Procedures using laboratory animals were in accordance with the international guidelines on the ethical use of animals from the European Communities Council Directive of 24 November 1986 (86/609/EEC). C57BL/6J (wt) and homozygous cxcr6^gfp/gfp knock-in mice (Unutmaz et al., 2000) in which the coding region of the receptor has been substituted with the coding region of the Green Fluorescent Protein (GFP) were obtained from Jackson Laboratory (strain name B6.129P2-Cxcr6tm1Litt/J). A3R knockout mice (A3R^–/–) (Salvatore et al., 2000) were also used. Animals of either sex were used.

Male mice (25–28 g, 10–12 weeks) were anesthetized with intraperitoneal Equitensine at 3.5 ml/kg (39 mM pentobarbital, 256 mM chloral hydrate, 86 mM MgSO4, 10% ethanol v/v, and 39.6% propyleneglycol v/v). The right MCA was permanently occluded by electrocoagulation as described previously (Storini et al., 2006). Mice were maintained at 37°C during surgery and sacrificed 24 h after pMCAO.

Recombinant mouse CXCL16 or mouse CX3CL1 (Peprotech) was dissolved in saline solution and intracerebroventricularly injected 30 min before pMCAO. For dose-response experiments, mice were injected with 15, 70 and 150 pmol CXCL16/2 μl. Anesthetized animals were immobilized on a stereotaxic apparatus (David Kopf Instruments) and injected in the right cerebral ventricle (1 mm lateral and 3 mm deep, according to the atlas of Paxinos and Franklin, 2004). A constant rate of infusion (0.2 μl/min) was maintained with a pump (KD Scientific).

The extent of ischemic area was evaluated 24 h after ischemia. Mice were deeply anesthetized with Equitensine and transcardially perfused with ice-cold PBS (20 ml), pH 7.4, and paraformaldehyde (PFA; 4%, 50 ml) in PBS. The brains were carefully removed from the skull and transferred in 4% PFA at 4°C overnight, then to PBS/30% sucrose at 4°C overnight, frozen in isopentane at −45°C for 3 min, and then stored at −80°C until use. Twenty μm coronal brain cryosections were cut serially at 320 μm intervals and stained with cresyl violet. Infarct volumes were calculated by integration of the infarct areas on each brain slice, as described previously (Storini et al., 2006).

Primary hippocampal cultures were prepared from the brain of 0–2-day-old wild type (wt), cxcr6^gfp/gfp and A3R^–/– mice. In brief, after careful dissection from diencephalic structures, the meninges were removed and the hippocampi chopped and digested in 0.025% trypsin, in Hank’s balanced salt solution (HBSS) for 20 min at 37°C. Cells were mechanically dissociated and plated at a density of 2.5 × 10⁵ in poly-L-lysine coated plastic 24-well dishes, in serum-free Neurobasal medium supplemented with B27, 0.5 mM L-glutamine and 100 μg/ml gentamicin. Successively, cells were kept at 37°C in 5% CO₂ for 10–11 days in vitro (DIV) with a twice a week medium replacement (1:1 ratio). With this method we obtained 60–70% neurons, 30–35% astrocytes, 4–5% microglia, as determined with β-tubulin III, glial fibrillary acidic protein (GFAP), and isolectin IB4 staining (Lauro et al., 2010).

Primary hippocampal cultures (10–11 DIV) were exposed to OGD. Briefly, culture medium was replaced with modified Locke’s buffer (without glucose), bubbled with 95% N₂/5% CO₂, and transferred into an anaerobic chamber (Billups-Rothenberg MIC- 101) containing a mixture of 95% N₂/5% CO₂, and humidified at 37°C for 90 min. For the reperfusion conditions OGD was terminated by replacing the OGD medium with the original conditioned medium. For comparative purposes, control cultures were treated under normoxic conditions (95% O₂/5% CO₂) in complete Locke’s buffer supplemented with glucose (5.6 mM).

