TZM-bl and HEK293T cells were cultured in Dulbecco’s modified Eagle’s Medium (DMEM; Invitrogen, Paisley, United Kingdom), supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, United States), 100 U/mL penicillin (HyClone), and 100 μg/mL streptomycin (HyClone) at 37°C with 5% CO₂.

PBMCs were obtained from healthy adult volunteers under an IRB approved protocol. CD4+ cells were purified from PBMCs using CD4+ T cell enrichment kits (StemCell Technologies). CD4+ T cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT, United States), 100 U/mL penicillin (HyClone), and 100 μg/mL streptomycin (HyClone) at 37°C with 5% CO₂.

HIV/eGFP fusion protein expression plasmids were constructed to measure the efficacy of RNA interference. The primers used to amplify the gag, tat, vpu, and env genes are shown in Supplementary Table 1. The gag/tat/vpu/env gene segment was inserted into the peGFP-N1 plasmid to construct HIV/eGFP fusion gene expression plasmids pGag-eGFP, pTat-eGFP, pVpu-eGFP, and pEnv-eGFP.

The RNAi plasmids with shRNA/lhRNA/dlhRNA expression cassettes were designated pGag-shRNA, pTat-shRNA, pVpu-shRNA, pEnv-shRNA, pGag-Tat-lhRNA, pTat-Gag-lhRNA, pGag-Vpu-lhRNA, pVpu-Gag-lhRNA, pEnv-Tat-lhRNA, pTat-Env-lhRNA, pEnv-Vpu-lhRNA, pVpu-Env-lhRNA, pTEVG-dlhRNA, and pVGTE-dlhRNA. The construction method was performed according to the two-step PCR method described by Castanotto et al. (2002) and Saayman et al. (2010). RNAi-Ready pSIREN-RetroQ (Clontech, No. 631526) was used as a template to obtain the human U6 promoter. The primers used for shRNA/lhRNA/dlhRNA construction are listed in Supplementary Table 2.

Lentiviral vector packaging system helper plasmid pMDLg/pRRE contained the gag and pol genes of HIV-1; however, the gag gene was also a target in our research. To prevent self-repression of gag, synonymous mutation plasmid pMDLg/pRRE-M was constructed. Using a site-directed mutagenesis kit (Finnzymes, F-541), the sequence “gaaggagccaccccacaagattt” was mutated into “gaGggCgcTacAccTcaGgaCttt” (mutation sites are marked in capital letters). All of the constructed plasmids were verified by sequencing. Lentiviral expression vector plasmid FG12-VGTE was sub-cloned from pVGTE-dlhRNA.

For HIV virion harvesting, HIV-1 infectious clone plasmid pNL4-3 (GenBank: AF324493.2) was transfected into HEK293T cells using polyethylenimine (PEI) (Polyscience, Cat:23966). The viral supernatant was harvested at 60 h post-transfection, filtered through a 0.45-μm filter, dispensed, and stored at -80°C. The 50% tissue culture infective dose (TCID50) of the virus stock was determined by infecting TZM-bl cells with fourfold serial dilutions of virus (Kong et al., 2008).

An HIV/eGFP fusion protein reporter system was used to test the inhibitory efficacy of the shRNA/lhRNA/dlhRNA expression cassettes (Liang et al., 2012). A decrease in the GFP positive ratio between the RNA expression cassette and scramble-RNA group was taken as evidence of inhibition. The RNAi plasmid (1 μg) and HIV/eGFP fusion gene expression plasmid (1 μg) were co-transfected into HEK293T cells (5 × 10⁵ cells in each well of a 6-well cluster). After 48 h, cells were observed under a microscope, images were collected, and cells were harvested for flow cytometry. Mock-transfected cells were used as a negative control. The DMEM was discarded, after which the cells were digested for 3 min with 500 μL per well of 0.25% trypsin. The reaction was terminated with 500 μL DMEM (10% serum) and the mixture was mixed by pipette. The cell suspensions were pooled in a 1.5 mL tube, after which the cells were pelleted at 850 × g for 5 min. The supernatant was discarded, after which the pellet was suspended in 500 μL phosphate buffer solution (PBS). Cells were pelleted again at 850 × g for 5 min, the supernatant was discarded, and the pellet was fixed in 500 μL 1% paraformaldehyde for 30 min in the dark. Finally, the proportion of green fluorescent cells (GFPs) was checked using a flow cytometer (FACSCalibur^TM, BD).

