Edited by:
Reviewed by:
*Correspondence:
†
This article was submitted to Infectious Diseases, a section of the journal Frontiers in Microbiology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
In oral health, the interdental spaces are a real ecological niche for which the body has few or no alternative defenses and where the traditional daily methods for control by disrupting biofilm are not adequate. The interdental spaces are the source of many hypotheses regarding their potential associations with and/or causes of cardiovascular disease, diabetes, chronic kidney disease, degenerative disease, and depression. This PCR study is the first to describe the interdental microbiota in healthy adults aged 18–35 years-old with reference to the Socransky complexes. The complexes tended to reflect microbial succession events in developing dental biofilms. Early colonizers included members of the yellow, green, and purple complexes. The orange complex bacteria generally appear after the early colonizers and include many putative periodontal pathogens, such as
Of all of the parts of the human body, the interdental (ID) space is a unique place, a real ecological niche, for which the body has few or no alternative defenses and where the traditional daily methods for control by disrupting biofilm are not adequate. This niche is the source of many hypotheses of its potential associations with and/or causes of cardiovascular disease (
For the mouth, the Human Oral Microbiome Database lists 1,200 predominant oral species, with some 19,000 phylotypes (
Due to its unusual anatomy between adjacent teeth and the gingival tissue, the interdental space – in fact the 30 interdental spaces for an individual – is a huge source of bacteria (
Periodontitis affects millions of people each year (
An understanding of what is happening within these interdental spaces is a priority. This knowledge will lead to new recommendations and innovative preventive methods to significantly reduce gingivitis, periodontitis and related diseases. The first stage consists of qualitatively and quantitatively describing the microbiota of the interdental space from clinically healthy subjects. In the longer term, this information will enable the immune and inflammatory mechanisms involved in periodontal pathologies to be better understood. The objective of our bacterial cartography study is based on the benchmark framework of the Socransky complexes, which have the consensus of the scientific community (
Currently, no study has addressed interdental biofilm in healthy adults. The main objective of this study is to describe the interdental microbiota in healthy adults with reference to the Socransky complexes. For this purpose, a quantitative detection system has been developed that uses real-time PCR methodology to quantify 19 major periodontal pathogens, including the following bacteria from (i) the blue complex –
Research findings can contribute greatly to improving the periodontal health of people. Findings can be used to make decisions on new policies in relation to molecular analysis about classification of periodontal diseases and provision of services (e.g., instituting new procedures, practices and interventions, including those for prevention) related to periodontal health-care delivery. Furthermore, research findings can also be used for advocacy or promoting the adoption of best practice to prevent or mitigate consequences of risks to health.
The workflow of the experiment was described in
Twenty-five Caucasian subjects diagnosed as periodontally healthy (H) were recruited between January and April 2015 from a pool of first-time volunteers who were referred to the Department of Public Health of the Faculty of Oral Medicine at the University of Lyon (UCBL), France. Written informed consent was obtained from all enrolled individuals in accordance with the Declaration of Helsinki. The study protocol was reviewed and approved by the National Ethics Committee and by the National Commission of Informatics and Liberties, France.
The inclusion criteria were: (i) age 20–35 years-old, (ii) good general health, and not pregnant or breastfeeding, (iii) no health conditions that required antibiotic prophylaxis before interproximal probing, (iv) periodontally healthy, (v) tooth brushing at least twice per day, (vi) no experience with interdental cleaning – interdental brushing or dental flossing, (vii) no intake of systemic antimicrobials during the previous 6 months, (viii) no use of chlorhexidine or over-the-counter mouthwash, (ix) no implants or orthodontic appliances, (x) no previous periodontal illness or treatment, (xi) the presence of at least 24 natural teeth, (xii) the presence of four premolar-molar pairs, (xii) non-smokers, and (xiii) a willingness to return 3 weeks after the clinical investigation for microbiological tests.
