Edited by: Aldo Corsetti, Università degli Studi di Teramo, Italy
Reviewed by: Bettina Buttaro, Temple University, United States; Lorena Ruiz, Instituto de Productos Lácteos de Asturias (IPLA), Spain; Manuel A. Ortega, Massachusetts Institute of Technology, United States
This article was submitted to Food Microbiology, a section of the journal Frontiers in Microbiology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
The gene cluster responsible for the production of the aureocin A53-like bacteriocin, lactolisterin BU, is located on plasmid pBU6 in
Ribosomal synthesis of antimicrobial peptides or peptide complexes, known as bacteriocins, presents a successful strategy for the reduction of microbial competitors to obtain more nutrients and living space in the environment (
Bacteriocins differ in molecular mass, structure, biochemical and genetic characteristics, modes of action and target cell receptors. Based on these criteria, bacteriocins from LAB are generally classified into two main classes: Class I bacteriocins (lantibiotics) contain unusual amino acids such as lanthionine and dehydrated amino acids as a result of post-translational modifications and Class II bacteriocins consisting of unmodified or peptides with minor modifications. Furthermore, Class II bacteriocins are subdivided into four subclasses: pediocin-like bacteriocins (class IIa), two-peptide bacteriocins (class IIb), cyclic bacteriocins (IIc), and linear non-pediocin-like bacteriocins (class IId) (
Bacteriocin genetic systems can be located on chromosomes, plasmids or conjugative transposons (
In this study, we investigated the function of the hypothetical genes within the lactolisterin BU gene cluster of
The strains, their derivatives and plasmids used in this study are listed in Table
Bacterial strains and plasmids used in this study.
Strains, plasmids, and derivatives | Relevant characteristics | Source |
---|---|---|
BGBU1-4 | Bacteriocin (lactolisterin BU) producer | |
BGMN1-596 | Plasmid free derivative of |
|
MG7284 | Prt−, Lac−, Bacr, Fusr, Spcr | |
DH5α | ||
EC101 | JM101 containing |
|
pBU6 | 6.2 kb, natural plasmid carrying lactolisterin BU gene cluster from strain BGBU1-4 | |
pBluescriptT/A | 2994 bp, Ampr, PCR cloning vector | |
pAZIL | 7,109 bp, Emr, shuttle cloning vector | |
pNZ8150 | Cmr, NICE expression vector | |
pNZ8150-lacZ1 | pNZ8150 carrying |
|
pAZIL-SP | This work | |
pAZIL-SB | This work | |
pAZIL-SS | This work | |
pAZIL-pBU6P-1 | pBU6 digested with |
This work |
pAZIL-pBU6P-5 | pBU6 digested with |
This work |
pAZIL-pBU6B-2 | pBU6 digested with |
This work |
pAZIL-pBU6B-4 | pBU6 digested with |
This work |
pBluescriptT/A-PlliBU | PCR-amplified fragment carrying P |
This work |
pNZ8150-h1 | This work | |
pNZ8150-h2 | This work | |
pNZ8150-h1+h2 | This work | |
pNZ8150-h3 | This work | |
pNZ8150-h3+mobC+relM+rnaY | This work | |
pAZIL-EEB | pAZIL-SB partially digested with |
This work |
