Edited by: José Roberto Mineo, Federal University of Uberlandia, Brazil
Reviewed by: Manuel Vilanova, University of Porto, Portugal; Roland Lang, University Hospital Erlangen, Germany
*Correspondence: Yongqing Zeng
Wei Chen
This article was submitted to Microbial Immunology, a section of the journal Frontiers in Microbiology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) mimic the immunostimulatory activity of microbial DNA by interacting with Toll-like receptor 9 (TLR9) to activate both the innate and adaptive immune responses in different species. However, few studies have been published to compare the effects of CpG ODN on different pig breeds. Therefore, in this study, whole blood gene expression profiles of DPL and Landrace pigs treated with CpG ODN were studied using RNA-seq technology. Five Hundred differentially expressed genes (DEGs) were identified between the two breeds. DPL pigs had significantly higher number of immune-relevant DEGs than the Landrace pigs after CpG ODN treatment. Pathway analysis showed that cytokine-cytokine receptor interaction and chemokine signaling pathway were the major enriched pathways of the immune-relevant DEGs. Further
In the pig production industry, infectious diseases caused by viral and bacterial pathogens seriously influence animal welfare, product quality and economics around the world (Meng,
Toll-like receptors (TLRs) are a family of pattern recognition receptors (PRR), which recognize invading pathogens by an array of conserved molecular structure known as pathogen-associated molecular patterns (PAMPs), playing critical roles in innate antimicrobial immune responses (Kumar et al.,
Next-generation sequencing (NGS) technology has provided a very useful platform to easily compare DEGs and assess mRNA transcription patterns for all the genes in various species (Wilhelm and Landry,
Twelve female DPL and twelve female Landrace pigs (all at day 28 of age) were purchased from Jiaxiang DPL Farm, Jining City, China. These pigs were housed in adjacent pens (6 pigs per pen separated by breed) under the same standard conditions to reduce environmental effects on gene expression. The pigs had access to the same food three times a day and water
Six DPL and six Landrace pigs were injected with C CpG ODN 2429 TCGTCGTTTTCGGCGGCCGCCG (CpG) (Shenggong Biotech Co, Shanghai, China) at the dose of 500 μg/kg body weight according to the reference (Dar et al.,
Among the 6 pigs from each breed treated with CpG ODN, blood samples from 3 DPL and 3 Landrace pigs were used for RNA-seq experiment. The whole blood RNA was extracted using a RNAsimple Total RNA kit (Tiangen Biotech Co, Beijing, China) according to the manufacturer's instructions. RNA concentration and purity were assessed using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). RNA integrity was assessed using a RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). According to the manufacturer's recommendations, the sequencing libraries were generated using a NEBNext® Ultra RNA Library Prep Kit from Illumina (New England Biolabs, Ipswich, MA, USA) by Biomarker Technologies Corporation (Beijing, China). Briefly, mRNA was isolated from total RNA using magnetic oligo (dT) beads (Invitrogen, Carlsbad, CA, USA) and was further fragmented into about 200 bp. The first and the second strands of cDNA were synthesized using theses fragmented mRNAs. Finally, the suitable cDNA fragments were PCR-amplified to generate a complete cDNA library. The cDNA library was sequenced using an Illumina HiSeq 2500 instrument at the Biomarker Technologies Corporation (Beijing, China).
