iSLK, iSLK.219, and iSLK.BAC16 cells (Brulois et al., 2012) were cultured in DMEM with 10% FBS and selection antibiotics as described previously (Myoung and Ganem, 2011b). CH12F3-2 cells were cultured in RPMI 1640 medium supplemented with 10% FBS, 0.05% β-mercaptoethanol, and 5% NCTC 109 (Sigma-Aldrich).

iSLK.219 cells were reactivated with 1 mM sodium butyrate and 1 μg/mL doxycycline without antibiotics at 60% confluence. The supernatant was collected after 4 days, centrifuged at 4000 rpm for 10 min, and filtered through a 0.45 μM PES membrane. This supernatant was spun at 27,000 × g for 90 min at 4°C. After ultracentrifugation, the viral pellet was resuspended in 1X PBS and stored in the -80°C for future use.

Purified rKSHV.219 was UV-irradiated with 150,000 J/cm² of energy for two rounds. UV-inactivation was verified by spinoculating AD293 cells at 700 rpm for 60 min at 37°C with 8 μg/ul polybrene, and infection media was replaced with complete DMEM. At 48 h post-infection, FACS (LSRII) analysis ensured no GFP-positive cells. rKSHV.219 and UV-rKSHV.219 from the same viral stock were used within the same experiment.

All infections were done in the presence of 5 μg/mL protamine sulfate. For CH12F3-2 infection via co-culture with iSLK.219 cells, 25 × 10⁴ iSLK.219 cells were reactivated for 24 h with 1 μg/mL doxycycline. After 24 h, co-culture was started by introducing 1:1 ratio of CH12F3-2 cells to the iSLK cells. After 24 h, αCD40, IL-4, and TGFβ (+CIT), were added to stimulate switching in CH12F3-2 cells and left for 48 h more before evaluating infection. For CH12F3-2 cells infected directly with purified rKSHV.219, 25 × 10⁴ CH12F3-2 cells were cultured with an MOI = 5 in 12 × 75 mm FACS tubes in 400 μL of serum-free RPMI at 37°C for at least 5 h. A final concentration of 10% FBS was added to the tubes and left overnight at 37°C in 1mL final volume. After 24 h, fresh CH12F3-2 media was added to the cells and they were transferred to a 6-well plate. Cells were maintained in inoculum until harvested. For primary naïve splenocytes infected with purified rKSHV.219, 1 × 10⁶ cells were cultured with an MOI of 1 or 5 in 12 × 75 mm FACS tubes in 400 μL of serum-free RPMI at 37°C for at least 5 h, or spun at 300 g for 30 min at 4°C and left at 37°C for 1 h. A final concentration of 10% FBS was added to the tubes, cells were transferred to a 6-well plate and LPS was added, and the culture was left overnight at 37°C in 2 mL final volume. The next day IL-4 was added to stimulate switching, fresh media was added as needed, and splenocytes were maintained in inoculum until used for experiments.

Mice were housed under pathogen-free conditions. Animal studies were performed according to protocols approved by the Institutional Animal Care and Use Committee at the University of Miami. Splenocytes were removed from 8 to 10-week-old c57BL6/J male mice obtained from the Jackson Laboratory.

Mouse B cells were purified from freshly isolated splenocytes using anti-CD43 magnetic beads MACS CD43 depletion (Miltenyi Biotech) according to manufacturer’s protocol. Cells were stained with CFSE (Invitrogen) or eFlour670 (Thermo Fisher Scientific) and 5 × 10⁵ cells/mL were activated with 5 μg/mL LPS (Sigma) and 20 ng/mL murine IL-4 (Peprotech) (IgG1 switching), or 1 ng/mL TGF-β1 (IgG2b switching). Isotype switching was analyzed by FACS after staining cells with anti–IgG1 or IgG2b-biotin (BD Pharmingen), followed by PE-conjugated anti-biotin antibody. Splenocytes were cultured with or without purified rKSHV.219 (MOI = 1–5) with 5 μg/mL protamine sulfate and activated with the aforementioned cytokines. For CH12F3-2 experiments, cells were also preincubated with CFSE or eFluor 670 and 25 × 10⁴ cells/mL were activated with 1 ng/mL TGF-β1 (R&D Systems), 10 ng/mL recombinant murine IL-4 (PeproTech), and 1 μg/mL purified anti–mouse CD40 (BD Biosciences). Cells were stained with anti-IgA (SouthernBiotech) and analyzed by FACS with Accuri C6 Flow Cytometer (BD Biosciences).