pNZ8150-EEB | This work | |
pAZIL-S-h1 | PCR-amplified fragment carrying P |
This work |
pAZIL-S-h1+h2-TT2 | PCR-amplified fragment carrying P |
This work |
pAZIL-S-h1+h2+1/2TT2 | PCR-amplified fragment carrying P |
This work |
pAZIL-S-h1+h2+TT2 | PCR-amplified fragment carrying P |
This work |
pNZ8150-PlliBU-lacZ1 | P |
This work |
pNZ8150-PlcnB-lacZ1 | P |
This work |
MG7284/pBU6 | MG7284 transformed with plasmid pBU6 (producer of lactolisterin BU) | |
MG7284/pAZIL-SP | MG7284 transformed with pAZIL-SP | This work |
MG7284/pAZIL-SB | MG7284 transformed with pAZIL-SB | This work |
MG7284/pAZIL-SS | MG7284 transformed with pAZIL-SS | This work |
MG7284/pAZIL-pBU6P-1 | MG7284 transformed with pAZIL-pBU6P-1 | This work |
MG7284/pAZIL-pBU6P-5 | MG7284 transformed with pAZIL-pBU6P-5 | This work |
MG7284/pAZIL-pBU6B-2 | MG7284 transformed with pAZIL-pBU6B-2 | This work |
MG7284/pAZIL-pBU6B-4 | MG7284 transformed with pAZIL-pBU6B-4 | This work |
MG7284/pNZ8150-h1 | MG7284 transformed with pNZ8150-h1 | This work |
MG7284/pAZIL-SS+pNZ8150-h1 | MG7284/pAZIL-SS transformed with pNZ8150-h1 | This work |
MG7284/pNZ8150-h2 | MG7284 transformed with pNZ8150-h2 | This work |
MG7284/pAZIL-SS+pNZ8150-h2 | MG7284/pAZIL-SS transformed with pNZ8150-h2 | This work |
MG7284/pNZ8150-h1+h2 | MG7284 transformed with pNZ8150-h1+h2 | This work |
MG7284/pAZIL-SS+pNZ8150-h1+h2 | MG7284/pAZIL-SS transformed with pNZ8150-h1+h2 | This work |
MG7284/pNZ8150-h3 | MG7284 transformed with pNZ8150-h3 | This work |
MG7284/pAZIL-SS+pNZ8150-h3 | MG7284/pAZIL-SS transformed with pNZ8150-h3 | This work |
MG7284/pAZIL-SB+pNZ8150-h3 | MG7284/pAZIL-SB transformed with pNZ8150-h3 | This work |
MG7284/pAZIL-SP+pNZ8150-h3 | MG7284/pAZIL-SP transformed with pNZ8150-h3 | This work |
MG7284/pNZ8150-h3+mobC+relM+rnaY | MG7284 transformed with pNZ8150-h3+mobC+relM+rnaY | This work |
MG7284/pAZIL-SS+pNZ8150-h3+mobC+relM+rnaY | MG7284/pAZIL-SS transformed with pNZ8150-h3+mobC+relM+rnaY | This work |
MG7284/pAZIL-SB+pNZ8150-h3+mobC+relM+rnaY | MG7284/pAZIL-SB transformed with pNZ8150-h3+mobC+relM+rnaY | This work |
MG7284/pNZ8150-EEB | MG7284 transformed with pNZ8150-EEB | This work |
MG7284/pAZIL-SS+ pNZ8150-EEB | MG7284/pAZIL-SS transformed with pNZ8150-EEB | This work |
MG7284/pAZIL-S-h1+h2-TT2 | MG7284 transformed with pAZIL-S-h1+h2-TT2 | This work |
MG7284/pAZIL-S-h1+h2+1/2TT2 | MG7284 transformed with pAZIL-S-h1+h2+1/2TT2 | This work |
MG7284/pAZIL-S-h1+h2+TT2 | MG7284 transformed with pAZIL-S-h1+h2+TT2 | This work |
MG7284/pNZ8150-lacZ1 | MG7284 transformed with pNZ8150-lacZ1 | |
MG7284/pNZ8150-PlliBU-lacZ1 | MG7284 transformed with pNZ8150-PlliBU-lacZ1 | This work |
MG7284/pNZ8150-PlcnB-lacZ1 | MG7284 transformed with pNZ8150-PlcnB-lacZ1 | This work |
All strains carrying constructs were stored in growth medium containing 15% glycerol (Sigma Chemie GmbH, Deisenhofen, Germany) at −80°C.
For plasmid isolation from
PlatinumTM
Primers used in this study.