The clinical inclusion criteria for each premolar-molar interdental site were: (i) accessibility of the interdental space for the four sites (15–16, 25–26, 35–36, and 45–46) by the interdental brush in each subject; (ii) no interproximal caries or dental or prosthetic restorations; (iii) no interdental diastema; (iv) no clinical signs of inflammation, such as redness, swelling, or bleeding on probing (BOP) after 30 s; (v) no pocket depth (PD) > 3 mm or clinical attachment loss (CAL) > 3 mm; and (iv) the subjects were judged to be free of gingivitis or periodontitis.
The exclusion criteria were: (i) teeth missing due to periodontal reasons, (ii) having any other concomitant systemic disorder, (iii) having diseases affecting the immune system, (iv) receiving medication, such as anti-platelet or anti-coagulant agents, (v) having a professional prophylaxis 4 weeks prior to the baseline examination, (vi) having a history of periodontal disease or treatment, and (vii) subjects undergoing a course of dental or orthodontic treatment.
All subjects were diagnosed according to criteria described by the American Academy of Periodontology (
In a group of 10 individuals who did not participate in this study, pairs of examinations were conducted in each individual, with a 1-h interval between them. Intraclass correlation coefficients for PD and CAL were calculated at the site level. The intra- and inter-examiner coefficients for CAL ranged between 0.80 and 0.85, and between 0.75 and 0.85 for PD.
Standardized clinical monitoring was performed 3 weeks before microbiological monitoring. The subjects were submitted to a medical/dental anamnesis, and information regarding their age, gender, and smoking status was obtained. The clinical examination was performed by trained and calibrated periodontists. Clinical measurements were taken at six sites per tooth (mesio-buccal, buccal, disto-buccal, disto-lingual, lingual, and mesio-lingual) on all teeth, with the exception of the third molars, as previously described (
For all subjects, the same four interdental sites (15–16, 25–26, 35–36, and 45–46) were assessed (total 100 sites). The appropriate prime interdental brushes (Curaden, Kriens, Switzerland) were selected based on the clinical assessment of the interdental spaces (
Total DNA was isolated from the interdental brushes using the QIAcube® HT Plasticware and Cador® Pathogen 96 QIAcube® HT Kit (Qiagen, Hilden, Germany), according to manufacturer’s guidelines. The elution volume used in this study was 150 μL. DNA quality and quantities were measured using an ultraviolet spectrophotometer at 260 and 280 nm.
To quantify the total bacterial load (TB) and that of 19 pathogen species (
Simplex quantitative real-time PCR assays were performed in a 10 μL reaction composed of 1× SYBR® Premix Ex TaqTM Tli RNaseH Plus (TaKaRa, Shiga, Japan), 2 μL of the extracted DNA and 1 μM of each primer. The bacterial primers used are derived from previously published ribosomal 16S sequences and have been adapted to the real-time PCR conditions (
Species-specific and ubiquitous real-time PCR primers for 19 periodontal bacteria, the annealing temperature, and the limit of quantification.
Target | Primer pairs (5′–3′) | Reference | Annealing temp (°C) | LOQ (E+02) |
---|---|---|---|---|
TB | CCATGAAGTCGGAATCGCTAGT |
66 | 200 | |
AAACCCATCTCTGAGTTCTTCTTC |
60 | 10 | ||
AGGCAGCTTGCCATACTGCG |
60 | 4 | ||
GCGTATGTAACCTGCCCGCA |
60 | 80 | ||
TAATACCGAATGTGCTCATTTACAT |
60 | 10 | ||
CGTGGACCAAAGATTCATCGGTGG |
60 | 60 | ||
AGAGTTTGATCCTGGCTCAG |
60 | 60 | ||
AGAGTTTGATCCTGGCTCAG |
60 | 40 | ||
TTTCGGAGCGTAAACTCCTTTTC |
60 | 20 | ||
GGGAAGAAAAGGGAAGTGCT |
60 | 50 | ||
ATGAAACAAAGGTTTTCCGGTAAG |
66 | 5 | ||
AGAGTTTGATCCTGGCTCAG |
66 | 5 | ||
AGAGTTTGATCCTGGCTCAG |
66 | 5 | ||
AGAGTTTGATCCTGGCTCAG |
66 | 5 | ||
GGCTCAAAAGAGATCGCTCA |
66 | 5 | ||
GAGTCCTGCATCAGCCAAGAG |
66 | 5 | ||
AGAGTTTGATCCTGGCTCAG |
66 | 10 | ||
CTTTGGGATAACGCCGGGAAAC |
66 | 5 | ||
ATGTGGGTCTGACCTGCTGC |
60 | 5 | ||
GAAGCATTGGAAGCGAAAGTTTCG |
60 | 5 |
The assays were performed on the Rotor-Gene® Q thermal cycling system (Qiagen, Hilden, Germany) with the following program: 95°C for 30 s, followed by 40 cycles of 10 s at 95°C, 10 s at the appropriate annealing temperature (
Serial dilutions of a bacterial standard DNA provided by Institut Clinident SAS (Aix en Provence, France) were used in each reaction as external standards for the absolute quantification of the targeted bacterial pathogens. The standard bacterial strains used for standard DNA production came from DSMZ (Germany), CIP Collection of Institut Pasteur or from BCMM/LMG Bacteria Collection:
The statistical analysis consists of three main steps, namely producing descriptive summaries of the data, modeling the data using a mixed (linear) model and assessing the correlations between bacterial abundances. Prior to these steps, we transformed the original count data to handle missing data points, namely the measurements that fell under the quantification threshold (LOQ) of the quantitative real-time PCR device. The missing values for a given species were replaced by half of the corresponding quantification thresholds given in
All statistical analyses and associated plots were performed using the R environment (
The age, the sex and clinical assessments of the study group are summarized in
Age, sex, and characteristics of the full mouth and sampled sites of the study group.
Age (years) | 26.8 ± 4.6 |
Sex | |
Male | 15 |
Female | 10 |
Teeth | 28.9 ± 1.2 |
BOP (%) | 0.16 ± 0.08 |
PD (mm) | 0.95 ± 0.21 |
CAL (mm) | 0.95 ± 0.21 |
BOP (%) | 0.00 ± 0.00 |
PD (mm) | 1.40 ± 0.21 |
CAL (mm) | 1.54 ± 0.24 |
Average abundances for species of the Socransky complexes in various subgroups of the cohort.
Variable | TB | TS | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Alla | 100 | 10 | 7.9 | 2.6 | 5.6 | 4.4 | 6.3 | 5 | 5.8 | 3.5 | 2.9 | 5 | 6.2 | 4.8 | 6.6 | 6.2 | 4.2 | 5.5 | 7.5 | 3 | 6 | 4.6 |
Bacteria/TBb | 100 | 100 | 0.94 | 0.00 | 0.02 | 0.00 | 0.10 | 0.01 | 0.03 | 0.00 | 0.00 | 0.00 | 0.03 | 0.00 | 0.15 | 0.09 | 0.00 | 0.02 | 0.37 | 0.02 | 0.02 | 0.04 |
Positives sitesb | 100 | 100 | 100 | 22 | 100 | 92 | 100 | 100 | 97 | 87 | 6 | 100 | 100 | 98 | 96 | 81 | 87 | 88 | 100 | 19 | 93 | 49 |
Age (years) | * | * | * | * | ** | * | ||||||||||||||||