293TX cells were transfected at 70% confluence with pCMV delta 8.2, pCMV VSV-G, and the pSin, vFLIP, vGPCR, or vIL-6 plasmids from the Boshoff lentiviral library using Polyplus transfection reagent. Next day, the transfection media was replaced with fresh plating media and supernatant with virus was collected 48 h later. Virus was concentrated from the supernatant using LentiX concentrator (Clontech) according to the manufacturer’s protocol and resuspended in 1X PBS. Cells were infected adding 5 μg/ml of protamine sulfate to the culture media. Class-switching was induced in CH12F3-2 or mouse splenic B cells 24–48 h post-infection.

To remove cell bound virus, all samples cultured with KSHV were washed 1X with PBS, trypsinized for 5 min at 37°C, and washed 2X in 1X PBS. RNA was harvested using RNeasy Kit (Qiagen) or Trizol with glycogen as a carrier as per the manufacturer’s instructions (Thermo Fisher Scientific). 500–1000 ng of RNA was used to make cDNA (Promega Improm-II). RT-qPCR was performed using an ABI Prism 7000 Sequence Detection System (Applied Biosystems) with SybrGreen PCR Master Mix (Quanta Biosciences). Analysis of qRT-PCR results was adapted from (Totonchy et al., 2018). As described above, total RNA was extracted from CH12F3-2 or primary splenic B cells that were mock infected or infected with rKSHV.219 (KSHV) and mRNA transcript expression for viral genes and rKSHV.219 infection markers (GFP, RFP) was validated using qRT-PCR for a 40-cycle reaction. To control for DNA contamination, there was no addition of Reverse Transcriptase (noRT) to at least 2 KSHV-infected cultures (biological replicates). Technical duplicates of the noRT Cq values (from all biological replicates) were used to calculate the mean noRT Cq value. Non-amplifying samples were set to Cq = 40 (not detected) for calculation purposes as all detected values were less than 40. The lowest Cq value from either the mean noRT control or mock-infected samples was selected to set the threshold for the limit of detection for each target gene. On the Y-axis of each graph, the Cq values are reversed where values ≥ 40 represent Cqs at or below the level of detection. The lower the Cq on the Y-axis (for example Cq = 27), the higher the gene expression in a sample for a target gene. Grey shading indicates values of the mock (black) or KSHV-infected (red) samples that fall at or below the threshold for the limit of detection. Green shading indicates values that are between 2.4 and 3.3 cycles less than the limit of detection (correlating to ∼5-10-fold increase in gene expression above the threshold detection limit). Red shading indicates values that are ≥3.3 cycles less than the limit of detection (correlating to ∼10-fold or greater increase in gene expression above the detection limit threshold). The cycle difference (ΔCq) is determined using the equation: (Cq for threshold of detection for target) – (Cq of KSHV-infected sample for target). The cycle difference (ΔCq) is converted to fold-change using the equation: 2ˆ(ΔCq). The mean and standard deviation of all samples for both the mock and KSHV groups are displayed on the graph. The following primer sets were used: AID, FW- GCCACCTTCGCAACAAGTCT, RV-CCGGGCACAGTCATAGCAC; Sμ, FW-TAGTAAGCGA GGCTCTAAAAAGCAC, RV-ACTCAGAGAAGCCCACCCAT; GAPDH, FW-TGAAGCAGGCATCTGAGGG, RV-CGAAGG TGGAAGAGTGGGAG. LANA, FW -CCTGGAAGTCCCAC AGTGTT, RV-AGACACAGGATGGGATGGAG, VIL-6, FW-, TGCTGGTTCAAGTTGTGGTC, RV-ATGCCGGTACGGTAA CAGAG, K8.1, FW-CACCACAGAACTGACCGATG, RV-TGGCACACGGTTACTAGCAC, GFP, FW-ACGTAAACGGC CACAAGTTC, RV- AAGTCGTGCTGCTTCATGTG, RFP, FW-AGGAGGGCTGCTTCATCTAC, RV-TGGTCTTCTTTGCA TCACG.

Cells were washed with 1X PBS and resuspended in RIPA buffer with Halt protease inhibitor cocktail (Thermo Scientific). Lysates were centrifuged at 10,000 g for 10 min at 4°C, resuspended in Laemmli buffer (Bio-Rad) and β-mercaptoethanol, and boiled for 5 min. Protein was quantified using the BCA protein assay (Thermo Scientific Pierce) and 35 μg was run on SDS-PAGE gels (Bio-Rad) in 1X Tris-glycine-SDS buffer (Bio-Rad) at 120 V, and transferred using 1X Tris-glycine onto a.2 μM PVDF membrane for 1 h at 100 V. Membranes were blocked in 5% BSA (phospho antibodies) or 5% non-fat milk (other antibodies) with TBS-T. Membranes were incubated with primary antibody (pSTAT3, STAT3, pSTAT, STAT1, pSTAT6, STAT6 (Cell Signaling Technology, 1:1000), AID (Active Motif, 1:500), Actin (Sigma, 1:10,000)) and in secondary antibody (Anti-rabbit, anti-mouse, goat-anti-rat; 1:10,000) and developed with Super Signal West Pico ECL western blotting substrate (Pierce) per the manufacturer’s instructions. Membranes were stripped with Restore PLUS Stripping Buffer (Thermo Fisher Scientific) per manufacturer’s instructions. Images were quantified by densitometry with Image Studio Lite software (Li-cor).

P-values are from a two-tailed Student’s t-test, unless stated otherwise. Bars represent the standard deviation (SD) obtained from 3 independent samples. Experiments were performed at least 2–3 times.

It has been previously shown that KSHV infection upregulates AID expression in human tonsillar B cells (Bekerman et al., 2013). As AID induces CSR, we investigated the functional consequence of KSHV infection on CSR. We initiated our studies using CH12F3-2 cells, a unique mouse lymphoma system that undergoes class-switching from IgM to IgA in the presence of αCD40, IL-4, and TGFβ (CIT) (Nakamura et al., 1996; Cortizas et al., 2013). Although it is a murine model, it is currently the only reliable system to study the mechanisms of CSR in vitro (Stavnezer and Schrader, 2014). Recent studies demonstrated increased KSHV infection of B cells based on a mechanism of cell-contact by co-culturing them with lytically reactivated iSLK.219 cells (Myoung and Ganem, 2011c; Bekerman et al., 2013). In this system, iSLK.219 cells are infected with a recombinant KSHV construct, rKSHV.219, which expresses GFP under the elongation factor-1 (EF-1) promoter upon latency establishment, and expresses RFP under the polyadenylated nuclear (PAN) promoter when the virus is reactivated with doxycycline (Myoung and Ganem, 2011b). Hence, to establish infection efficiency of CH12F3-2 cells by KSHV, iSLK (KSHV-negative) or iSLK.219 (KSHV-positive) cells were reactivated for 24 h with doxycycline before the addition of CH12F3-2 cells. Five days post co-culture, CH12F3-2 cells were stained with anti-B220 (a B cell marker), to distinguish GFP or RFP-positive CH12F3-2 from iSLK.219 cells, and assessed for endogenous GFP and RFP expression using fluorescence-activated cell sorting (FACS). After 5 days of co-culture, approximately 4% of the CH12F3-2 cells expressed GFP or RFP (+KSHV, Figure 1A). To document and characterize the infection by KSHV of CH12F3 cells, we directly infected the CH12F3-2 cells with purified rKSHV.219. We validated expression of two KSHV lytic viral genes, vIL-6 and K8.1, in CH12F3-2 cells by qRT-PCR. The transcript level of both genes was greater than 10-fold the limit of detection (Figure 1B). The gene expression of rKSHV.219 infection markers, GFP and RFP, also showed more than a 10-fold difference over the limit of detection (Figure 1B), corroborating with the FACS data (Figure 1A), and further providing evidence of infection. While we observed GFP expression via FACS and qRT-PCR, LANA expression was negligible (data not shown), indicating a lytic infection. These data support evidence that KSHV produced from lytically reactivated iSLK.219 cells and purified rKSHV.219 results in infection of CH12F3-2 cells.