In primary hippocampal cultures (10–11 DIV) conditioned medium was removed and stored for later usage; neurons were washed and stimulated with Glu (100 μM, 30 min) in modified Locke’s buffer (without MgCl₂ plus 1 μM glycine to stimulate all types of Glu receptors), in the presence or in the absence of recombinant mouse mCX3CL1 (100 nM, Peprotech). Under these experimental conditions, only neurons die (Chen et al., 2000; Rosito et al., 2012). After treatment, cells were re-incubated in the original conditioned medium for 18–20 h, treated with lysis buffer (0.5% ethylhexadecyldimethylammonium bromide, 0.28% acetic acid, 0.5% Triton X-100, 3 mM NaC1, 2 mM MgCl, in PBS pH 7.4) and counted in a hemocytometer for viability, as described (Volontè et al., 1994). Data were expressed as percentage of viable cells taking as 100% the number of viable cells in control cultures. Variability in the number of viable cells in control conditions never exceeded 10%.When necessary, cells were pre-treated with monoclonal mouse αCCL2 Ab (3 μg/ml, 30 min; R&D MAB479), rat IgG (3 μg/ml, 30 min; Santa Cruz Biotecnology sc-2032), 3-propyl-6-ethyl-5-[(ethylthio)carbonyl]-2phenyl-4-propyl-3-pyrinide carboxylate (MRS1523; 100 nM, Sigma) in culture medium; drugs were present also during and after Glu challenge.

Total RNA from ipsilateral (ischemic core and penumbra) and controlateral (corresponding areas) brain emispheres of pMCAO mice, from primary hippocampal mixed cell cultures (5 × 10⁵ cells), from primary astrocytes (2.5 × 10⁵) and microglial cells (2.5 × 10⁵), was extracted by the use of Trizol reagent (Invitrogen). Reverse transcription reaction was performed in a thermocycler (MJ Mini Personal Thermal Cycler; Biorad) using IScriptTM Reverse Transcription Supermix (Biorad) according to the manufacturer’s protocol. Real-time PCR (RT-PCR) was carried out in a I-Cycler IQ Multicolor RT-PCR Detection System (Biorad) using SsoFast EvaGreen Supermix (Biorad) according to the manufacturer’s instructions. The PCR protocol consisted of 40 cycles of denaturation at 95°C for 30 s and annealing/extension at 58°C for 30 s. For quantification analysis the comparative Threshold Cycle (Ct) method was used. The Ct values from each gene were normalized to the Ct value of β-actin or GAPDH in the same RNA samples. Relative quantification was performed using the 2−ΔΔCt method (Schmittgen and Livak, 2008) and expressed as fold change in arbitrary values. Primer sequences targeted against CXCL16 (BC019961.1, GenBank), mouse β-actin and GAPDH were as follows: CXCL16-forw. TCCTTTTCTTGTTGGCGCTG, CXCL16rev. CAGCGACACTGCCCCTGGT; β-actin-forw.AGAGGGAAATCGTGCGTGAC, β-actin-rev. CAATAGTGATGACCTGGCCGT; GAPDH- forw. TCGTCCCGTAGACAAAATGG, GAPDH-rev. CAAGGGGTTGAAGCTCAGAT.

Primary cortical glial cells were prepared from 0–2-day-old wt mice. Cerebral cortices were chopped and digested in 30 U/ml papain for 40 min at 37°C followed by gentle trituration. The dissociated cells were washed, suspended in DMEM with 10% fetal bovine serum (FBS; Gibco) and 2 mM L-glutamine and plated at a density of 9–10 × 10⁵ in 175 cm² cell culture flasks. At confluence (10–14 DIV), glial cells were shaken for 2 h at 37°C to detach and collect microglial cells. Astrocytes which remained attached to the bottom of the flask were treated with trypsin and collected. These procedures gave almost pure (no more than 2% astrocyte contamination) microglial cell population, and astrocytes cell population (4–6% of microglia contamination), as verified by staining with GFAP and isolectin IB4.

After 10–14 DIV, 8 × 10⁵ microglial cells were re-plated and co-cultured for 48 h with astrocytes cells (8 × 10⁵) seeded on 24 mm transwell cell-culture inserts (pore size 0.4 μm; Corning Life Sciences) which allows traffic of small diffusible substances, but prevents cell contact. After co-cultures, cells were treated with vehicle or soluble CX3CL1 (100 nM) for 18 h and upon stimulation proteins from cells and conditioned medium was collected and analyzed for Western blot. For CCL2 ELISA and mRNA analysis 2.5 × 10⁵ astrocyte were re-plated on 12 mm transwell cell-culture inserts (pore size 0.4 μm; Corning Life Sciences) and co-cultured with 2.5 × 10⁵ microglial cells. After 48 h cells were treated with vehicle or soluble CX3CL1 (100 nM) for 18 h. For ELISA conditioned medium (c.m.) was collected and analyzed according to the manufacturer (R&D Systems), while for mRNA extraction microglia and astrocytes were collected from the different transwell compartments.

