Edited by: Mark Vincent Brown, University of New South Wales, Australia
Reviewed by: Lucas Stal, Netherlands Institute of Sea Research, Netherlands; Wei Xie, Tongji University, China
*Correspondence: Xingguo Liu
Zhuojun Ma
This article was submitted to Aquatic Microbiology, a section of the journal Frontiers in Microbiology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Pond aquaculture is the major freshwater aquaculture method in China. Ammonia-oxidizing communities inhabiting pond sediments play an important role in controlling culture water quality. However, the distribution and activities of ammonia-oxidizing microbial communities along sediment profiles are poorly understood in this specific environment. Vertical variations in the abundance, transcription, potential ammonia oxidizing rate, and community composition of ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) in sediment samples (0–50 cm depth) collected from a freshwater aquaculture pond were investigated. The concentrations of the AOA
China is the world's largest producer, consumer, processor, and exporter of fish. China alone accounts for >60% of the global aquaculture volume and roughly half of the global aquaculture value (Cao et al.,
Nitrification, the biological conversion of ammonia (NH3) to nitrate via nitrite (
The oxidation of ammonium mainly occurs in the pond sediments, probably because of photoinhibition, and we previously found a low abundance of ammonia-oxidizing microorganisms in freshwater aquaculture water throughout the year (Lu et al.,
Samples were collected from a freshwater aquaculture pond located at the Research Center for Pond Ecosystem Engineering, Chinese Academy of Fishery Sciences [30°56′ N, 121°09′ E], Shanghai, China. The sampling pond had a surface area of ~5000 m2 and an average depth of about 1.6 m. Wuchang bream (
Three sediment cores (5 cm diameter and 50 cm depths) were collected from the aquaculture pond in October 2014 using a polyvinylchloride pipe. Then, the sediment cores were placed in sterile plastic bags, sealed, and transported to the laboratory on ice. Later, they were sectioned to 2 cm from 0 to 10 cm depths, and to 5 cm at 10–50 cm depths, and then we mixed the different cores from each sample for each depth. One portion was incubated to determine the ammonia oxidation activities immediately after arrival, another portion was used for an analysis of chemical components, and subsamples were stored at −80°C for subsequent DNA and RNA extractions and molecular analysis.
Ammonium (
Potential ammonia oxidation rates were measured using the chlorate inhibition method (Kurola et al.,
Extraction of DNA from the sediment samples was conducted, and two controls were performed to estimate the possible inhibition of qPCR performance by the co-extracted polyphenolic compounds or humic acids in the sediment, as described by Lu et al. (
AOA |
Arch-amoAF | STAATGGTCTGGCTTAGACG | 200 | 95°C for 30 s; 35 cycles of 95°C for 5 s, 53°C | Francis et al., |
Arch-amoAR | GCGGCCATCCATCTGTATGT | 200 | for 1 min, 72°C for 70 s, and 80°C for 20 s (read plant); | ||
β-AOB |
GGGGTTTCTACTGGTGGT | 200 | 95°C for 30 s; 40 cycles of 95°C for 5 s, 54°C | Rotthauwe et al., |
|
CCCCTCKGSAAAGCCTTCTTC | 200 | for 40 s, 72°C for 70 s, and 80 for 20 s (read plant); | |||
Bacteria | 1055f | ATGGCTGTCGTCAGCT | 400 | 95°C for 30 s; 35 cycles of 95°C | Amann et al., |
16S rRNA | 1392r | ACGGGCGGTGTGTAC | 400 | for 5 s, 54°C for 45 s, 72°C for 45 s (read plant); | Wilson et al., |
Crenarchaeota | 771F | ACGGTGAGGGATGAAAGCT | 400 | 95°C for 30 s; 40 cycles of 95°C for 5 s, 54°C | Torsten et al., |
16S rRNA | 957R | CGGCGTTGACTCCAATTG | 400 | for 45 s, 72°C for 40 s, and 80°C for 20 s (read plant); |
Standard curves for qPCR were developed as described previously (Lu et al.,
The purified PCR products were ligated and cloned using the pMD ™18-T Vector (Takara). In total, 105 and 76 clones of the AOA and AOB
The estimated coverage of the constructed
The nucleotide sequences obtained in this study were deposited in the GenBank database under accession nos.
The vertical distribution profiles of TOC,
The concentrations of TOC,
To detect the presence of AOA, AOB, as well as the Crenarchaeota and total bacterial, the
To obtain more detailed information about the AOA and AOB in the freshwater aquaculture pond sediments, the potential ammonia oxidation rate was obtained from every sample, and it ranged from 0.0014 ± 0.0001 to 0.0386 ± 0.0028 mg kg−1 h−1. The potential ammonia oxidation rates in 0–6 cm deep sediments were significantly higher than those in other sediment layers (
To investigate the diversity and community composition of ammonia-oxidizing populations, sediment layers with depths of 0–2 and 4–6 cm, as well as 0–2, 10–15 cm, and 20–25 cm, were selected for the construction of clone libraries of bacterial and archaeal
An obvious variation in the AOA community and structure with sediment depth was also observed. As shown in Figure
A significant positive correlation between the abundance of AOA and TOC was observed. This may indicate that AOA are able to assimilate organic substrates and thereby be able to grow mixotrophically or even heterotrophically. This view is supported by studies of archaeal isolates from soil and marine sediments (Tourna et al.,
Because of large depositions of feeding debris and feces in the aquaculture pond, the surface sediments were rich in organic substances and exhibited a high
AOA, rather than AOB, were the numerically predominant ammonia-oxidizing organisms in the surface sediment. This could be attributed to the fact that AOA are more resistant to low levels of DO (Coolen et al.,
Apart from the
To better understand the activity of the ammonia-oxidizing community in different sediment layers, potential ammonia oxidation rates were measured in the laboratory. Variations in the potential ammonia oxidation rates were not explained by the concentrations of
The results for the expression of
The diversity of AOB has been studied in various ecosystems with molecular tools, and it has been shown that AOB exhibit apparently high biodiversity in many aquatic ecosystems (Nicol et al.,
Like AOB, the archaeal
In summary, our results showed that diversity of AOA and AOB decreased with increasing sediment depth and different dominant species were found at the different depths sampled. AOA were less active than AOB in surface sediments (0–10 cm depth) of the freshwater aquaculture pond, however, where AOA, as opposed to AOB, were the most abundant ammonia-oxidizing organisms. AOA might be the dominant ammonia-oxidizing microorganisms in deeper sediments, where only the AOA
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
This study was financially supported by the National Natural Science Foundation (grant no. 31372570), a project in the National Science & Technology Pillar Program during the Twelfth Five-year Plan Period (no. 2012BAD25B01), and an Open Fund of the Key Laboratory of Fishery Equipment and Engineering, Ministry of Agriculture (grant no. 2014006) of China. We also thank Dr. Liao Ming-jun (College of Resource and Environmental Engineering, Hubei University of Technology, Wuhan 430068, China) for reading the manuscript.