Bacillus subtilis ATCC 6633 (B. subtilis), Bacillus polymyxa B719W (B. polymyxa), Bacillus cereus ATCC 14579 (B. cereus), and Bacillus thuringiensis DUP6044 (B. thuringiensis) cultures were used in this study. Cultures were inoculated in brain heart infusion (BHI) broth (Difco, MD, USA) and incubated at 37°C for overnight (16 h) with 130 rpm shaker, 10-fold serially diluted in 0.2 mM phosphate buffered saline, pH 7.0 (PBS) and diluents were plated on BHI and phenol red mannitol (PRM) agar plates (Becton Dickinson, NJ, USA) to obtain 50–100 colonies. Optical scatter patterns of the colonies were captured using the BARDOT instrument at 6–8 h that corresponds to colony diameter of about 550, 750, and 900 μm, respectively.

Scatterometer (Figure 1A), consists of laser diode (LD) with 635 nm wavelength that was installed as a light source, and the light source directly illuminates a single bacterial colony grown on semi-solid agar plate. The diffracted light is captured using detector (CMOS camera, PL-B741, ON, Canada) with 1280(H) × 1024(V) pixels, 6.7 × 6.7 μm pixel pitch which is located after the semi-solid agar plate with distance z. Motorized 2 axis lateral stage was integrated to the system, and the semi-solid agar plate was put on the 2 axis lateral stage for a full automatic measurement of optical scatter pattern. The Bacillus colonies were then picked from the plate, grown briefly (4 h) in BHI broth at 37°C and analyzed by multiplex PCR (mPCR) assay.

Total DNA was extracted by boiling cultures as described earlier (Ngamwongsatit et al., 2008). mPCR was performed using gyrB gene-specific primers (BcF: 5′ GTTTCTGGTGGT TTACATGG3′; BcR: 5′TTTTGAGCGATTTAAATGC 3′) and cry gene-specific primers (K5F: 5′AGG ACCAGGATTTACAGGAGG 3′; K3R: 5′ GCTGTGACACGAAGGATATAGCCAC 3′) (Kuo and Chak, 1996; Manzano et al., 2003). The mPCR reaction mixture contained 200 μM of each dNTP, 2.5 mM of MgCl₂, 0.8X GoTaq Flexi buffer, 1U of GoTaq Flexi DNA polymerase (Promega), 0.2–0.3 μM of primers, 60–90 ng of template DNA and the reaction condition was optimized (Henegariu et al., 1997; Lorenz, 2012). Ultra-pure sterile water was used as negative control. PCR reaction was only considered valid when control reaction was either positive or negative as appropriate and 16S rRNA gene was positively amplified with all DNA templates. All amplicons were analyzed on 1.2% agarose gel.

As shown in Figure 1B, the laser confocal displacement meter (CDM) (Keyence, LT9010M) is located at the top and attached to a linear horizontal translation stage (Edmund Optics, NJ, USA) in order to position the probing laser beam (λ = 670 nm) along the vertical z axis and to focus it on the surface of colony. A motorized 2D lateral stage translated the Petri dish in the x-y plane to align the diagnostic laser beam with each selected bacterial colony to obtain their 3-D profiles. Two linear motors (850G-HS) connected to the ESP 300 multi-axis closed-loop controller (Newport, NY, USA) with the specification of a 42 mm maximum stroke and a 0.1 mm minimum step size control the movement of the x-y stage. This instrument implements a high accuracy surface scanning method by using a laser light source with a Gaussian beam spot of approximately 2 μm. The position of the doublet lenses is controlled by a tuning fork moving up and down at high frequency. When the beam was focused on the sample (colony) surface, the reflected light traveled back along the original optical path and was directed toward the pinhole to produce the highest level of intensity on the light receiving element. If the laser is unfocused, some of the reflected light would be occluded at the pinhole. Therefore, the relative height of the measured surface was registered by the sensor positioned at the bottom of the tuning fork, and the values are calculated and converted to an absolute height value (Keyence-Corporation, 2006).

A micro-objective lens (Bausch & Lomb, 20x, N.A. 0.4) is placed just below the Petri dish to focus the transmitted light onto the active area of the photodiode (Hamamatsu, S1087) (Figure 1B). This photodiode offered a low background noise (10 pA) with a wide dynamic range and provided a spectral response from 320 to 730 nm with the peak sensitivity at 560 nm. The active area for this photodiode is 1.3 × 1.3 mm², providing a photo sensitivity of 0.19 A/W for the incoming laser from the CDM sensor head on which a custom built active components driven I-V converter and preamp were installed at a preamp section. A custom built micro controller unit (MCU) (AVR128, Atmel) was used as a data acquisition unit. Through use of the MCU's internal 10 bit A/D conversion, all signals from the photodiode circuit and CDM were captured and transferred simultaneously to the PC by means of serial communication. All sequences were controlled by a custom built graphic user interface (GUI) at the PC, which was developed using Microsoft Visual Studio 2008 and both were analyzed and visualized in MATLAB.

The bacterial colony and a semi-solid media are positioned at the aperture plane, and the forward scattering pattern is captured at the image plane, defined as (x_a, y_a) and (x_i, y_i), respectively. A bacterial colony is modeled as a bell curve shape with tailing edge (Gaussian-like profile) where colony center height and radius is defined as H₀ and r_c, respectively. Based on Rayleigh and Sommerfeld formation of diffraction, and Fresnel diffraction approximation (Bae et al., 2007, 2010), intensity of electric field at aperture and image plane is derived as Equations (1) and (2), respectively, where distance between aperture plane to a point at image plane, r_ai is assumed as Equation (3).

Since previous researchers focused on structural morphology of bacterial colony such as elevation and colony diameter, the colony was modeled as smooth curve with Gaussian profile function without considering surface roughness. In reality, a cross section of bacterial colony showed the accumulation of densely packed multiple layers of bacterial cells (Banada et al., 2009; Bae et al., 2010; Suchwalko et al., 2013; Marcoux et al., 2014). Furthermore, Bacillus colonies also showed some degree of surface roughness (Figures 2, 3). To simplify the modeling, surface roughness is generated by random signal with colony area, and superposed to the colony morphology. Considering the surface roughness of the colony, intensity of electric field at image plane is simplified as Equation (4).

where T is amplitude modulator; f_x and f_y is defined as xi/(λz₂) and yi/(λz₂), known as a spatial Fourier frequency; Φ_r, Φ_q, Φ_g, and Φ_s is radial, quadratic, Gaussian, and surface roughness phase component respectively, and defined as:

The summation of four phase components,Φ_overall is working as phase modulator for the propagating light. The amplitude modulator T is derived as:

Coefficient of Equation (4), C is derived as:

where Δ_agar and n_agar is defined as thickness of agar and refractive index of agar respectively.

To provide quantitative speckle analysis, a MATLAB code was constructed utilizing an image processing toolbox V2.6 (Vliet, 2014). A radial Gaussian blur was applied to the raw image to apply a low pass filter that eliminates the objects while keeps the slow change in the background, and the blurred image was subtracted from the raw image to remove the background noise. The subtracted image was binarized with locally adaptive threshold using approximation of gradient of background intensity to eliminate the external lighting and local CMOS sensor sensitivity characteristics effect on the image. Then, each speckle was segmented, grouped, and labeled. Number of pixels (size of the speckle) and feret diameter (Merkus, 2009) of each segmented group was computed, and analyzed.

The phase contrast microscopic (PCM) images of colonies of B. subtilis and B. polymyxa on both BHI and PRM were contrasting (Figure 2). B. subtilis colony has an irregular boundary with bumpy and uneven surface structure on both media (Figures 2A,B). Due to the limitation of phase contrast microscopic setup, the 3-D elevation cannot be interpreted with current image but B. subtilis shows a representative swarming colony characteristics, where spatially localized variations of bacterial cell densities are observed. Meanwhile, B. polymyxa had symmetrical circular boundary with relatively smooth surface curvature (Figures 2C,D). As the PCM result showed, the colony forming characteristics of B. polymyxa was drastically different from the majority of other Bacillus species including B. subtilis, B. cereus, and B. thuringiensis.