C.m. from microglia-astrocytes co-cultures were collected and concentrated by ultrafiltering on Ym-10 membrane (Centricon; Millipore). For cell membrane proteins preparation, cells were washed with phosphate-buffered saline and lysed for 15 min on ice in hypotonic buffer containing 10 mM HEPES pH 8, 1.5 mM MgCl₂, 1 mM DDT, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride. After centrifugation at 1500 rpm for 5 min at 4°C, supernatant were ultra-centrifuged at 55000 rpm for 60 min, 4°C, and pellet were suspended in NaCl 10 mM.

Protein samples were separated on 10% SDS-polyacrylamide gel and analyzed by Western immunoblot using a mouse CXCL16 antibody (0.2 μg/ml; R&D System, AF503) and HRP-tagged rabbit anti goat IgG secondary antibody (1:2000; Dako), and subsequently detected using a commercial chemiluminescent assay (Immun-Star WesternC Kit; Bio-Rad). Densitometric analysis was performed with Quantity One software (Biorad). Interpretation of western-blot bands for CXCL16 was according to Gough et al. (2004).

The data are expressed as the means ± SEM. Where appropriate t-test, or analysis of variance (ANOVA) was used: we performed the parametric one-way ANOVA or two-way ANOVA followed by specific multiple comparison, as described in detail in figure legends. A value of p < 0.05 was considered significant. All statistical analysis was done using SigmaPlot 11.0 Software.

Since we have recently demonstrated that CXCL16 is neuroprotective against Glu excitotoxicity in vitro (Rosito et al., 2012), we now investigated the ability of CXCL16 to induce neuroprotection in mice upon pMCAO. In wt mice, i.c.v. injection of soluble CXCL16, 30 min before induction of pMCAO, resulted in a decreased ischemic volume compared to wt mice injected with saline (n = 10) control solution: in particular, a significant reduction in ischemic volume was observed after injection of 70 and 150 pmol of CXCL16 (n = 4–8; p < 0.05), while no effect was observed upon injection of 15 pmol (n = 4; Figure 1A). Further experiments were performed at 70 pmol. The neuroprotective effect of CXCL16 was specific, being absent in mice that lack CXCR6 receptor (cxcr6^gfp/gfp mice; Figure 1B). Two-way ANOVA analysis indicated a significant interaction between genotypes and treatments (p = 0.02) and post hoc evaluation revealed that CXCL16 was ineffective in reducing ischemic volume in cxcr6^gfp/gfp mice (n = 6). In addition, in cxcr6^gfp/gfp mice, pMCAO induced a significantly increased ischemic volume compared to wt animals suggesting that endogenous CXCL16-CXCR6 signaling contributes to restrain brain damage following ischemic insult.

To investigate whether the protective effect of CXCL16 upon pMCAO requires the activity of A3R, we analyzed the effect of i.c.v. administration of CXCL16 in A3R^–/– mice (n = 6–7; Figure 1B). Two-way ANOVA analysis reveals a significant differences between genotypes (p < 0.001), being the ischemic volume higher in A3R ^−/– vs. wt animals. CXCL16 administration was effective in reducing ischemic volume in both genotypes, (p < 0.05) but the reduction observed in A3R^–/– mice was less pronounced (12.3% in A3R^–/– vs. 26.3 % in wt).

Since CXCL16 signaling is determinant in reducing brain damage, we measured CXCL16 expression in the brain upon ischemia. RT-PCR analysis revealed that 24 h after pMCAO CXCL16 mRNA specifically increased in the ipsilateral hemisphere (n = 5; p < 0.001; Figure 2A), while no differences were observed in sham operated mice (not shown). Similar results were obtained in vitro, when hippocampal cultures were treated to induce OGD cell death (Rosito et al., 2012). After 90 min of OGD we observed a reduction of CXCL16 mRNA, followed by a significant increase after 2 h of recovery (n = 8–11; p < 0.05; Figure 2B).