HEK293T cells (1 × 10⁷ cells in a 15-cm dish) were co-transfected with lentiviral vector plasmid pFG12 or pFG12-VGTE (25 μg) and helper plasmids (6.25 μg pRSV-rev, 12.5 μg pHCMV-G, and 7.5 μg pMDLg/pRRE-M). The plasmids and PEI (Polyscience, 23966) were mixed for 10 min in serum-free DMEM at a ratio of 1:4. The medium was refreshed at 8 h post-transfection. The culture supernatant was harvested 48 h after transfection, filtered through a 0.45-μm filter, and concentrated via ultracentrifugation (Beckman, LE-80K) at 82,000 × g for 1.5 h at 4°C. The supernatant was discarded gently after ultracentrifugation, and 200 μL serum-free DMEM was added to the tube. The pellet was suspended overnight at 4°C. On the next day, the medium containing the lentiviral particles was dispensed into a 25-μL per tube and stored at -80°C for further study. The lentiviral particle titer was determined by infecting TZM-bl cells with serial dilutions of the stock solution. The lentiviral particle titer was generally approximately 10⁸ transducing units (TU)/mL.

To evaluate the siRNA cleavage efficiency of the dlhRNA-encoding cassette, 2 μg of the dlhRNA-encoding plasmid or the corresponding shRNA-encoding plasmid was transfected into HEK293T cells (5 × 10⁵ per well in a 6-well culture plate). Total RNA was extracted from the HEK293T cells at 48 h post-transfection using TRIzol Reagent (Life Technologies, 15596-026) according to the manufacturer’s instructions. RNA pellets were suspended in 30 μL nuclease-free water, after which the RNA concentration was determined. RT- PCR was performed according to Chen’s stem–loop RT-PCR method (Chen et al., 2005). All RT primers are listed in Supplementary Table 3. After cDNA of U6a, Gag-RNAi, Tat-RNAi, Vpu-RNAi, and Env-RNAi was obtained, 1 μL of cDNA was analyzed by qPCR in triplicate using SuperReal PreMix Plus (SYBR Green) (Tiangen, FP204-01). The primers used in these experiments are listed in Supplementary Table 3. Real-time PCR was performed as follows: denaturing for 15 min at 95°C, followed by 40 cycles of 95°C for 10 s, 56°C for 30 s, and 72°C for 30 s. The specificity of the PCR amplification was also verified by melting curve analysis.

To assess activation of the IFN response in cells expressing dlhRNA, interferon beta (IFN-β) mRNA was measured using a sensitive quantitative PCR assay. Total RNA was extracted using TRIzol Reagent (Life Technologies, 15596-026) according to the manufacturer’s instructions from cells expressing dlhRNA. Double-stranded RNA Poly I:C (50 μg/mL, Sigma, St. Louis, MO, United States)-treated cells were used as a positive control group, and non-treated TZM-bl cells were used as a negative control group. PCR was performed with an oligo-dT (18T) primer as described above (Takara, D2639A). After reverse transcription, 1 μL of cDNA was analyzed by qPCR in triplicate using SuperReal PreMix Plus (SYBR Green) (Tiangen, FP204-01). The primers used for qPCR are listed in Supplementary Table 3. The PCR conditions were as follows: 95°C for 15 min followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s. GAPDH mRNA was used as a loading control. The specificity of the PCR products was also verified by melting curve analysis.

To evaluate the long-term inhibitory effect of the VGTE-dlhRNA expression cassette against HIV, HIV-1-susceptible TZM-bl cells were transducted by lentiviral particles FG12-VGTE or FG12. Approximately, 5 × 10⁵ TZM-bl cells were infected by FG12-VGTE or FG12 with a multiplicity of infection (M.O.I.) of 10 for 72 h in a 10-cm dish. Three days post-transduction, cells were sorted via live FACS (BD, FACSAria II), and cells expressing GFP were selected. The selected cells were designated as FG12-VGTE-TZM-bl or FG12-TZM-bl cells. Cells collected by FACS were incubated for 48 h before infection with HIV-1 NL4-3.

Replication of HIV-1 NL4-3 was evaluated in TZM-bl cells by luciferase assay as previously described (Liang et al., 2012). Briefly, TZM-bl cells were seeded in 96-well plates (4 × 10³ cells in each well) and infected with HIV-1 NL4-3 (M.O.I. = 0.01) for 2 h. Cells in the negative control (NC) group were mock-infected. Cells were washed three times with 100 μL PBS per well. FG12-VGTE and FG12 lentiviral particles were added separately with varying M.O.I. (0.01, 0.02, or 0.04). NC group cells and HIV group cells were not treated with lentiviral particles. Additional FG12-VGTE or FG12 lentiviral particles were added every 24 h for a total of four exposures. Cells were harvested for measurement of luciferase activity 16 h after the last treatment. The luciferase assay was performed according to the rapid protocol for the Steady-Glo assay system (Promega, E2520) with a GloMax^®96 Microplate Luminometer (Promega) according to the manufacturer’s instructions. Relative luciferase activity (RLA) was used to reflect HIV-1 replication.

Replication of HIV-1 NL4-3 in CD4+ cells was analyzed by p24 ELISA assay (Perkin Elmer) according to the manufacturer’s instructions. Briefly, 2 × 10⁵ CD4+ cells were activated with PHA (2 μg/mL) before transduction with corresponding lentiviruses (FG12-VGTE or FG12) at M.O.I. of 20. 48 h after activation, cells were infected with NL4-3 at M.O.I. of 0.01. Supernatants from CD4+ T cells were collected and analyzed for HIV replication by p24 ELISA assay.

For the HIV-1 replication kinetics assays using FG12-VGTE-TZM-bl cells or FG12-TZM-bl cells, 2 × 10⁴ cells per well were seeded in a 24-well plate. All cells were infected by HIV-1 with an equivalent M.O.I. of 0.01. After incubation at 37°C overnight, cells were washed three times with PBS, after which 800 μL of fresh DMEM was added. A 400-μL aliquot of each infected culture was sampled on days 0, 2, 4, 6, 8, 10, 12, and 14. The culture medium was replenished with an equal volume of fresh DMEM after each sample was collected. To determine the viral yield at each time point, 50 μL of each culture supernatant was used to infect 2 × 10⁴ TZM-bl cells in a 96-well plate. At 48 h post-infection, luciferase activity and titration assays were performed as described above.

The statistical significance between two different groups of each inhibition efficiency assay was determined by the Student paired t-test. P-values of ≤ 0.05 were considered to be significant.

In order to choose RNAi targets with the potential to alter HIV-1 replication, we consulted previous studies and online HIV-1 resources, including HIV Databases¹ and the siVirus online tool² (McIntyre et al., 2009). Finally, four highly conserved RNAi targets located in two structural genes (gag and env) and two non-structural genes (tat and vpu) were chosen as shown in Figure 1A. Long terminal repeat (LTR) sequences, most of which are highly conserved, were not chosen for our study, because RNAi targets have been identified in the LTR sequence of the FG12 lentiviral vector applied in this study. Four shRNA expression cassettes were designed and constructed according to the target gene sequences. As shown in Figure 1B, flow cytometry assay results showed that each of the four shRNA expression cassettes decreased expression of its corresponding viral gene-eGFP fusion protein (64.3% for Gag-shRNA, 58% for Tat-shRNA, 88% for Vpu-shRNA, and 60.7% for Env-shRNA).

Based on these results, a series of lhRNA and dlhRNA expression cassettes were constructed and assessed with regard to RNAi efficacy following the process shown in Figure 2A. Eight lhRNA-encoding cassettes, each containing a structural gene RNAi target and non-structural gene RNAi target, were selected from the combinations of structural gene RNAi targets and non-structural gene RNAi targets. The inhibitory efficacy of each lhRNA expression cassette was quantified by flow cytometry. As shown in Figure 2B, we chose 40% inhibition efficiency as the selection standard. The inhibitory efficacy of each lhRNA expression cassette against HIV genes is shown in Supplementary Table 4. The Gag-Vpu-lhRNA and Vpu-Gag-lhRNA expression cassettes were chosen because they inhibited Gag-eGFP expression. The Vpu-Gag-lhRNA and Gag-Vpu-lhRNA encoding cassettes were chosen because they inhibited Vpu-eGFP expression. The Tat-Env-lhRNA encoding cassette was chosen because it inhibited Tat-eGFP expression. The Env-Tat-lhRNA and Tat-Env-lhRNA encoding cassettes were chosen because they inhibited Env-eGFP expression. The Vpu-Gag and Tat-Env lhRNA expression cassettes were chosen for the dlhRNA expression cassette because they inhibited each of the target HIV genes. Two dlhRNA expression cassettes, abbreviated TEVG and VGTE (TEVG: Tat-Env lhRNA followed by Vpu-Gag lhRNA; VGTE: Vpu-Gag lhRNA followed by Tat-Env lhRNA), were derived from the combinations of lhRNA expression cassettes chosen previously. As shown in Figure 2C, VGTE inhibited expression of Gag-eGFP (36.5% vs. 18.9%) and Vpu-eGFP (59% vs. 14.3%) more effectively than TEVG, while TEVG inhibited expression of Tat-eGFP (55.4% vs. 37.5%) and Env-eGFP (36.6% vs. 22.5%) more effectively than VGTE. The difference between Gag-eGFP and Vpu-eGFP inhibition by VGTE and TEVG was significant, while the difference between Tat-eGFP and Env-eGFP inhibition by VGTE and TEVG was not significant (p > 0.05). Based on these results, VGTE was chosen as the dlhRNA expression cassette in the following experiments.

Detailed information about the VGTE-dlhRNA expression cassette is shown in Figure 3A, including the nucleotide sequence of the dlhRNA expression cassette, the secondary structure of the double-long hairpin RNA, and the four different siRNAs generated after cleavage. The RNAi efficacy of VGTE-dlhRNA compared with each shRNA is summarized in Figure 3B. The efficacy of VGTE-dlhRNA was not as high as that of each corresponding shRNA (Gag: 36.5% vs. 64.3%, Vpu: 59% vs. 88%, Tat: 37.5% vs. 58%, Env: 22.5% vs. 60.7%). These results suggest that the VGTE-dlhRNA expression cassette was constructed successfully and inhibited HIV-1 gene expression. The difference in inhibitory efficacy may have been due to reduced siRNA generation by the dlhRNA. siRNA generation by VGTE-dlhRNA in HEK293T cells was quantified by qRT-PCR and compared with that of each shRNA. As shown in Figure 3C, vpu/gag/tat/env siRNAs were generated by the VGTE-dlhRNA expression cassette, but the rate of siRNA generation was reduced compared with that of each corresponding shRNA (Vpu: 53%, Gag: 22%, Tat: 20%, Env: 17%; data were normalized by the corresponding shRNA group).

After the VGTE dlhRNA expression cassette was constructed successfully, it was sub-cloned into lentiviral vector FG12 to construct FG12-VGTE. The structure of FG12-VGTE included a VGTE dlhRNA expression cassette and an eGFP expression element, as shown in Figure 4A. FG12-VGTE and the negative control FG12 lentiviral particles were packaged in HEK293T cells and harvested. The transient inhibitory efficacy of FG12-VGTE against HIV-1 replication is shown in Figure 4B. FG12-VGTE at a M.O.I. of 0.01, 0.02, and 0.04 reduced HIV NL4.3 replication by 69.1, 86.9, and 88.6%, respectively, in TZM-bl cells.

To evaluate the inhibitory effect of FG12-VGTE in CD4+ T cells, CD4+ T cells were transduced with FG12-VGTE or FG12 after activation with PHA for 2 days, and then after 2 days the cultures were infected with HIV-1 NL4-3. Culture supernatants harvested on days 0, 5, 10, 15 after HIV infection were tested for released virus levels by p24 ELISA. As shown in Figure 4C, HIV-1 replication showed a peak on day 10 and declined by day 15 in FG12 transducing CD4+ T cells. Compared with the FG-12 group, the replication of HIV was repressed significantly in FG12-VGTE transducing CD4+ T cells.

To obtain HIV-1 susceptible cells that stably expressed VGTE-dlhRNA, TZM-bl cells were transduced by FG12-VGTE and sorted via FACS at 3 days post-transduction as shown in Figure 4D. Highly eGFP-positive cells were collected, and the percentage of GFP-positive cells was greater than 98%. The GFP-positive cells were designated VGTE-TZM-bl cells. Fluorescence images were taken 2 days after sorting. Negative control FG12-TZM-bl cells were obtained similarly by transduction with FG12. The expression levels of four siRNAs were detected by stem–loop RT-PCR. As shown in Figures 4E,F, four siRNAs were detected in the VGTE-TZM-bl cells, but not in the TZM-bl or FG12-TZM-bl cells, as expected. IFN-β was also detected in the VGTE-TZM-bl cells. These results suggest that VGTE dlhRNA expression did not induce a detectable IFN response.

After obtaining VGTE-TZM-bl cells with stable VGTE dlhRNA expression, we challenged these cells with HIV-1 NL4-3. TZM-bl and FG12-TZM-bl cells were also challenged as control groups. As shown in Figure 5A, the replication kinetics of NL4-3 in TZM-bl and FG12-TZM-bl cells were not significantly different. In VGTE-TZM-bl cells, NL4-3 replication was inhibited completely for the first 8 days, after which the replication rate increased. In comparison with the TZM-bl and FG12-TZM-bl groups, the HIV replication rate of the VGTE-TZM-bl cells was decreased by two orders of magnitude 14 days post-infection. In order to assess virus survival in VGTE-TZM-bl cells, viruses were collected from the culture supernatants 14 days post-infection and used to re-infect VGTE-TZM-bl cells. As shown in Figure 5B, HIV replication in VGTE-TZM-bl cells was only inhibited completely for the first 2 days, after which replication recovered quickly. In contrast to the previous challenge, the viral replication rate in the VGTE-TZM-bl cells was nearly equal to that of the two control groups. These results suggest that long-term combinatorial RNAi with VGTE dlhRNA did not inhibit replication of HIV-1 because mutant versions of target mRNAs emerged under the combinatorial RNAi condition. To assess this possibility, proviral DNA was isolated from VGTE-TZM-bl cells and sequenced. As shown in Figure 5C, nucleotide mutant versions of Vpu, Gag and Env were found, but no mutation in Tat was identified.