Edited by: Kathleen S. Rockland, Boston University School Medicine, USA
Reviewed by: Ricardo Insausti, University of Castilla -la Mancha, Spain; Gudrun Ahnert-Hilger, Institute for Integrative Neuroanatomy Charite, Germany
*Correspondence: Naguib Mechawar and Salah El Mestikawy, Department of Psychiatry, Douglas Mental Health University Institute, McGill University, 6875 Lasalle blvd, Montréal, QC H4H 1R3, Canada e-mail:
This article was submitted to the journal Frontiers in Neuroanatomy.
†These authors have contributed equally to this work.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Glutamate is the major excitatory transmitter in the brain. Vesicular glutamate transporters (VGLUT1-3) are responsible for uploading glutamate into synaptic vesicles. VGLUT1 and VGLUT2 are considered as specific markers of canonical glutamatergic neurons, while VGLUT3 is found in neurons previously shown to use other neurotransmitters than glutamate. Although there exists a rich literature on the localization of these glutamatergic markers in the rodent brain, little is currently known about the distribution of VGLUT1-3 in the human brain. In the present study, using subtype specific probes and antisera, we examined the localization of the three vesicular glutamate transporters in the human brain by
Glutamate, the major excitatory neurotransmitter in the brain, has been implicated in many neurological and psychiatric disorders (Fonnum,
With the advent of genetically engineered mice, specific features and functions of the 3 VGLUTs have recently been identified (for review see Wallen-Mackenzie et al.,
The anatomical distribution of the 3 VGLUTs has been thoroughly characterized in the mature rodent brain (for review see El Mestikawy et al.,
The almost non-overlapping distribution of the 3 VGLUTs delineates three complementary glutamatergic systems. VGLUT1 and VGLUT2 play major neurophysiological roles in virtually all major neuronal circuits, while VGLUT3 is involved in more subtle modulation of local transmission (for review see El Mestikawy et al.,
The widespread distributions of VGLUT1-3 in rodent CNS suggest their involvement in the regulation of sensori-motor, cognitive and mood processes. Hence, it can be surmised that alterations in the expression of these proteins may underlie significant aspects of human neurolopathologies. Indeed, recent postmortem studies have highlighted alterations in VGLUT1 and VGLUT2 expression in mood disorders and psychosis (Oni-Orisan et al.,
This study was approved by the Douglas Institute Research Ethics Board, and written informed consent from next-of-kin was obtained in each case. Postmortem brain samples from six caucasian individuals (Table
135 | Male | 18 | Nil | Natural death cardiovascular |
2.0 |
138 | Female | 66 | Nil | Car accident |
57.6 |
146 | Male | 26 | SCZ | Suicide |
3.9 |