To compensate the phase contrast microscope image, ICAM was utilized to acquire spatially resolved optical characteristics from a single colony. Figures 3A,B show the morphology map of B. subtilis and B. polymyxa colony on PRM, respectively from morphology channel of ICMA; whereas panel (d) and (e) show their corresponding spatially resolved transmittance in optical density (OD) units with 670 nm light source. Colonies of both species on PRM agar were captured after 7 h of growth, when the center diameter of B. polymyxa colony reached to approximately 800 μm. Similar to the PCM result, morphology map by ICMA revealed that boundary of B. subtilis colony was irregular, while, B. polymyxa colony had near circular symmetrical boundary (Figures 3A,B). Comparison of morphology cross section for the both species at their center area showed that B. subtilis colony had random bumpy profile with rough surface, while B. polymyxa colony had bell curve-like profile with relatively smooth surface (Figure 3C). B. subtilis colony had approximate 890 μm cross sectional diameter and 57 μm of center peak height, while, B. polymyxa colony had 814 μm diameter and 66 μm of colony center height. Considering the colony aspect ratio (colony center height to diameter ratio) of each species, B. subtilis (1:15.6) colony had more flat cross sectional profile than B. polymyxa (1:12.4) at the same diameter. Furthermore, the 2-D transmittance map (cross-sectional OD profile) of both species shows more distinctive characteristics, which can be attributed to colony morphology and opacity (Figures 3C,F). Since the OD of BHI agar plate alone at 670 nm was approximately 0.2, cross section of the OD result had 0.2 offset. Cross section of B. subtilis colony OD fluctuates from 0.24 to 0.41, while B. polymyxa colony had OD with maxima 0.29. Assuming that each species of bacterial cell had identical optical characteristic, this irregularity and randomness of OD can be ascribed to different spatial cell density that is translated into variation in light absorption. In addition, surface roughness of the B. subtilis colony can be modeled as variation in reflected and transmitted light intensity (Figure 3).

In previous studies, optical forward scattering pattern or ELS of Salmonella, E. coli, and Staphylococcus showed characteristics symmetric or concentric circle with some radial spokes (Banada et al., 2009). However, forward scattering pattern of Bacillus species (except B. polymyxa) showed speckle pattern (Figures 4A, 5). Diffraction pattern of B. subtilis colony is consisted of only small sized random speckle, while, B. polymyxa shows concentric circular pattern (Figure 4). To verify the time resolved speckle development of Bacillus species on their forward scattering pattern, B. subtilis, B. cereus, and B. thuringiensis were selected and their diffraction patterns were measured after 6–8 h of growth using BARDOT (Figure 5). As the incubation time increased from 6 to 8 h, the diffraction patterns also evolved to fully developed speckles, i.e., structured patterns progressively became unstructured random speckles. All three Bacillus species displayed similar trend as the incubation time increased where average speckle numbers decreased.

To investigate the effect of surface roughness on forward scattering pattern, other components of models are kept constant for Equations (5)–(11). The effect of random surface phase component (Φ_s) on forward scattering pattern was determined (Figure 6). Figure 6A shows the forward scattering pattern prediction when the surface phase component was equal to zero which means, the colony surface was devoid of any random structures. The predicted scatter image contained concentric ring patterns with small bright ring at the center and the thickness of rings increased as they moved outwardly. To mimic the random surface roughness effect, Equation (8) was adopted which is a random function multiplied by the wave number k, and is only influenced by bacterial colony region. The maximum amplitude of the random function for Equation (8) was chosen as 1/150, 1/100, and 1/80 of colony center height for fine, medium, and coarse surface roughness, respectively. The surface roughness component (Φ_s) is added to Gaussian phase component (Φ_g), and worked as a part of phase modulator, which can deform the incident wave front. Predicted forward scatter patterns are shown for fine (Figure 6B), medium (Figure 6C), and coarse surface roughness (Figure 6D). For a diffraction pattern prediction with fine surface roughness effect, relatively larger size speckles and less number of speckles were generated, and still had concentric circle pattern. As the surface roughness increased, the size of the speckle decreased and higher number of speckles were generated, and formed a random speckle pattern rather than concentric circle pattern as predicted.

Figure 7 shows the comparison of theoretical speckle development on diffraction pattern by surface roughness and that from experiment. The results were plotted for speckle area vs. the number of speckles. For the prediction, the maximum amplitude of the random function for Φ_s were set as 1/200, 1/150, and 1/100 of B. cereus colony center height for fine, medium, and coarse roughness, respectively. As the theoretical model moved from coarse (□) to fine (⊳) surface roughness, the model predicts decreasing average speckle size with increasing numbers. Similar trend was observed in experiment with B. cereus ATCC14579 incubated from 6 h (□) to 8 h (Δ) (Figure 7A). For B. thuringiensis DUP6044, Φ_s was changed to 1/180, 1/130, and 1/100 of colony center height and an excellent agreement between theory and experiment was evident (Figure 7B). For example, coarse surface roughness (□) and 9 h incubation (Δ) showed almost similar trend in average speckle size and the numbers.

Euiwon Bae and Arun K. Bhunia are inventors of “System and method for rapid detection and characterization of bacterial colonies using forward light scattering” (US Patent No. 7465560), designated BARDOT, described in this review. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.