Primer name | Sequence (5′ to 3′) | Product size (bp) | Temperature of annealing | Reference |
---|---|---|---|---|
PBU1-4-Fw | GGACTAAAAACAAGTAAC | 136 | 42°C | This work |
PBU1-4-Rev | CATATGTAAGAGTACCTCC | |||
lliBU-Fw | ATGTGGGGTAGAATTCTTGG | 134 | 51°C | This work |
lliBU-Rev | CATTCCAAGCTTATATTTTAACCCC | |||
lliBU-Fw | ATGTGGGGTAGAATTCTTGG | 830 | 48°C | This work |
abcT-Rev | CAAATAATTCACGCTCC | |||
lliBU-Fw | ATGTGGGGTAGAATTCTTGG | 1,486 | 44°C | This work |
hyp1-Rev | GAGTATCTACTTTTCAAG | |||
lliBU-Fw | ATGTGGGGTAGAATTCTTGG | 2,004 | 54°C | This work |
middle_the_loop_hyp2-Rev | TGGCGGAAATATGTCCC | |||
abcT-Fw | CACAATTACCCAGAATTC | 663 | 44°C | This work |
abcT-Rev | CAAATAATTCACGCTCC | |||
abcT-Fw | CACAATTACCCAGAATTC | 1,319 | 44°C | This work |
hyp1-Rev | GAGTATCTACTTTTCAAG | |||
abcT-Fw | CACAATTACCCAGAATTC | 1,837 | 48°C | This work |
middle_the_loop_hyp2-Rev | TGGCGGAAATATGTCCC | |||
hyp1PstI-Fw | 677 | 53°C | This work | |
hyp1XbaI-Rev | ||||
hyp2PstI-Fw | 570 | 55°C | This work | |
hyp2XbaI-Rev | ||||
hyp3BglII-Fw | 615 | 48°C | This work | |
hyp3-Rev | GTAAGAATCCTCCTCTCG | |||
hyp3BglII-Fw | 2,585 | 48°C | This work | |
ribonucleaseY-Rev | GGCTCACTCAGTTCGGTCAGGG | |||
SacI_before_prom-Fw | GAGTGGTTAG |
1,860 | 41°C | This work |
hyp1-Rev | GAGTATCTACTTTTCAAG | |||
SacI_before_prom-Fw | GAGTGGTTAG |
2,366 | 44°C | This work |
before_the_loop- hyp2-Rev | GTCCCAATTAATACTAGC | |||
SacI_before_prom-Fw | GAGTGGTTAG |
2,378 | 51°C | This work |
middle_the_loop_hyp2-Rev | TGGCGGAAATATGTCCC | |||
SacI_before_prom-Fw | GAGTGGTTAG |
2,434 | 52°C | This work |
after_the_loop- hyp2-Rev | CGCTTCCCCGAACCCCCG | |||
LcnB-Fw | AGTTATTAACATTTGTTAACG | 77 | 38°C | This work |
LcnB-Rev | CATAATAATCTCCTTATTTTTATAAATC |
The
The lactolisterin BU promoter, P
Schematic representation of the construction of appropriate constructs.
The construct pAZIL-SB was partially digested with
A section of the operon from the
For analysis of the P
Cloned fragments of all relevant constructs were sequenced by Macrogen Sequencing Service (Macrogen Europe, Amsterdam, Netherlands). The DNA Strider 1.4f7 program was used for sequence analysis and ORF prediction.
Standard heat-shock transformation was used for plasmid transformation of
For clonal confirmation, pulse-field gel electrophoresis (PFGE) was performed, as described previously by
For detection of bacteriocin activity, an agar-well diffusion assay was performed as described previously by
Antimicrobial activity of cytoplasmic fraction was tested in the following way: cells from 50 ml of overnight cultures of bacteriocin producers (BGBU1-4 and MG7284/pAZIL-SB), MG7284/pAZIL-SS and MG7284/pAZIL as negative control were harvested by centrifugation (10 min 5,000 ×
The bacteriocin activity assay was performed at least in two independent repetitions.
β-Galactosidase activity was determined essentially as described by
Total mRNA was isolated from
Lactolisterin BU production is plasmid encoded. In a previous study, it was reported that
Since lactolisterin BU showed the highest identity with bacteriocins belonging to aureocin A53-like group (
Comparative analysis of aureocin A53-like clusters.
Downstream of the lactolisterin BU (
TMpred program prediction
In the lactolisterin BU cluster, two genes were predicted to encode possible transporter/enzymes involved in sugar catabolism, indicating that the lactolisterin BU peptide determinant was somehow introduced upstream of a sugar-related cluster and uses these proteins for its own transport.
The absence or existence of small intergenic regions between the genes of lactolisterin BU operon indicated the synthesis of a single polycistronic RNA (the intergenic region between the
Analysis to detect the presence of transcriptional terminators (TT) using
Upstream of the
Position and sequence of RBS upstream of genes in lactolisterin BU operon.