152 | Female | 49 | MDD | Suicide |
14.7 |
155 | Male | 31 | MDD | Natural death cause unknown |
9.2 |
513 | Male | 72 | Nil | Heart attack | 5.0 |
HV1-AS1: GGGACTCGTAGGAGACGAGCAGCCAGAACAGGTAC |
HV1-AS2: GAGAGCACGACCCGCTAGCTTCCGAAACTCCTCCT |
HV1-AS3: GAGCAGGGTTCCTTGACACTGTCACTCAGGCCAG |
HV1-AS4: CCCCGTAGAAGATGACACCTCCATAGTGCACCAGGG |
HV1-S1: GTACCTGTTCTGGCTGCTCGTCTCCTACGAGTCCC |
HV1-S2: AGGAGGAGTTTCGGAAGCTAGCGGGTCGTGCTCTC |
HV1-S3: CTGGCCTGAGTGACAGTGTCAAGGAACCCTGCTC |
HV1-S4: CCCTGGTGCACTATGGAGGTGTCATCTTCTACGGGG |
HV2-AS1: GCTTCTTCTCCAGACCCCTGTAGATCTGGCCGAG |
HV2-AS2: GAAGGGGAGTATCCGGTGGCAAAGAGCGCAAGCAG |
HV2-AS3: CCCCAAAAGAAGGAACCGTGGATCATCCCCACGG |
HV2-AS4: CTTTCTCCTTGATGACCTTGCCCCCGCGGTGGAT |
HV2-S1: CTCGGCCAGATCTACAGGGTGCTGGAGAAGAAGC |
HV2-S2: CTGCTTGCGCTCTTTGCCACCGGATACTCCCCTTC |
HV2-S3: CCGTGGGGATGATCCACGGTTCCTTCTTTTGGGG |
HV2-S4: ATCCACCGCGGGGGCAAGGTCATCAAGGAGAAAG |
HV3-AS1: CGGCTTCTCTCCAAAGGTGGTGCCCACTTA |
HV3-AS2: AGCCAACCACCAGGAGTAAGGTTGCCTCCATGCC |
HV3-AS3: CCCCTCCCAATATTTGGACCTCTGGCAAGCTGGG |
HV3-AS4: GGACCATCCAATGTACTGCACCAACACCCCAGCC |
HV3-S1: GGAGTAAGTGGGCACCACCTTTGAGAGAAGCCG |
HV3-S2: GGCATGGAGGCAACCTTACTCCTGGTGGTTGGCT |
HV3-S3: CCCAGCTTGCCAGAGGTCCAAATATTGGGAGGGG |
HV3-S4: GGCTGGGGTGTTGGTGCAGTACATTGGATGGTCC |
DAT1AS1: GACTTCCTGGGGTCTTCGTCTCTGCTCCCTCTAC |
DATAS2: GTAGGCCAGTTTCTCTCGAAAGGACCCAGGCAGG |
DATAS3: GGTATGCTCTGATGCCGTCTATGGCTCCAGGGAG |
DATAS4: GCCTGAGTGGCAGTAGCCTGAGCTGGTTTCAAGG |
DATAS5: GTTGGCCCAGTCGGGGAAGATGTAGGCTCCGTAGT |
DAT1S1: GTAGAGGGAGCAGAGACGAAGACCCCAGGAAGTC |
DATS2: CCTGCCTGGGTCCTTTCGAGAGAAACTGGCCTAC |
DATS3: CTCCCTGGAGCCATAGACGGCATCAGAGCATACC |
DATS4: CCTTGAAACCAGCTCAGGCTACTGCCACTCAGGC |
DATS5: ACTACGGAGCCTACATCTTCCCCGACTGGGCCAAC |
humSERT-AS1: AGCCACTAGGGTGGTGGTGGTCGCTGGGATAGAGT |
humSERT-AS2: CCTCCGAGCTCTCTATCGTCGGGATTGACACGTC |
humSERT-AS3: CAGGACCCCAAAGCCCGGACCAAGAGAGAAGAAG |
humSERT-AS4: GAACAGGAGAAACAGAGGGCTGATGGCCACCCAG |
humSERT-S1: ACTCTATCCCAGCGACCACCACCACCCTAGTGGCT |
humSERT-S2: GACGTGTCAATCCCGACGATAGAGAGCTCGGAGG |
humSERT-S3: CTTCTTCTCTCTTGGTCCGGGCTTTGGGGTCCTG |
humSERT-S4: CTGGGTGGCCATCAGCCCTCTGTTTCTCCTGTTC |
To visualize proteins, immunoautoradiography (IAR) was performed as previously described (Kashani et al.,
Anti-VGLUT1 was used at 1:2000; anti-VGLUT2 affinity purified antiserum at 1:4000 (Kashani et al.,
On the day of the experiment, fresh frozen sections (10 μm) were fixed in 4% formaldehyde in PBS, washed with PBS, and preincubated in PBS containing 3% bovine serum albumin, 1% normal goat serum and 1 mM NaI (buffer A) for 1 h. Sections were incubated with buffer A supplemented with polyclonal rabbit anti-VGLUT1-3 antisera overnight at 4°C, followed by anti-rabbit [125I]-IgG (GE Healthcare lifesciences, 100 mCi/ml) for 2 h. Sections were exposed to X-ray films (Biomax MR, Kodak, France) for 24 h, and images were digitized using a PowerLook 100 Umax scanner and analyzed with Multi Gauge Software.