Next, we determined whether KSHV infection affected CSR in CH12F3-2 cells. For this objective, iSLK (-KSHV) and iSLK.219 (+KSHV) cells were reactivated for 24 h with doxycycline before introducing CH12F3-2 (CH12) cells to the culture (Figure 1C). After 24 h of co-culture, cytokines (CIT) were added, and 48 h later surface IgA expression was assessed via FACS (Figure 1C). CH12F3-2 cells were stained with both IgM and IgA to ensure that only CH12F3-2 cells were analyzed. As observed in Figure 1D, levels of class-switching were significantly elevated in CH12F3-2 cells co-cultured with reactivated cells (+KSHV, 24.8%) compared to CH12F3-2 cells that were cultured alone (CH12, 16.8%), or with uninfected cells (-KSHV, 15.7%) (Figure 1D). Furthermore, we consistently observed that the increase in CSR efficiency was always greater than the efficiency of KSHV-infected cells. Thus, a small population of cells infected with KSHV is mediating the increase in CSR in both the uninfected (GFP^-, RFP^-) and infected (GFP⁺, RFP⁺) cell population, suggesting that the effect of KSHV on CSR could have a paracrine component (Figure 1E). These data show that KSHV-infection enhances CSR in CH12F3-2 cells.

We chose to continue investigating the effect of KSHV on CSR using primary mouse splenic B cells because the parameters of class-switching are well-defined and established within this in vitro model in contrast to human cells (Stavnezer and Schrader, 2014). Initially, to determine the infection efficiency of KSHV in splenocytes, resting B cells were purified, cultured with rKSHV.219 (KSHV) and LPS, and endogenous GFP and RFP expression was assessed using FACS. After 48 h of infection, approximately 10% of the splenocyte population was GFP-positive and 8.5% was RFP-positive (Figure 2A). Like the CH12F3-2 cells (Figure 1A), KSHV-cultured splenocytes expressed both GFP and RFP, although a greater percentage of the splenocyte population showed fluorescent expression (Figure 2A) compared to the CH12F3-2 cells (Figure 1A). As this indicated that splenocytes could be infected with KSHV, resting B cells were purified, concomitantly cultured with LPS and rKSHV.219 (KSHV) or UV-irradiated KSHV (UV-KSHV), and after 24 h, stimulated with IL-4 (for switching to IgG1) or TGFβ-1 (for switching to IgG2b). We chose IL-4 and TGFβ because of the effect on CSR efficiency that we observed during KSHV infection in the CH12F3-2 system following stimulation with those cytokines (Figure 1D). After 4 days of cytokine exposure, surface IgG1 and IgG2b expression was assessed via FACS (Figures 2B,C). LPS/IL-4-activated splenic B cells cultured with KSHV exhibited a ∼70% increase in class-switching to IgG1 compared to B cells cultured without virus or with UV-KSHV (Figure 2B), indicating that replication-competent virus, not antigen exposure, enhanced CSR. In general, the efficiency of CSR to IgG1 increased more than 50% when exposed to KSHV. In contrast, B cells cultured with KSHV and stimulated with LPS/TGFβ exhibited no difference in the efficiency of class-switching to IgG2b when compared to control cells (Figure 2C). Noteworthy, KSHV always required the addition of cytokines to enhance class-switching efficiency in B cells. Splenic B cells or CH12F3-2 cells cultured with KSHV alone did not undergo switching. Splenocytes cultured with LPS and KSHV did not show enhanced CSR to IgG3 compared to splenocytes cultured with LPS alone (data not shown). KSHV-infection only enhanced the efficiency of CSR in splenocytes cultured with LPS/IL-4 (Figure 2B) and in CH12F3-2 cells cultured with CIT (Figure 1D). This shows that KSHV can enhance, but not promote CSR. These data indicate that KSHV enhances the efficiency of CSR to some isotypes in the presence of certain cytokines, and that viral infection mediates this effect.