Gene | Distance from ATG | Sequence | Consensus |
---|---|---|---|
11 | TGGAGG | AGGAGG | |
6 | AGGAGAG | ||
8 | TGGAGCG | ||
8 | ACGAAGG |
In order to test if all genes (
Transcriptional analysis of the lactolisterin BU operon. Amplicons obtained after RT-PCR using
Considering that production of lactolisterin BU in the strain
Lactolisterin BU is encoded by a gene cluster located on the smallest plasmid in strain BGBU1-4, pBU6 of 6.2 kb (Figure
Antimicrobial activity of constructed derivatives on
In order to determine the role of the
A construct containing the
To determine if the
Sensitivity of all analyzed derivatives to different concentrations of purified lactolisterin BU in spot on the lawn bacteriocin assay.
Name of derivative | Concentration of purified lactolisterin BU (μg/ml) |
|||||
---|---|---|---|---|---|---|
125 | 62.5 | 31.2 | 15.6 | 7.8 | 3.9 | |
BGBU1-4 | + | + | + | − | − | − |
BGMN1-596 | + | + | + | + | − | − |
MG7284 | + | + | + | + | − | − |
MG7284/pBU6 | + | + | + | − | − | − |
MG7284/pAZIL-SP | + | + | +/− | − | − | − |
MG7284/pAZIL-SB | + | + | +/− | − | − | − |
MG7284/pAZIL-SS | + | + | + | + | +/− | − |
MG7284/pAZIL-pBU6P-1 | + | + | + | − | − | − |
MG7284/pAZIL-pBU6P-5 | + | + | + | − | − | − |
MG7284/pAZIL-pBU6B-2 | + | + | + | − | − | − |
MG7284/pAZIL-pBU6B-4 | + | + | + | − | − | − |
MG7284/pNZ8150-h1 | + | + | + | + | − | − |
MG7284/pAZIL-SS+pNZ8150-h1 | + | + | + | + | − | − |
MG7284/pNZ8150-h2 | + | + | + | + | − | − |
MG7284/pAZIL-SS+pNZ8150-h2 | + | + | + | + | − | − |
MG7284/pNZ8150-h1+h2 | + | + | + | + | − | − |
MG7284/pAZIL-SS+pNZ8150-h1+h2 | + | + | + | + | − | − |
MG7284/pAZIL-SB+pNZ8150-h3 | + | + | +/− | − | − | − |
MG7284/pAZIL-SB+pNZ8150-h3+mobC+relM+rnaY | + | + | +/− | − | − | − |
MG7284/pNZ8150-EEB | + | + | + | + | − | − |
MG7284/pAZIL-SS+pNZ8150-EEB | + | + | + | + | − | − |
MG7284/pAZIL-S-h1+h2-TT2 | + | + | +/− | − | − | − |
MG7284/pAZIL-S-h1+h2+1/2TT2 | + | + | +/− | − | − | − |
MG7284/pAZIL-S-h1+h2+TT2 | + | + | +/− | − | − | − |
Sensitivity of representative strains and derivatives to different concentrations of purified lactolisterin BU in spot on the lawn bacteriocin assay.
It has been documented that transcription terminators can be involved in regulation of gene expression by transcriptional attenuation or impacting on the stability of mRNA originating from bacteriocin operons (
The possible involvement of the
Subcloning experiments with the pBU6 plasmid showed that the lactolisterin BU gene cluster consists of four genes (
The results of this study highlight that sophisticated mechanisms of regulation were involved in expression of genes within the lactolisterin BU cluster, which require further study. Elucidation of regulatory mechanisms involved in the expression of lactolisterin BU could help in making constructs for the overexpression of bacteriocins and/or other proteins of interest.
The lactolisterin BU cluster consists of four genes (
MaM and MK conceived, designed, and coordinated this study, interpreted all of results and contributed to the preparation of the figures, and wrote this paper. JL, NM, MiM, and BJ provided experimental assistance and contributed to the preparation of the figures and manuscript. PO performed experiments of bacteriocin purification. PO and PC provided technical assistance and contributed to the preparation of this paper. All authors reviewed the results and approved the final version of the manuscript.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.