Front. Microbiol. Frontiers in Microbiology Front. Microbiol. 1664-302X Frontiers Media S.A. 10.3389/fmicb.2021.736406 Microbiology Correction Corrigendum: Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira Xu Jun 1 † Koizumi Nobuo 2 Nakamura Shuichi 3 * 1Department of Animal Microbiology, Graduate School of Agricultural Science, Tohoku University, Sendai, Japan 2Department of Bacteriology I, National Institute of Infectious Diseases, Tokyo, Japan 3Department of Applied Physics, Graduate School of Engineering, Tohoku University, Sendai, Japan

Approved by: Frontiers Editorial Office, Frontiers Media SA, Switzerland

 *Correspondence: Shuichi Nakamura naka@bp.apph.tohoku.ac.jp

This article was submitted to Infectious Diseases, a section of the journal Frontiers in Microbiology

†Present address: Jun Xu, Department of Bacteriology, Graduate School of Medicine, University of the Ryukyus, Okinawa, Japan

 17 08 2021 2021 12 736406 05 07 2021 07 07 2021 Copyright © 2021 Xu, Koizumi and Nakamura. 2021 Xu, Koizumi and Nakamura

This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.

 A Corrigendum on Crawling Motility on the Host Tissue Surfaces Is Associated With the Pathogenicity of the Zoonotic Spirochete Leptospira by Xu, J., Koizumi, N., and Nakamura, S. (2020). Front. Microbiol. 11:1886. doi: 10.3389/fmicb.2020.01886 bacterial motility pathogenicity spirochete leptospirosis zoonosis host–pathogen association biophysics optical microscopy

In the original article, there was a mistake in Supplementary Table S1 as published.

In the original version, “TATCGATACCGTCGATCACTTGTACAGCTCATCCATG” was shown as the reverse primer of AcGFP, but “GCTGGCCGGCGTCGATCACTTGTACAGCTCATCCATG” is correct. The corrected Supplementary Table S1 appears below.

Primer sequences used in this study.

Target Primer sequence (5' → 3')
Forward Reverse
rep-parB-parA (pGui1) TCGACGCCGGCCAGCGGTTACTTCATAGCATCTTGGTTC GCTGGAGCTCCACCGGCTCGACTCTTACGGTGTGTTAG
pNKLiG1 (pCjSpLe94 derivative) CGGTGGAGCTCCAGCTTTG GCTGGCCGGCGTCGAAAAGTAAGCACCTGTTATTGC
flgB promoter TATCGATACCGTCGACCCGAGCTTCAAGGAAGATTTCCTA ATGGAAACCTCCCTCATTTA
AcGFP GAGGGAGGTTTCCATATGACCATGATTACGCCAAGC GCTGGCCGGCGTCGATCACTTGTACAGCTCATCCATG

The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.

Publisher's Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.