Edited by: Frank T Robb, University of California, USA
Reviewed by: Garry Myers, University of Maryland, USA; Nils-Kaare Birkeland, University of Bergen, Norway
*Correspondence: Naomi L. Ward, Department of Molecular Biology, University of Wyoming, Dept 3944, 1000 E. University Avenue, Laramie, WY 82071, USA. e-mail:
†Present address: Michelle Sait, Moredun Research Institute, Pentlands Science Park, Bush Loan, Edinburgh, Midlothian, UK; Natalia V. Kirienko, Department of Molecular Biology, Massachusetts General Hospital, Boston, MA, USA; Department of Genetics, Harvard Medical School, Boston, MA, USA; Mimi M. Shirasu-Hiza, Department of Genetics and Development, Columbia University Medical Center, New York, NY, USA.
This article was submitted to Frontiers in Evolutionary and Genomic Microbiology, a specialty of Frontiers in Microbiology.
This is an open-access article subject to a non-exclusive license between the authors and Frontiers Media SA, which permits use, distribution and reproduction in other forums, provided the original authors and source are credited and other Frontiers conditions are complied with.
Our knowledge of pathogens and symbionts is heavily biased toward phyla containing species that are straightforward to isolate in pure culture. Novel bacterial phyla are often represented by a handful of strains, and the number of species interacting with eukaryotes is likely underestimated. Identification of predicted pathogenesis and symbiosis determinants such as the Type III Secretion System (T3SS) in the genomes of “free-living” bacteria suggests that these microbes participate in uncharacterized interactions with eukaryotes. Our study aimed to test this hypothesis on
For anthropocentric reasons, bacteria are often conceptually divided into free-living and host-associated organisms. However, we know that different members of the same bacterial phylum can exhibit a multitude of lifestyles (free-living, pathogen, symbiont), and even that a single species can engage in different kinds of relationships with different hosts. It is also clear that bacterial phyla containing known pathogens and symbionts are enormously over-represented in our culture collections and sequence databases (Martiny and Field,
The
We next used a yeast functional screen (Lesser and Miller,
We next performed standard infection assays (Schneider et al.,
We also examined the effect of
Phylogenetic analysis of structural T3SS proteins has shown most bacteria possessing T3SS to cluster according to their specific interaction type, such as plant pathogen, obligate intracellular animal pathogen, or extracellular animal pathogen (Troisfontaines and Cornelis,
We have begun to address two questions, using
The second question is whether
Another obvious goal is determination of the role of the predicted
With the rapid development of sequencing technology, bacterial genome sequencing has revealed predicted pathogenesis/symbiosis determinants in several organisms not previously known to interact with eukaryotes (Pallen et al.,
The
Ten milliliters of
Open reading frames were PCR-amplified from
Putative T3SS effectors were selected for yeast genetic screening (Lesser and Miller,
Survival assays in
Strains were maintained according to standard procedures (Stiernagle,
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Open reading frame | Description | Top BLASTP match | Required for type III secretion? |
---|---|---|---|
ORF02659 | Type III secretion chaperone DspF family | ZP_02197308.1 |
No |
ORF02982 | Type III secretion chaperone CesT family | YP_002436649.1 |
No |
ORF03096 | Type III secretion chaperone CesT family | YP_002436233.1 |
No |
ORF03208 | Type III secretion chaperone, CesT family | ZP_03311875.1 |
No |
ORF04373 | Type III secretion chaperone CesT family | YP_002680810.1 |
No |
ORF04377 | Type III secretion chaperone CesT family | YP_002680810.1 |
No |
ORF04807 | Type III secretion chaperone CesT family | gb|AAY36239.1| |
No |
ORF05889 | Type III secretion chaperone CesT family | ZP_02197308.1 |
No |
ORF05893 | Type III secretion protein YscU/HrpY | ZP_01259729.1 |
Yes |
ORF05894 | Type III secretion protein SpaR/YscT/HrcT | NP_798053.1 |
Yes |
ORF05895 | Type III secretion protein HrpO family (YscS/HrcS/SctS/EscS) | ZP_01550017.1 |
Yes |
ORF05896 | Type III secretion apparatus protein YscR/HrcR | ZP_02195905.1 |
Yes |
ORF05897 | Type III secretion apparatus protein YscQ/HrcQ/SpaO | YP_001444923.1 |
Yes |
ORF05898 | Putative T3SS needle length determinant | YP_436215.1 |
No |
ORF05899 | Type III secretion protein O | ABM29998.1 |
No |
ORF05900 | Type III secretion apparatus H + transporting two-sector ATPase YscN | YP_594915.1 |
Yes |
ORF05901 | Type III secretion apparatus protein HrpE/YscL family | AAO18079.1 |
Yes |
ORF05904 | Type III secretion apparatus lipoprotein YscJ/HrcJ | ZP_01769285.1 |
Yes |
ORF05909 | Type III secretion apparatus protein YscD/HrpQ family | ABC30002.1 |
Yes |
ORF05910 | Type III secretion outer membrane pore YscC/HrcC family | YP_434425.1 |
Yes |
ORF05911 | Type III secretion chaperone CesT family | YP_961197.1 |
No |
ORF05912 | Type III secretion protein LcrD/AscV/YscV | NP_863517.1 |
Yes |
ORF05915 | Type III secretion chaperone SycN family | ZP_01259739.1 |
No |
ORF05917 | Type III secretion regulator YopN/LcrE/InvE/MxiC | YP_961203.1 |
No |
ORF05919 | Putative Type III secretion system protein EscC | YP_002932398.1 |
No |
ORF05921 | Type III secretion low calcium response chaperone LcrH/SycD/SpaT | ZP_01985138.1 |
No |
ORF05929 | Type III secretion chaperone CesT family | YP_001906486.1 |
No |
ORF05931 | Type III secretion chaperone CesT family | YP_002680810.1 |
No |
ORF05932 | Type III secretion chaperone CesT family | YP_595407.1 |
No |
ORF05933 | Type III secretion chaperone CesT family | YP_961179.1 |
No |
ORF06015 | Type III secretion chaperone CesT family | YP_434498.1 |
No |
Bait/prey pair | B-Galactosidase induction | Interaction | ||||
---|---|---|---|---|---|---|
SC− | SC− | SC− | SC− | X-Gal assay | ||
Leu− | Leu− | Leu− | Leu− | |||
Trp− | Trp− | Trp− | Trp− | |||
His+ | His+ | His+ | His+ | |||
10 mM | 25 mM | 50 mM | 100 mM | |||
3AT | 3AT | 3AT | 3AT | |||
pEXP32Krev1/pEXPRalGDS-wt (control strong positive interaction) | + | + | + | + | Blue | Strong |
pEXP32Krev1/pEXPRalGDS-m1 (control weak positive interaction) | + | + | + | + | Blue | Weak |
pEXP32Krev1/pEXPRalGDS-m2 (control negative interaction) | − | − | − | − | White | No |
pEXP32VspF1/pEXP22VspF2 | − | − | − | − | White | No |
pEXP32VspF1/pEXP22VspE | + | + | + | + | Blue | Strong |
pEXP32VspF1/pEXP22VspG | − | − | − | − | White | No |
pEXP32VspF2/pEXP22VspF2 | − | − | − | − | White | No |
pEXP32VspF2/pEXP22VspE | − | − | − | − | White | No |
pEXP32VspF2/pEXP22VspG | − | − | − | − | White | No |
Gene product | Open Reading frame | Oligonucleotide primers | Primer binding positions | Primer annealing temp.°C | |
---|---|---|---|---|---|
Forward primer (5′→3′) | Reverse primer (5′→3′) | ||||
VspC | ORF05910 | AAGACCAAGAACACCCGCCAGATA | AAG AAG CGC TGT TTG CGC TCA TTC | 1595f-1698r | 62 |
VspQ | ORF05897 | AAGGTGCCTGTGAGGTGCTGATTT | GCG GGA TCG CTC ATG ATG AAT TGT | 567f-666r | 62 |
VspF1 | ORF05908 | AGCTCACTGAATATCTCGGCACCT | TTTCAGCCTGATCAATGCTGTGGG | 71f-190r | 62 |
VspF2 | ORF05907 | ACGAAGAAACCACCCAGGTGATGA | TGGATCGCTTTCACAAGGTTGGAG | 83f-221r | 62 |
VspF1 | ORF05908 | CAC CAT GAC AGA CAT TGA TAC | TCA GTC GTT TTG TTT ATC CCC | 17f-235r | 60 |
VspF2 | ORF05907 | CAC CAT GGC AAT TGA CTT TG | CTA ACG AAG GTT GCT GAC AG | 16f-239r | 60 |
VspG | ORF05906 | CAC CAT GAT CCC CGT CGA T | TCA TAG AAA GTT GCG TTT GGG | 15f-388r | 60 |
VspE | ORF05905 | CAC CAT GAG CGT ACC TCT TG | TCA ACC GCC GCG GCT GAG | 16f-439r | 60 |
ORF05930 | CAC CAT GCA CAA GAT TTC CG | TCA GTC CCC GAT CTT GTC CG | 16f-2044r | 58 | |
ORF05930 | CCATA ATG CAC AAG ATT TCC G | GTC CCC GAT CTT GTC CGA C | 16f-2046r | 58 | |
ORF01842 | CCATA ATG CCT CCT ATT TC | CCT GGG GGA GTC CGG TC | 14f-560r | 56 | |
ORF04374 | CCATA ATG AAT AGC TTC C | CAA GAG GAT GAT CGA TG | 13f-1070r | 56 | |
ORF03840 | CCATA ATG AAA ATC TCT AGC G | GTCCG CGG AGC GCA AAG | 16f-662r | 56 | |
ORF04373 | CCATA ATG ATC GAC GAC TC | GGCGC AGA GAT AGT GCG | 14f-434r | 58 | |
ORF05921 | CCATA ATG CCG ACG GGC | TGA CTC GGA AGT GGC GG | 12f-497r | 56 |
This research was supported by the United States National Science Foundation (EPS-0447681). We would like to thank members of the Thorsness Lab in the Department of Molecular Biology, University of Wyoming, for assistance with experiments performed in yeast.