20–24a | 44 | 9.9 | 7.8 | 2.6 | 5.7 | 4.5 | 6.2 | 5 | 5.7 | 3.3 | 2.9 | 5.2 | 6.3 | 4.7 | 6.4 | 6.1 | 4 | 5.3 | 7.5 | 2.6 | 5.5 | 4 |
25–29a | 24 | 9.9 | 7.7 | 2.7 | 5.6 | 3.9 | 5.9 | 4.1 | 5.8 | 3.1 | 2.7 | 4.8 | 5.9 | 4.6 | 5.8 | 5.7 | 4 | 5.2 | 7.3 | 3.5 | 6 | 3.9 |
30–35a | 32 | 10.2 | 8.3 | 2.5 | 5.5 | 4.6 | 6.9 | 5.5 | 5.9 | 4.1 | 3.1 | 5 | 6.2 | 5.2 | 7.4 | 6.7 | 4.7 | 6.1 | 7.7 | 3.2 | 6.6 | 5.9 |
Sex | * | * | ||||||||||||||||||||
Malea | 60 | 10 | 7.9 | 2.5 | 5.6 | 4.3 | 6.4 | 5.1 | 5.9 | 3.5 | 2.8 | 5.1 | 6.2 | 4.6 | 6.7 | 6 | 4 | 5.6 | 7.4 | 2.9 | 5.8 | 4.7 |
Femalea | 40 | 10.1 | 8 | 2.7 | 5.6 | 4.5 | 6.3 | 4.8 | 5.7 | 3.6 | 3 | 4.9 | 6.2 | 5.2 | 6.5 | 6.5 | 4.5 | 5.5 | 7.6 | 3.2 | 6.2 | 4.4 |
Arcade | *** | * | * | |||||||||||||||||||
Uppera | 50 | 10 | 7.9 | 2.6 | 5.6 | 4.4 | 6.7 | 5.1 | 5.9 | 3.6 | 2.8 | 5.1 | 6.2 | 4.9 | 6.5 | 6 | 4.2 | 5.4 | 7.5 | 3 | 5.9 | 4.4 |
Lowera | 50 | 10 | 7.9 | 2.6 | 5.6 | 4.4 | 6 | 4.8 | 5.7 | 3.4 | 3 | 5 | 6.2 | 4.8 | 6.7 | 6.4 | 4.2 | 5.7 | 7.5 | 3 | 6 | 4.8 |
IDB size | * | * | * | * | ** | * | ||||||||||||||||
0.6 mma | 5 | 9.9 | 7.8 | 2.4 | 6 | 4.5 | 6.2 | 4.4 | 5.7 | 3.9 | 2.7 | 4.4 | 5.9 | 4.7 | 6.7 | 6.2 | 3.9 | 5.6 | 7.4 | 2.6 | 6.4 | 4.6 |
0.7 mma | 55 | 10 | 7.8 | 2.6 | 5.7 | 4.3 | 6.1 | 4.6 | 5.8 | 3.1 | 2.8 | 4.8 | 6 | 4.8 | 6.2 | 6 | 4.1 | 5.5 | 7.4 | 2.8 | 5.8 | 4.2 |
0.8 mma | 25 | 10.1 | 8 | 2.6 | 5.6 | 4.4 | 6.5 | 5.3 | 5.9 | 3.7 | 2.8 | 5.4 | 6.4 | 4.9 | 7 | 6.2 | 4.4 | 5.5 | 7.6 | 3 | 6.1 | 5.2 |
0.9 mma | 8 | 10.3 | 8.3 | 2.6 | 5.4 | 4.2 | 7.2 | 6.2 | 5.9 | 4.4 | 2.7 | 4.9 | 6.3 | 5.2 | 7.3 | 6.6 | 4.6 | 5.9 | 7.6 | 3 | 6.3 | 5.7 |
1.1 mma | 7 | 10.3 | 8.2 | 2.4 | 5.3 | 5.1 | 6.6 | 6 | 5.2 | 4.5 | 4.2 | 5.7 | 6.8 | 4.9 | 7.2 | 7 | 4.4 | 5.8 | 7.7 | 4.6 | 6.1 | 4.7 |
Because the counts for bacterial abundance may span several orders of magnitude from one site to another (
The mean counts for the total bacterial load (TB) and that of the 19 evaluated species in the interdental biofilm are reported in
The abundance of the 19 evaluated species among the samples is presented in
Within each Socransky complex, the expression level of each bacterium differed. The main bacteria were:
The genome counts for
The 19 bacteria studied here were grouped into the complexes defined by
The comparison of the mean value of each Socransky complex according to age and the interdental space diameters was shown in
To our knowledge, this investigation is by far the largest study employing real-time PCR to study periodontal pathogens in healthy interdental plaques. An understanding of the mechanisms involved in the onset and progression of periodontal diseases could greatly help establish effective ways to prevent and treat of these diseases and decrease the risk factors for relevant systemic disorders. In oral health, the interdental space is a very specific location. From an anatomical point of view, it is not easily accessible to brushing. From a physiological point of view, it is the seat of many more or less virulent bacteria; it is not only the location where interproximal caries are initiated but also the location of periodontal diseases, such as gingivitis and periodontitis.
Gingivitis is an inflammation of the periodontal marginal tissue in response to bacterial biofilms that adhere to tooth surfaces (
The clinical signs of gingivitis either do not appear as plaque accumulates, or they are greatly delayed in children, and the inflammatory infiltrate mainly consists of T lymphocytes. The conversion to a B cell lesion does not appear to occur (
The anatomical characteristics of the periodontium, such as gingival thickness, gingival width and alveolar bone morphology, will determine periodontium behavior when it is submitted to physical, chemical, or bacterial injury (
In this variably sized space, the interdental papilla is only lightly keratinized and is thus more permeable to bacterial products – lipopolysaccharides (endotoxins), chemotactic peptides, protein toxins, and organic acids – released by the biofilm (
Bacteria circulating in the saliva will gradually coat the enamel surface to form the biofilm. Unlike the enamel lingual and palatal surfaces, which undergo self-cleaning by the action of the tongue, or buccal surfaces that undergo self-cleaning by alveolar mucosa, the interdental space has no self-cleaning mechanism, and the passage of salivary fluid has little or no action on the formation of the interproximal biofilm (
Furthermore, in daily oral hygiene activities, it is technically impossible to reach this space and to disrupt the biofilm of the healthy adult in the posterior parts of the mouth (
Our study characterizes the interdental biofilm of periodontally healthy young adults. For this, a new technique was used to collect the biofilm that consists of using IDB. Many studies have employed different collection techniques, including paper points, sterile cotton swaps, curettes or strips, in the sulcus, mesial and distal surfaces of teeth and were mainly focused on the subgingival plaque (
The commonly used methods are not suitable for assessing interdental plaque (directly under the contact area) and thereby limit the interpretation of interdental plaque removal. The term interdental refers to the area under and related to the contact point. The interdental gingiva fills the embrasure between two teeth apical to their contact point. It is difficult to clinically assess the middle interdental area, as they are usually not available for direct visualization (
Our results showed that the interdental space is an area in which biofilm accumulates. In periodontally healthy young adults aged from 20 to 35 years, it contains approximately 1010 bacteria, whereas in other studies, such as the study by
To collect the best data on the composition of interdental biofilm, real-time PCR was used to study the periodontal pathogens expressed in the interdental biofilm of periodontally healthy sites. It is well-known that periodontal diseases appear when some specific bacteria are expressed and reach a critical level (
The 19 bacteria studied here belong to Socransky’s complexes (
Our study highlights the fact that bacteria from the yellow complex (
Concerning the yellow complex,
Concerning the blue complex, which is composed of
Concerning the green complex, particularly the three
Among the bacteria of the purple complex, our study revealed that
Although bacteria of the yellow, green, purple, and blue complexes are usually compatible and associated with periodontal health, more and more data tend to prove that these bacteria may be associated with periodontal disease or systemic diseases (
Concerning the orange complex, this study focused on
Our data indicated that
The red complex, which is recognized as comprising the most important pathogens in adult periodontal disease (
In accordance with the study by
The importance of
Chronic periodontitis has a polymicrobial biofilm etiology, and interactions between key bacterial species are strongly implicated in contributing to disease progression.
The interdental biofilm of young periodontally healthy subjects is composed of bacteria that are able to induce periodontitis. The effective presence of the red complex, particularly
DB and FC conceived the experiments; FC, SV, and JS performed the experiments; PV analyzed the data; and FC, DB, and SV wrote the paper.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We acknowledge the support of our work by Institut Clinident SAS (Aix en Provence, France) and the PRABI bioinformatics platform (Lyon, France) for providing computational and methodological support.
The Supplementary Material for this article can be found online at: