129 | Type I secretion outer membrane protein, TolC precursor | 50 | 6.34 | 50 | 6.02 | 74 | 23 | 1.1e − 04 | 2.4 | 9.4e − 03 |
M503 | ACA_2765 | Ribulose bisphosphate carboxylase large chain | 53 | 5.96 | 53 | 5.78 | 121 | 27 | 2.2e − 09 | 2.6 | 8.5e − 4 |
M530 | ACA_2773 | Carboxysome shell protein CsoS1 | 10 | 5.52 | 10 | 5.39 | 121 | 62 | 2.2e − 09 | unique | 1.0e − 02 |
ACA_2771 | Carboxysome shell protein CsoS1 | 10 | 5.58 | 10 | 5.39 | 78 | 46 | 4.3e − 05 | |||
ACA_2772 | Carboxysome shell protein CsoS1 | 10 | 5.58 | 10 | 5.39 | 78 | 46 | 4.3e − 05 | |||
M539 | ACA_1520 | Hypothetical protein ACA_1520 | 12 | 6.52 | 16 | 8.39 | 91 | 59 | 2.0e − 06 | unique | 2.8e − 4 |
M550 | ACA_0172 | 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase | 21 | 5.10 | 22 | 5.05 | 77 | 36 | 5.4e − 05 | unique | 1.4e − 02 |
M553 | ACA_0993 | Hypothetical protein ACA_0993 | 25 | 8.98 | 25 | 8.89 | 141 | 42 | 2.2e − 11 | unique | 1.8e − 02 |
M565 | ACA_1527 | Hypothetical protein ACA_1527 | 32 | 4.74 | 28 | 4.66 | 57 | 26 | 6.2e − 03 | unique | 1.4e − 5 |
M605 | ACA_0109 | Protease Do | 53 | 6.98 | 51 | 6.9 | 54 | 15 | 1.2e − 02 | unique | 2.1e − 02 |
M607 | ACA_2388 | Two component, sigma54 specific, transcriptional regulator, Fis family | 50 | 5.47 | 52 | 5.33 | 53 | 16 | 1.4e − 02 | unique | 4.0e − 4 |
M675 | ACA_2024 | Outer membrane component of tripartite multidrug resistance system | 51 | 6.14 | 53 | 5.52 | 75 | 16 | 9.3e − 05 | unique | 4.7e − 4 |
Theoretical | Experimental | Mowse score |
Coverage |
Fold | |||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Match ID |
Accession |
Protein identification | MW (kDa) |
pI |
MW (kDa) |
pI |
E-value |
difference |
Anova |
||
64 | ACA_1726 | Twin-arginine translocation protein TatA | 8 | 6.40 | 16 | 6.33 | 71 | 51 | 2.1e − 04 | 7.9 | 9.0e − 03 |
118 | ACA_2219 | Hypothetical protein ACA_2219 | 20 | 6.15 | 20 | 6.11 | 75 | 31 | 8.9e − 05 | 4.2 | 1.4e − -03 |
492 | ACA_0303 | Sulfide–quinone reductase, sqr-1 | 47 | 5.57 | 52 | 5.56 | 86 | 35 | 6.5e − 06 | 2.4 | 7.2e − 5 |
826 | ACA_0867 | Hypothetical protein ACA_0867 | 18 | 9.07 | 14 | 7.18 | 101 | 61 | 2.2e − 07 | unique | 2.9e − 6 |
827 | ACA_0867 | Hypothetical protein ACA_0867 | 18 | 9.07 | 14 | 6.95 | 69 | 53 | 3.2e − 04 | unique | 5.2e − 5 |
841 |
ACA_2319 | Sulfur oxidation protein SoxY | 16 | 5.65 | unique | 3.3e − 4 | |||||
70 | ACA_1907 | Single-stranded DNA-binding protein | 17 | 5.49 | 16 | 5.59 | 70 | 66 | 3.0e − 04 | 3.1 | 3.1e − 02 |
213 | ACA_1235 | Peptidyl-prolyl cis-trans isomerase ppiD | 28 | 8.54 | 27 | 7.12 | 56 | 20 | 6.6e − 03 | 2.7 | 1.1e − 02 |
238 | ACA_2420 | CoB–CoM heterodisulfide reductase subunit C | 27 | 6.20 | 28 | 6.67 | 113 | 50 | 1.4e − 08 | 2.8 | 7.9e − 03 |
258 | ACA_2765 | Ribulose bisphosphate carboxylase large chain | 53 | 5.96 | 30 | 5.36 | 68 | 15 | 4.7e − 04 | 2.2 | 5.1e − 4 |
280 | ACA_2783 | Rubisco activation protein CbbQ mod | 30 | 5.32 | 32 | 5.32 | 84 | 35 | 1.2e − 05 | 2.4 | 5.3e − 5 |
325 | ACA_2737 | Twitching motility protein | 39 | 6.50 | 36 | 6.87 | 102 | 33 | 1.8e − 07 | 2.0 | 1.7e − 03 |
329 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.14 | 37 | 5.4 | 64 | 18 | 1.2e − 03 | 2.2 | 9.5e − 03 |
364 | ACA_0002 | Pyruvate dehydrogenase E1 component beta subunit | 35 | 5.69 | 39 | 5.8 | 77 | 20 | 5.5e − 05 | 3.0 | 2.5e − 02 |
382 | ACA_2418 | Heterodisulfide reductase subunit A | 38 | 6.03 | 40 | 5.57 | 93 | 34 | 1.5e − 06 | 2.4 | 3.6e − 4 |
ACA_1473 | Heterodisulfide reductase subunit A | 38 | 5.86 | 40 | 5.57 | 68 | 28 | 4.3e − 04 | |||
395 | ACA_2421 | CoB–CoM heterodisulfide reductase subunit B | 33 | 5.01 | 41 | 5.03 | 71 | 56 | 2.3e − 04 | 2.1 | 5.9e − 4 |
404 | ACA_0152 | 40-residue YVTN family beta-propeller repeat protein | 96 | 5.98 | 43 | 5.35 | 49 | 7 | 3.4e − 02 | 7.7 | 4.4e − 5 |
408 | ACA_2100 | Fructose-bisphosphate aldolase class II | 38 | 5.69 | 43 | 5.93 | 76 | 33 | 7.4e − 05 | 2.3 | 1.6e − 02 |
420 | ACA_0056 | 42 | 5.37 | 45 | 5.38 | 79 | 21 | 3.3e − 05 | 2.4 | 9.0e − 6 | |
442 | ACA_0500 | Gamma-glutamyl phosphate reductase | 46 | 5.87 | 48 | 6.37 | 109 | 25 | 3.6e − 08 | 2.5 | 1.7e − 03 |
447 | ACA_0113 | Serine hydroxymethyltransferase | 45 | 6.4 | 49 | 6.73 | 71 | 22 | 2.0e − 04 | 5.2 | 8.5e − 03 |
455 | ACA_1035 | 3-isopropylmalate dehydratase large subunit | 51 | 5.69 | 49 | 5.85 | 107 | 33 | 5.6e − 08 | 2.5 | 1.8e − 5 |
515 | ACA_0148 | 2-isopropylmalate synthase | 32 | 5.94 | 56 | 5.43 | 86 | 29 | 7.3e − 06 | 2.5 | 1.7e − 03 |
522 | ACA_0976 | ATP synthase alpha chain | 56 | 5.32 | 57 | 5.27 | 68 | 18 | 4.0e − 04 | 2.3 | 1.7e − 03 |
541 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.14 | 63 | 5.4 | 96 | 34 | 7.8e − 07 | 3.8 | 7.0e − 03 |
543 | ACA_2307 | Heat shock protein 60 family chaperone GroEL | 58 | 5.14 | 67 | 5.26 | 94 | 28 | 1.2e − 06 | 2.4 | 8.1e − 4 |
553 | ACA_2095 | Transketolase | 73 | 5.95 | 79 | 6.33 | 77 | 18 | 5.8e − 05 | 3.0 | 5.2e − 03 |
556 | ACA_1454 | Chaperone protein DnaK | 68 | 5.06 | 82 | 5.02 | 155 | 36 | 8.9e − 13 | 2.6 | 3.4e − 03 |
1
2
3
4
5
6
7