Class-switching can be affected by differences in AID expression, germline transcription, or cell proliferation. To further determine the mechanism whereby KSHV enhanced CSR efficiency in B cells, we evaluated AID and germline transcript mRNA levels (Figures 2D,E), and cell proliferation (via CFSE staining, Figure 2F). Control or KSHV-cultured splenocytes stimulated for class-switching to IgG1 with LPS and IL-4 exhibited no substantial difference in Sμ germline mRNA levels (Figure 2E) or cell proliferation (Figure 2F). However, we observed significantly higher levels of AID mRNA transcripts in B cells exposed to KSHV (Figure 2D). This coincided with a trend toward decreased microhomology use for the DNA end-joining step in host IgH Sμ-Sγ1 regions, and increased transition mutations (Supplementary Figure 1). These data suggest that the observed increase in CSR to IgG1 in KSHV-infected B cell cultures may be due to upregulation of AID.

In seeking for a viral-mediated mechanism for the enhanced CSR, we first assessed viral gene expression within the population of KSHV-infected LPS/IL-4 stimulated splenic B cells via qRT-PCR. We observed expression of the latent, LANA, and lytic, vIL-6 and K8.1, viral genes. LANA transcripts were more than 5-fold (except for one mouse), while vIL-6 and K8.1 levels were greater than 10-fold the limit of detection (Figure 3A). The mRNA transcripts of rKSHV.219 infection marker, GFP, was 3-to5-fold, and RFP, was higher than 10-fold the detection limit (Figure 3A), supporting the FACS data (Figure 2A). This indicates that there are both latently and lytically infected cells within the splenocyte population. These data substantiate that primary splenic B cells stimulated for switching to IgG1 can be infected with KSHV.

Due to evidence of KSHV gene expression within KSHV-infected cultures of CH12F3-2 cells (Figure 1B) and primary splenocytes (Figure 3A), we hypothesized that particular viral genes could be influencing class-switching. To elucidate the viral mechanism mediating increased CSR, we evaluated the ability of individual KSHV genes to modulate CSR efficiency. Class-switching is prompted by a combination of cytokines and T cell-dependent or T cell-independent signals which trigger JAK/ STAT and NF-κB pathways to induce AID expression (Xu et al., 2012). Thus, the latent viral FLICE-inhibitory protein (vFLIP), and the lytic viral G protein-coupled receptor (vGPCR) gene candidates were selected based on their ability to directly or indirectly activate NF-κB (Mesri et al., 2010). vFLIP was also chosen because it upregulated AID expression in primary human tonsillar B cells (Bekerman et al., 2013). Besides its capacity to signal through the JAK/STAT pathway (Mesri et al., 2010; Xu et al., 2012), vIL-6 was selected due to its paracrine signaling potential (Mesri et al., 2010) and consistent levels of gene expression within KSHV-infected cultures of CH12F3-2 cells (Figure 1B) and splenocytes (Figure 3A). Accordingly, mouse naïve splenic B cells were transduced with vFLIP, vGPCR, or vIL-6 from a KSHV lentiviral library (Vart et al., 2007), and activated with LPS (Figure 3B). Twenty-four hours post-lentiviral infection, IL-4 was added to the culture to induce class-switching to IgG1, and surface isotype expression was evaluated via FACS 4 days later (Figure 3B). We observed that vIL-6 significantly increased class-switching in mouse splenocytes (33%, p ≤ 0.00014), in contrast to both vFLIP and vGPCR which resulted in no significant change in switching to IgG1 compared to the control (Figure 3C).

Viral cytokines such as vIL-6 often exhibit gain-of-function properties. Several differences exist between vIL-6 and IL-6 in regards to signaling, subcellular localization, secretion, host-binding interactions, and endothelial cell movement (Wan et al., 1999; Nicholas, 2005; Hu and Nicholas, 2006; Chen et al., 2009; Chen et al., 2012, 2014; Cousins et al., 2014; Giffin et al., 2015). Therefore, we wanted to determine whether mIL-6 affected class-switching, and/or if it demonstrated synergism with its viral homolog (Suthaus et al., 2012). Thus, B cells were transduced with vIL-6 lentivirus, and/or incubated with recombinant mIL-6, and CSR to IgG1 was evaluated. While IL-4-stimulated B cells transduced with vIL-6 resulted in a 47% increase in class-switching to IgG1 (Figure 3C), cells treated with mIL-6 showed no difference to control cells (Figure 3D). Similarly, mIL-6 did not further influence CSR levels in stimulated splenocytes transduced with vIL-6, suggesting that this effect is specific to vIL-6 (Figure 3D). These results indicate that vIL-6 contributed to the enhanced levels of class-switching mediated by KSHV.

AID initiates CSR (Muramatsu et al., 2000) and elevated AID expression is associated with increased class-switching efficiency (Cortizas et al., 2013). As we observed significantly higher levels of AID transcripts (Figure 2D) and IgG1 isotype-switching in stimulated splenic B cell cultures infected with KSHV (Figure 2B), we explored if vIL-6 expression was able to upregulate AID expression in the context of our CH12F3-2 CSR system. Initially, CH12F3-2 B cells were transduced with vFLIP, vGPCR, and vIL-6 (Figure 4A) to determine their effect on CSR efficiency. Although the increase in the level of IgA-switching observed in CH12F3-2 B cells transduced with vIL-6 was lower than that of IgG1 observed with mouse splenic B cells (Figures 3C,D), vIL-6 expression showed a trend to augment switching to IgA (∼10%), which was not observed with vFLIP or vGPCR (Figure 4A).

Accordingly, CH12F3-2 cells were transduced with empty vector or vIL-6 and stimulated or not with cytokines (CIT) for 24 h to evaluate the consequence of vIL-6 expression on AID levels. Since vIL-6 could activate both STAT1 and STAT3 (Molden et al., 1997), we used the phosphorylation of these two transcription factors to assess vIL-6 downstream signaling. We observed that vIL-6 transduction in CH12F3-2 cells upregulated phospho-STAT3 in the absence of CIT, and that cytokine stimulation amplified this effect (Figure 4B and Supplementary Figure 3). However, while total STAT1 expression slightly increased with cytokine exposure (Figure 4B), phospho-STAT1 expression was undetected in either the empty vector or vIL-6 transduced cells (Figure 4B and Supplementary Figure 3). These data suggest that in this B cell system, vIL-6 activates STAT3, and not STAT1 phosphorylation. Since STAT6 is implicated in CSR and is upregulated in response to IL-4 signaling (Dedeoglu et al., 2004), we used STAT6 as a positive control for IL-4 stimulation and to further show the signaling specificity of vIL-6 in CH12F3-2 cells. Phospho-STAT6 was substantially upregulated when stimulated with cytokines as predicted, and there was no difference in expression between control and vIL-6 transduced cells (Figure 4B). As expected, AID was only expressed in the presence of cytokines and its levels increased with vIL-6 expression (Figure 4B and Supplementary Figure 3), suggesting that AID expression was driven by STAT6-activating cytokines and was further augmented by vIL-6 signaling (Figure 4B). These data indicate that vIL-6 enhances class-switching likely by upregulating AID expression in B cells.