To investigate if CXCL16 could be released from glia upon treatment with the neuroprotective chemokine CX3CL1, conditioned media (c.m.) from microglia/astrocytes co-cultures (in transwell system, see Section Materials and Methods) treated or not with CX3CL1 (100 nM, 18 h), were analyzed for CXCL16 presence. Data shown in Figure 3A revealed a significant increase in soluble CXCL16 upon CX3CL1 treatment (n = 12; p < 0.001). Membrane fractions of both microglia and astrocytes were also analyzed and we found that after CX3CL1 treatment the mature form of CXCL16 was significantly increased (Figures 3B,C top panels; n = 6; p < 0.05). Interestingly, we also observed an increased expression of CXCL16 mRNA upon CX3CL1 stimulation both in microglia and astrocytes (Figures 3B,C bottom panels; n= 6–8; p < 0.05).

Since CXCL16 acts on its unique receptor CXCR6, we performed experiments on the neuroprotective activity of CX3CL1 against Glu excitotoxicity in hippocampal cultures obtained from cxcr6^gfp/gfp mice, to investigate the possible involvement of CXCL16 in CX3CL1-induced neuroprotection. As reported in Figure 4, CX3CL1 was less effective in preventing cell death in hippocampal cultures derived from mice that lack CXCL16 signaling, compared with wt cultures. In particular, statistical analysis (two-way ANOVA) indicated a significant interaction between genotypes and treatment, with a main effect of treatments (p = 0.004). In cxcr6^gfp/gfp mice, a significant difference between Glu and both control and Glu/CX3CL1 treated cells was observed (n = 8–10; p < 0.05).

The activity of CXCL16 and A3R on astrocytes and the consequential release of CCL2 are key events in CXCL16 induced neuroprotection (Rosito et al., 2012). To further corroborate the CX3CL1-CXCL16 connection in neuroprotection, we analyzed the contribution of A3R and CCL2 in this mechanism. We performed excitotoxic experiments in hippocampal cultures derived from A3R^–/– mice: at difference with wt, in A3R^–/– cultures CX3CL1 was less effective in preventing cell death (Figure 5A). Statistical analysis (two-way ANOVA) indicated a significant interaction between genotypes and treatment (p = 0.025), with a main effect of treatments. Both in wt and A3R^–/– animals, a significant difference between Glu and both control and Glu/CX3CL1 treated cells was observed (post hoc analysis, n = 6; p < 0.05). According to this result, the A3R inhibitor MRS1523 reduced CX3CL1 neuroprotection (n = 5; p < 0.05; Figure 5B). Moreover, as reported in Figure 5C in the presence of neutralizing αCCL2 Ab (but not with control IgG, both used at 3 μg/ml), CX3CL1 was not able to induce neuroprotection (n = 4; p < 0.05).

To verify the hypothesis that CX3CL1 could also induce the release of CCL2, that concur to neuroprotection, we stimulated microglia-astrocytes co-cultures or microglia with CX3CL1 for 18 h and measured CCL2 level in the c.m. Figure 5D shows a basal release of CCL2 that increases upon CX3CL1 stimulation in microglia-astrocyte co-culture (n = 11; p < 0.001 Rank sum Test) but not in microglia alone (n = 7; p = 0.7 Rank sum Test), suggesting that CX3CL1 acting on microglia, induces the release of CCL2 from astrocytes.

CX3CL1 is neuroprotective in pMCAO (Cipriani et al., 2011). To further confirm that CXCL16 contributes to CX3CL1 neuroprotection, wt and cxcr6^gfp/gfp mice were i.c.v. injected with soluble CX3CL1, 30 min before induction of pMCAO: as reported in Figure 6, two-way ANOVA analysis reveals a significant difference between genotypes (p < 0.001), being the ischemic volume higher in cxcr6^gfp/gfp mice vs. wt animals. CX3CL1 administration was effective in reducing ischemic volume in both genotypes (p < 0.05) but the reduction observed in cxcr6^gfp/gfp mice was less pronounced being 10.9% (n = 6) vs. 25.6 % in wt (n = 4).