After discarding low quality sequence reads (reads with adaptors, unknown nucleotides larger than 5%, or Q20 <20%) by perl script, all clean reads were aligned to the reference genome of
All DEGs were submitted to the databases of Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) for enrichment analysis. GO analysis was performed using the Blast2 GO software (Conesa et al.,
Whole blood samples from the remaining six DPL and six Landrace pigs also at day 35 after birth were collected via external jugular vein using 10 mL vacutainers coated with EDTA. PBMCs were isolated by FICOLL density gradient centrifugation as described by Fuss et al. (
Total RNA of the PBMCs was extracted using Trizol (Takara Biotechnology, Dalian, China) according to the manufacturer's instructions. The quantity and quality of the isolated RNA were determined via UV260/280 using a biophotometer (Eppendorf, Hamburg, Germany). A two-step qRT-PCR Kit (Takara Biotechnology, Dalian, China) was used to generate cDNA according to the manufacturer's instructions. qRT-PCR was performed using a SYBR Premix Ex Taq kit (Takara Biotechnology, Dalian, China) on MX3000p RealTime PCR System (Stratagene, La Jolla, CA, USA). The primers (listed in Table
IFNα-F | CTGGCTGTGAGGAAATACTT | 118 | |
IFNα-R | TTGTGGAGGAAGAGAAGACT | ||
IFNγ-F | GGAGCATGGATGTGATGAAG | 137 | Du et al., |
IFNγ-R | GAGTTCACTGATGGCTTTGC | ||
TLR9-F | GGCCTTCAGCTTCACCTTGG | 151 | Auray et al., |
TLR9-R | GGTCAGCGGCACAAACTGAG | ||
CXCL10-F | CTGTTCGCTGTACCTGCATC | 232 | |
CXCL10-R | GCTTCTCTCTGTGTTCGAGG | ||
CXCL13-F | TTCTGGAGACCAATGACACA | 172 | |
CXCL13-R | TGAGGGTTCAAGCAGATAGC | ||
CXCL9-F | TCAACACCAGCCAAAGGATG | 180 | |
CXCL9-R | TGACCTGTTTCTCCCACTCT | ||
CCL19-F | TGCCAACGATGCTGAAGACT | 231 | |
CCL19-R | TAGTTGCGGTGGTGCTTGCT | ||
MYD88-F | GGAACAGACCAACTATCGGC | 126 | Hu et al., |
MYD88-R | GAGACAACCACTACCATCCG | ||
CCL3L1-F | CTTCCTCGCAAATTCGTAGC | 152 | |
CCL3L1-R | GCATTCAGCTCCAGGTCAG | ||
IL12 p40-F | GGGTGGGAACACAAGAGAT | 154 | Hu et al., |
IL12 p40-R | GGCTAAACTTGCCTAGAGGT | ||
B2M-F | TTCACACCGCTCCAGTAG | 166 | Martino et al., |
B2M-R | CCAGATACATAGCAGTTCAGG | ||
PPIA-F | CACAAACGGTTCCCAGTTT | 171 | Cinar et al., |
PPIA-R | TGTCCACAGTCAGCAATGGT |
The expression of genes with ≥2-fold change and FDR adjusted
In this study, we obtained approximately 31.4 gigabases (Gb) reads from the six RNA-seq libraries. After discarding low-quality reads, high percentage of the reads were mapped to the pig reference genome, ranging from 74.03 to 81.39%. Among the mapped reads, 69.74–78.96% were mapped uniquely to the pig reference genome. All six samples had nearly 90% reads equal to or exceeding Q30 (Table
Total reads | 48,632,150 | 39,206,506 | 42,966,768 | 32,416,978 | 44,590,578 | 43,659,992 |
Total base pairs | 6,127,650,900 | 4,940,019,756 | 5,413,812,768 | 4,084,539,228 | 5,618,412,828 | 5,501,158,992 |
Mapped reads | 39,582,267 81.39% | 30,911,049 78.84% | 33,909,206 78.92% | 23,998,577 74.03% | 35,345,365 79.27% | 34,459,642 78.93% |
Uniq mapped reads | 38,400,961 78.96% | 30,054,581 76.66% | 32,696,054 76.10% | 22,607,515 69.74% | 33,916,617 76.06% | 33,195,934 76.03% |
%≥Q30 | 90.01 | 89.39 | 89.52 | 90.39 | 89.58 | 89.62 |
GC content % | 58.36 | 58.84 | 58.07 | 55.94 | 57.91 | 58.14 |
L1 | L2 | 0.9856 |
L1 | L3 | 0.9946 |
L2 | L3 | 0.9873 |
DPL1 | DPL2 | 0.4738 |
DPL1 | DPL3 | 0.4597 |
DPL2 | DPL3 | 0.9985 |
After bioinformatics analysis, 500 genes were found to be differentially expressed in the whole blood samples of DPL and Landrace pigs. 64.2% (321 genes) of the DEGs had higher expression in the Landrace pigs, while 35.8% (179 genes) DEGs had higher expression in the DPL pigs. A heatmap of the DEGs was shown in Figure
To define the biological functions of the 500 DEGs, GO and KEGG analysis were performed. Fifty-two significantly enriched GO terms were identified. The main biological functions identified by GO analysis included molecular function, biological process and cellular component (Figure