Immunohistochemistry detection of VGLUT1-3 on human brain sections was performed as previously described with minor modifications. Paraffin embedded sections (5 μm) of the cerebellum were obtained from formalin-fixed brains as already described (Torres-Platas et al.,
The overall regional distributions of VGLUT1-3 mRNA and proteins were highly similar between subjects (Table
Cerebral cortex | +++ | +++ | + | ++ | + | ++ | 146 |
Hippocampus | +++ | +++ | N.D. | ++ | + | +++ | 146 ( |
155 ( |
|||||||
Amygdala | + (LA) | +++ | N.D. | ++ | N.D. | ++ | 135 |
Basal Ganglia | N.D. | +++ | N.D. | +++ | + | +++ | 152 |
155 | |||||||
Habenula | N.D. | + | +++ | +++ | N.D. | +++ | 146 |
SNC | N.D. | + | N.D. | +++ | N.D. | +++ | |
Thalamus | N.D. | ++ | +++ | ++ | N.D. | N.D. | 138 |
Raphe | ++ (Pons) | ++ | +++ (Pons) | +++ | ++ | +++ | 146 |
Cerebellum | +++ (Gcl) | +++ | N.D. | +++ | N.D. | N.D. | 146 |
The expression patterns of each of the three VGLUTs were conserved in both motor (BA4) and prefrontal associative cortex (BA9) (Figure
VGLUT2 mRNA was restricted to a band of cells spanning lower layer V. This distribution was mirrored by the presence of a more abundant cortical VGLUT2-immunoreactive material in layer V. The other cortical layers were uniformly immunoreactive but less intensely than layer V. In contrast to VGLUT1 and VGLUT2, VGLUT3 mRNA was only observed in scarce cells across the gray matter. VGLUT3 protein, however, was observed throughout the cortex with particular abundance in upper and lower layers, above and below of a band of lower intensity in mid-cortex.
In the hippocampal formation, VGLUT1 mRNA was detected in the pyramidal layer of Cornu Ammonis (CA1-3) fields, in the granule cell layer of the dentate gyrus (DG), as well as in sparse cells across the hilus (Figure
Although VGLUT2 mRNA was not detected in the hippocampus, the protein was very strongly expressed in the molecular layer of the DG, as well as in the mossy fiber pathway and in the subiculum.
VGLUT3 mRNA was only expressed in scattered cells throughout the hippocampal formation, except within the CA pyramidal cell layer and granule cell layer of the DG. The pattern of VGLUT3-IR was radically different, with more widespread distribution in gray matter displaying particularly strong signal in the outer DG granule cell layer, hilus, and mossy fiber pathway.
These patterns of expression were observed at various levels of the anteroposterior axis of the hippocampus (Figure
Of the three transporters examined, VGLUT1 was the only one to display mRNA expression in the amygdala, with very faint signal being mostly restricted to the lateral amygdala. In contrast, all three VGLUT proteins were labeled in the amygdala. Immunoreactivities were prominent in the basolateral complex, although VGLUT3-IR was weaker than VGLUT1- and VGLUT2-IR (Figure
VGLUT1 and VGLUT2 transcripts were absent from basal ganglia whereas VGLUT3 mRNA was detected in sparse cells distributed in the caudate the putamen and the nucleus accumbens (Figure
Dopaminergic cells from the substantia nigra
The habenular complex displayed strong content of VGLUT2 mRNA transcripts, and absence of VGLUT1 and VGLUT3 mRNAs. All three VGLUT proteins were labeled in the habenula. VGLUT2-IR was very strong in both the lateral and medial habenula, VGLUT3-IR was high and moderate in the medial and lateral portions of the habenula, respectively, and faint VGLUT3-IR was restricted to the medial part of the complex (Figure
Of the three VGLUTs, only VGLUT2 mRNA was found to be expressed in the thalamus (Figure
Serotonergic neurons were observed by SERT ISH in the raphe. This area (raphe dorsalis) was partially labeled by VGLUT3 ISH, but did not display VGLUT1 nor VGLUT2 mRNA (Figure
In the cerebellum, VGLUT1 mRNA was detected only in the granule cell layer (Figure
The anatomical distribution of VGLUTs has been thoroughly described in rodents (see for example, Ni et al.,
Our results are in line and extend previously published results. We found that transcripts coding for VGLUT1 and VGLUT2 were easily visualized. Interestingly, VGLUT1 and VGLUT2 transcripts are absent from area where both proteins are abundantly expressed (such as the caudate-putamen for example). This mismatch has been previously reported in rodent (Herzog et al.,
In human brains, VGLUT3 mRNA was hardly detected in some areas given weak signals and the small numbers of cells synthesizing this transcript. In contrast to VGLUT1 and VGLUT2, VGLUT3 transcript is often colocalized with the protein (in the hippocampus or caudate-putamen for example). This result suggests that, VGLUT3 has a discrete distribution in the human brain, similar to that previously described in rodents (Gras et al.,
As in rodents (Herzog et al.,
VGLUT1 and VGLUT2 patterns of mRNA expression in human brains corresponded to prominent cortical and subcortical glutamatergic systems, as previously described in rodents. In cerebral cortex, VGLUT1 mRNA displayed the most intense VGLUT signal. It was concentrated in layers V-VI, and thus presumably associated with pyramidal neurons projecting to subcortical structures. VGLUT2 mRNA, however, was rather weakly expressed in cortex, with signal being limited to a small band of cells in the middle layers. In contrast, protein expression for both transporter subtypes was strong in cerebral cortex. VGLUT1-IR yielded the strongest and most uniform staining in neocortex, spanning all layers homogeneously. VGLUT2-IR was also found throughout the cortical thickness, but much more weakly, except for a dense IR band in mid-cortex that colocalized with its mRNA distribution. This band also likely corresponded to layer V pyramidal neurons. The combined intensities of VGLUT1- and VGLUT2-IR throughout the cortical thickness clearly reflects the abundance of cortical and subcortical glutamatergic axon terminating in this structure. In the hippocampus, VGLUT1 (but not VGLUT2) was also associated with projection neurons. VGLUT1 mRNA sharply outlined the CA fields as well as the dentate gyrus, with strong signal in pyramidal neurons as well as granule cells. Thus, as in rodents, VGLUT1- and VGLUT2-IR suggests that VGLUT1 is the major vesicular glutamate transporter in the hippocampus and that VGLUT2 has only a discrete distribution in this area.
In subcortical regions, VGLUT1 and VGLUT2 displayed variable expression patterns. In the basal ganglia, although mRNAs for these transporters were completely absent, VGLUT1- and VGLUT2-IR were very intense in the caudate, putamen as well as the nucleus accumbens, and moderate in the substantia nigra. As previously described in rodents, VGLUT2-IR in the globus pallidus was also of moderate intensity, whereas VGLUT1 was absent. In the amygdala, the basolateral amygdaloid complex was the only region strongly delineated by VGLUT1- and VGLUT2-IR, as well as by VGLUT1 mRNA expression. Of note was the particularly high VGLUT2 mRNA and protein expression in the habenular complex, and moderate VGLUT1-IR in the lateral habenula. The only VGLUT mRNA (weakly) expressed in the thalamus was that coding for VGLUT2, with proportionally moderate immunoreactivity. The latter was uneven at the anatomical level examined, with sharp differences between thalamic nuclei. Heterogeneous VGLUT1-IR was also observed between nuclei, but its distribution did not match that of VGLUT2-IR.
The only VGLUT mRNA detected in the cerebellum was VGLUT1 mRNA strongly expressed in but confined to the granule cell layer. VGLUT1 and VGLUT2 proteins, however, were abundantly expressed and presented a complementary distribution along cerebellar layers. This strong IR is thus mainly provided by cerebellar afferents, among which the pontine nucleus was found to express high levels of VGLUT1 and VGLUT2 mRNA.
Similar to rodents (Herzog et al.,
In summary, the anatomical distributions of brain cells expressing each one of the 3 VGLUTs are strikingly different. In contrast, the proteins are often found within the same areas (with the exception of the cererbellum and the thalamus, in which VGLUT3 was not detected). The regional distributions of VGLUT transcripts and proteins was found to be highly similar between human and rodent, suggesting that these transporters play fundamental roles in brain function that were conserved with evolution. This knowledge is particularly important given the previous implication of VGLUTs in cerebral pathologies, as it validates the use of rodent models to uncover the molecular mechanisms underlying human mental illnesses.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We thank Quebec's coroner office as well as the next-of-kin of the deceased for their support. We also thank the expert staff of the Douglas-Bell Canada Brain Bank: Maâmar Bouchouka, Danielle Cécyre, Kirsten Humbert and Lucie Ratelle. This research was supported by funds from ANR (ANR-09-MNPS-033), ANR/CIHR (ANR-10-MALZ-0105), CFI (203624), CRC (CRC–216124), Fondation pour la Recherche Médicale (FRM DEQ20130326486), FRQS, the Douglas Foundation, the Graham Boeckh Foundation, CIHR (MOP-111022) and NSERC (950-203624-X-217240). MR was supported by a grant from the Réseau Québecois de Recherche sur le Suicide (RQRS) and NM is a CIHR New Investigator and FRQS Chercheur-boursier.