Cytokine-cytokine receptor interaction | ko04060 | TNFRSF18; IL12RB2; IL1B; IL1A; IL8; CXCL2; CXCL10; OSM; CCL19; CXCR6; CSF3; CCL4; CCL3L1; CCL2; CXCL9; CCR2; CCR5; CSF1; CXCL13; IL2RB | LTBR; CCL23; CCR2; KIT; CSF1R; TNFSF13 |
Pathways in cancer | ko05200 | FOS; TRAF3; TRAF2; PLCG1; IL8; CASP3; NOS2; PIAP; JUN | MAX; BCL-XL; KIT; NCOA4; CSF1R; ITGA2B; |
Chemokine signaling pathway | ko04062 | IL8; CXCL2; CXCL10; CCL19; CXCR6; CCL4; CCL3L1; CCL2; CXCL9; CCR2; CCR5; CXCL13 | FOXO3A; CCL23; CCR2 |
MAPK signaling pathway | ko04010 | FOS; PLA2G2D; TRAF2; IL1B; IL1A; CASP3; DUSP4; JUN; Pig_newGene_8380 | MAX; RPS6KA2 |
Toll-like receptor signaling pathway | ko04620 | FOS; TRAF3; IL1B; IL8; CXCL10; CXCL9; JUN | ENSSSCG0000000900; MYD88; IRF5 |
Jak-STAT signaling pathway | ko04630 | CCND2; IL12RB2; OSM; CSF3; ENSSSCG00000022485; ENSSSCG00000029668 | BCL-XL |
Immune relevant DEGs were significantly enriched in cytokine-cytokine receptor interaction and chemokine signaling pathway. It is worth noting that 82.8% of the immune relevant DEGs (24 out of 29) had higher expression in the DPL pigs compared to the Landrace pigs, such as IL1α, IL1β, CXCL8, CXCL10, CCL19, CXCR6 (The DPL/Landrace gene ratios were 3.33-, 1.74-, 5.63-, 2.24-, 5.55- and 3.55-fold respectively) and so on. Only 17.2% of the immune relevant DEGs (5 out of 29) had higher expression in the Landrace pigs compared to the DPL pigs, such as MyD88, CCL23, CCR2 and IRF5(the Landrace/DPL gene ratios were 6.1845-, 1.34-, 1.39-, and 1.20-fold respectively). The detailed information of the major immune relevant enriched genes were shown in Table
ENSSSCG00000002525 | TRAF3 | 0.004304 | −1.26584 | Down | TNF receptor-associated factor 3-like |
ENSSSCG00000003330 | TNFRSF18 | 1.02E-07 | −2.01619 | Down | Tumor necrosis factor receptor superfamily member 18-like |
ENSSSCG00000003799 | IL12RB2 | 0.000604 | −2.13986 | Down | Interleukin-12 receptor subunit beta-2 precursor |
ENSSSCG00000005838 | TRAF2 | 0.001752 | −1.12747 | Down | TNF receptor-associated factor 2 |
ENSSSCG00000008088 | IL1B1 | 2.89E-06 | −1.7407 | Down | Interleukin-1 beta precursor |
ENSSSCG00000008090 | IL1A | 0.003754 | −3.32519 | Down | Interleukin-1 alpha precursor |
ENSSSCG00000008953 | CXCL8 | 5.59E-11 | −5.63162 | Down | Interleukin-8 precursor |
ENSSSCG00000008959 | CXCL2 | 0.007887 | #NAME? | Down | C-X-C motif chemokine 2 precursor |
ENSSSCG00000008977 | CXCL10 | 2.09E-12 | −2.24248 | Down | C-X-C motif chemokine 10 precursor |
ENSSSCG00000009469 | IRG1 | 8.15E-05 | −2.5073 | Down | Immune-responsive gene 1 protein homolog |
ENSSSCG00000010966 | CCL19 | 1.48E-11 | −5.54945 | Down | C-C motif chemokine 19 precursor |
ENSSSCG00000011318 | CXCR6 | 1.98E-05 | −3.54542 | Down | C-X-C chemokine receptor type 6 |
ENSSSCG00000014441 | CSF1R | 0.007496 | 1.315574 | Up | Macrophage colony-stimulating factor 1 receptor |
ENSSSCG00000016573 | IRF5 | 0.001758 | 1.201847 | Up | Interferon regulatory factor 5-like isoform 1 |
ENSSSCG00000017698 | CCL4 | 1.79E-06 | −2.35038 | Down | C-C motif chemokine 4 precursor |
ENSSSCG00000017700 | CCL3L1 | 1.17E-12 | −2.73058 | Down | C-C motif chemokine 3-like 1 precursor |
ENSSSCG00000017702 | CCL23 | 0.0012 | 1.341277 | Up | C-C motif chemokine 23-like |
ENSSSCG00000017723 | CCL2 | 0.00608 | −4.09919 | Down | C-C motif chemokine 2 precursor |
ENSSSCG00000021847 | SAA4 | 3.61E-71 | −6.49546 | Down | Serum amyloid A-4 protein-like |
ENSSSCG00000022737 | Myd88 | 0.006187 | 6.18454 | Up | Myeloid differentiation primary response protein MyD88-like |
ENSSSCG00000023489 | CXCL9 | 0.005054 | #NAME? | Down | C-X-C motif chemokine 9 precursor |
ENSSSCG00000024270 | CCR2 | 0.001995 | #NAME? | Down | C-C chemokine receptor type 2 |
ENSSSCG00000024311 | CCR2 | 0.000314 | 1.396261 | Up | C-C chemokine receptor type 2 |
ENSSSCG00000024344 | CCR5 | 2.58E-05 | −1.62968 | Down | C-C chemokine receptor type 5 |
ENSSSCG00000024914 | CFB | 1.68E-06 | −4.21557 | Down | Complement factor B precursor |
ENSSSCG00000026832 | CSF1 | 0.000255 | −2.19443 | Down | Macrophage colony-stimulating factor 1 precursor |
ENSSSCG00000028731 | CXCL13 | 5.59E-11 | −6.87266 | Down | C-X-C motif chemokine 13-like |
ENSSSCG00000028875 | HAVCR2 | 1.58E-15 | −3.98527 | Down | Hepatitis A virus cellular receptor 2-like |
ENSSSCG00000029668 | IL2RB | 5.34E-08 | −1.75442 | Down | Interleukin-2 receptor subunit beta-like |
To verify the gene expression data by the RNA-seq, qRT-PCR was performed for six biologically important genesfor immunity, including one gene with lower expression level and five genes with higher expression levels in the Landrace pigs compared to the DPL pigs. qRT-PCR validation was performed using blood samples from all the pigs injected with CpG ODN except DPL1 (i.e., 5 DPL and 6 Landrace pigs injected with CpG ODN). Gene expression fold changes of Landrace/DPL in qRT-PCR analysis and RNA-seq were shown in Figure
DPL | 0.93 ± 0.07 | 1.32 ± 0.36 | 1.19 ± 0.33 | 1.13 ± 0.34 | 1.14 ± 0.23 | 1.23 ± 0.22 |
Landrace | 3.09 ± 0.59 | 0.16 ± 0.02 | 0.33 ± 0.13 | 0.26 ± 0.11 | 0.18 ± 0.05 | 0.42 ± 0.14 |
Because CpG ODN is an agonist for TLR9, we tested TLR9 gene expression in DPL and Landrace PBMCs with or without treatment with CpG ODN at different time points (Figure
Because large number of cytokine/chemokine genes were differentially expressed based on the RNA-seq result, we further studied their gene expression in the PBMCs of DPL and Landrace pigs after CpG ODN stimulation. The expression levels of IFNα and IFNγ genes were significantly higher after 12 h stimulation with CpG ODN in both breeds (25.47-, 10.89-fold); moreover, the gene expression levels of IFNα was significantly higher in the DPL than the Landrace pigs at 12 h (2.64-fold) (Figures
After stimulation with CpG ODN, the expression levels of CXCL9 and CXCL13 genes were significantly higher in the DPL pigs compared to the Landrace pigs at 24 h (15.00-, 10.9-fold; Figures
In this study, the transcriptional differences in the whole blood samples of DPL and Landrace pigs after a TLR9 agonist treatment were studied both
We next studied TLR9 gene expression in the PBMCs of DPL and Landrace pigs treated with CpG ODN
MyD88 is an essential adapter for TLR9 signaling (Takeshita et al.,
Cytokines are cell-signaling proteins, which play crucial roles in haematopoiesis, inflammation and clearance of pathogens (Turner et al.,
Chemokines are a group of small (8–12 kDa) proteins, and characterized by cysteine residues and separated into two groups depending on the presence (C-X-C family) or absence (CC family) of an intervening amino acid between cysteine residues (Turner et al.,
To summarize, our data suggest that DPL pigs exhibited more responsiveness to CpG ODN stimulation than Landrace pigs. Regulating TLR9 mRNA levels in pigs might be a novel way to improve their immune capacity. The TLR9 mRNA levels may be regulated either using pharmacological methods or by guided breeding to select pig breeds with higher TLR9.
YZ, WC, and JH designed this study. JH, DY, and WC took samples and performed the experiments, and analyses. YZ, WC, JH, and HW write and revised this manuscript. JH, DY, and CL modificated the manuscript.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
This study was supported by the National Animal Breed Resource Preservation Project of China (No. 2130135), the National Project for Breeding Transgenic Pigs of China (No. 2013ZX08006-002), Shandong Province Modern Pig Technology and Industry System Project (No. SDAIT-08-02), Shandong Province Agricultural Animal Breeding Project of China (No. 2013LZ02-015, 2014LZ03-016).
The Supplementary Material for this article can be found online at: