Edited by: Gilles Huberfeld, Sorbonne Universités, France
Reviewed by: Maheedhar Kodali, Texas A&M Health Science Center, United States; Dinesh Upadhya, Manipal Academy of Higher Education, India
This article was submitted to Epilepsy, a section of the journal Frontiers in Neurology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
The Wistar Audiogenic Rat (WAR) strain is a genetic model of epilepsy, specifically brainstem-dependent tonic-clonic seizures, triggered by acute auditory stimulation. Chronic audiogenic seizures (audiogenic kindling) mimic temporal lobe epilepsy, with significant participation of the hippocampus, amygdala, and cortex. The objective of the present study was to characterize the mitochondrial energy metabolism in hippocampus and cortex of WAR and verify its relationship with seizure severity. Hippocampus of WAR naïve (no seizures) presented higher oxygen consumption in respiratory states related to the maximum capacities of phosphorylation and electron transfer system, elevated mitochondrial density, lower GSH/GSSG and catalase activity, and higher protein carbonyl and lactate contents, compared with their Wistar counterparts. Audiogenic kindling had no adding functional effect in WAR, but in Wistar, it induced the same alterations observed in the audiogenic strain. In the cortex, WAR naïve presented elevated mitochondrial density, lower GSH/GSSG and catalase activity, and higher protein carbonyl levels. Chronic acoustic stimulation in Wistar induced the same alterations in cortex and hippocampus. Mainly in the hippocampus, WAR naïve presented elevated mRNA expression of glucose, lactate and excitatory amino acids transporters, several glycolytic enzymes, lactate dehydrogenase, and Na+/K+ ATPase in neurons and in astrocytes.
Epilepsy is one of the most common diseases involving the central nervous system (
Since the 1920s, studies have demonstrated that the ketogenic diet may be antiepileptogenic, suggesting an altered energy metabolism of neurons of patients with epilepsy. Some side effects of the ketogenic diet include certain mitochondrial cytopathies such as Complex I and carnitine deficiencies [for a review (
In order to study brain networks participation in the expression of epileptic seizures, animal models of epilepsy have been developed, among them the Wistar audiogenic rat (WAR) strain was developed from inbreeding of Wistar susceptible progenitors (
The objective of the present study was to characterize the mitochondrial energy metabolism in WAR's hippocampus and cortex, and to verify its relation with seizure severity. We evaluated mitochondrial respiration, redox state, activity of antioxidant enzymes and oxidative stress markers in Wistar and WAR submitted to conditions without seizures (naïve), and after successive epileptic seizures (audiogenic kindling). In addition, we also verified the effects of
Male Wistar and WAR animals were obtained from the breeding colony at the University of São Paulo, Ribeirão Preto Campus, and the Physiology Department, Ribeirão Preto School of Medicine, respectively. The animals had free access to food and water and maintained on a 12:12 h light:dark cycle at 22°C. All procedures were approved by the Ethics Committee on the Use of Animals of Faculdade de Medicina de Ribeirão Preto—USP (CEUA-FMRP, protocol no. 011/2015).
Wistar and WAR, at approximately 70 days of age, were placed into a cylindrical acrylic arena (height: 32 cm, diameter: 30 cm) inside an acoustically isolated wood chamber (45 × 45 × 40 cm) with a 15-W lamp in the top of the cage. The sound of a ringing bell (120 dB) was digitized with a high-pass filter (N500 Hz) and reproduced with a personal computer coupled to amplifiers and tweeters under the top of the cage. This procedure was repeated twice a day for 10 days. Behavioral evaluations were in accordance with the categorized seizure severity index (cSI) developed by Garcia-Cairasco et al. (
The term audiogenic kindling was coined by Marescaux et al. (
WARs with approximately 40 days of age were separated into three groups: WAR, WAR-DNP, and WAR-NAC. The WAR group continuously received drinking water; the WAR-DNP group continuously received drinking water containing 1 mg/L DNP; and the WAR-NAC group continuously received drinking water containing 2 g/L NAC. DNP and NAC solutions were prepared daily and placed into light-protected bottles. Hydric intake was measured daily. Intervention with DNP increased 38% hydric intake while NAC reduced 23%. Relative to body weight, the WAR-DNP group ingested 19.84 ± 1.38 μg/100 g/day DNP, and WAR-NAC group ingested 20.37 ± 0.37 mg/100 g/day NAC, as found in previous studies (
Biopsy samples were chopped into 1-mm cubes and placed in ice-cold BIOPS solution [2.7 mM EGTA, 20 mM imidazole, 20 mM taurine, 50 mM acid 2-(N-morfolino) ethanesulfonic potassium, 0.5 mM dithiothreitol, 6.5 mM MgCl2, 15 mM phosphocreatine, 0.57 mM ATP, pH 7.1] as recommended by Oroboros Instruments (Innsbruck, Austria). For cell membrane permeabilization, biopsies were placed into BIOPS solution containing saponin (0.01%) during 5 min, at 37°C and 300 rpm stirring. Biopsies were then rinsed with mitochondrial respiration medium MiR05 [0.5 mM EGTA, 3 mM MgCl2, 60 mM K-lactobionate, 20 mM taurine, 10 mM KH2PO4, 20 mM HEPES, 110 mM sucrose, 1 g/L albumin, pH 7.1].
Respiratory rates were determined monitoring oxygen consumption in an Oxygraph-2k respirometer (Oroboros, Innsbruk, Austria) containing 2.1 mL of air saturated respiration medium. The Respiratory States were determined as follows: NADH-linked, after substrate (9 mM glutamate and 5 mM malate) addition; OXPHOS (phosphorylation), in the presence of adenosine diphosphate (ADP, 1 mM); LEAK (non-phosphorylating), after ATP synthase inhibition by oligomycin (1 μg/mL); ETS (non-coupled), in the presence of the mitochondrial uncoupler carbonyl cyanide m-chlorophenylhydrazone (CCCP, 1 μM); Rox (residual), after complex III inhibition by antimycin A (AA, 3 μM) (
Reduced and oxidized glutathione were quantified by the fluorimetric ortho-phthalaldehyde method (
Citrate synthase activity was measured to estimate the actual value of mitochondrial functional units (
Citrate synthase activity:
Where V (mL) is the reaction volume, Venz (mL) is the sample volume and εmM is the extinction coefficient of DTNB, which is 13.6 mol/L−1.cm−1 at 412 nm, L (cm) is the path length for absorbance measurement, which was 0.552 cm for the plates used.
CAT activity was measured by monitoring H2O2 disappearance at 230 nm (
SOD activity was determined by tetrazolium salt using superoxide radicals generated by xanthine oxidase and hypoxanthine monitored at 505 nm (Cayman Chemical, Ann Arbor, MI, USA). Approximately 15 mg biopsy was homogenized in 1 mL RIPA buffer at 4°C, centrifuged at 10,000 g for 20 min at 4°C, 50 μL of supernatant was used for the analysis. One SOD unit is defined as the amount of enzyme needed to promote 50% superoxide radical dismutation. Results were expressed as U/mg protein.
Lactate concentration was determined using a commercial kit (Labtest Diagnostica SA, Brazil). Approximately 15 mg of sample was homogenized in 1 mL RIPA buffer at 4°C, centrifuged at 10,000 g for 20 min at 4°C and 40 μL supernatant was used for the analysis. Results were expressed as mg lactate/mg protein.
Total RNA was isolated using the TRIzol reagent (Invitrogen, Grand Island, NY, USA), solubilized in RNase-free H2O, and quantified by measuring the optical density (OD) at 260 nm (NanoDrop spectrophotometer; Thermo Fisher Scientific, USA). For cDNA synthesis, 1.5 μg RNA was used. The mRNA transcript levels were quantified using the Eppendorf Realplex4 Mastercycler Instrument (Eppendorf) and SsOFast EvaGreen (BioRad), according to the manufacturer's instructions. PCR cycling conditions included 10 min at 95°C, followed by 40 cycles at 95°C for 15 s, 60°C for 1 min and 72°C for 60 s. Dissociation curve analysis confirmed that signals corresponded to unique amplicons. After normalization with β-actin, the relative expression of mRNAs was determined by the ΔΔCt method (
Primer sequences used for expression analysis of energy metabolism-related genes.
CAAGCCAAACCAACAACTTTATCTCT | CACACTTAAGGTTCGCTCAATAGTC | |
GTGCCATAGAGAACGAGCTG | ATCTCGGAAGTAAACCACAGC | |
CTCATCTCCGTTGTCCTCCA | ACCACACCCGCTCCAAT | |
ACCACACTCACCACACTCTG | CCTGCCAAAGCGATTAACAA | |
GGAGTTCTTTGCCCGTAA | ATGTTCTTGGTGACTGCTTC | |
GTGACCAAAGACGTGACCAA | CAACCCGCCCTTAGAGACT | |
GAACCACGAGAAGAACCAGA | CAGGCAGTCAGCGACAT | |
ATACAACCAAGGCAGTCATC | ACCTAAGACATTCATCCCGT | |
CCAGGCCAACGAAACAC | TGACCCCATTCACAGACC | |
TAAGTCTGGGATGAATGTGG | AGGTCGGTAGAGAATGGGAT | |
TCATCACTGGCTTGGGTC | GCACAAAGGAACACGGGA | |
CCTTGGTTACTTCGTCCCC | TGATGTGGCCTGAGACGAG | |
TGGCTATGGCAGGCAG | GACGGACGGTATCGGT | |
GGAATGGCTTGTGCTATC | TCGGAGTCTGGAGAAATAAG | |
CAAACTGCTCATCGTCTCA | ACTCTGCTACTCGTCAAAC | |
GAGTGCTGGGCTTCAAA | GAGTTTGCCGTAGTAGGGA | |
CACTTTCTACAATGAGCTGCG | CTGGATGGCTACGTACATGG |
The animals were perfused through the heart with 0.1M PBS (pH 7.4), followed by 4% paraformaldehyde (PFA) in PBS, pH 7.4. After perfusion, right hippocampi were quickly dissected, washed three times with PBS, and fixed in glutaraldehyde (2.5%) in cacodylate buffer (pH 7.4) for 48 h. Next, tissues were placed in 2% osmium tetroxide (OsO4) at room temperature for 2 h, washed with ddH2O, dehydrated in a graded series of ethanol (30 to 100%), infiltrated with propylene oxide, embedded in Embed 812 resin (EM Sciences), and polymerized for 72 h at 60°C. Thin sections were stained with uranyl acetate and Reynold's lead citrate for 10 min. Images were recorded on a Jeol JEM- 100 CXII transmission electron microscope. Mitochondrial counts were taken from a series of electron micrographs (20,000x) totaling ~600 μm2 for each experimental condition, within each 38.16 μm2 field of view. Mitochondrial area (μm2) was quantified using NIH-developed Image J software (Wayne Rasband; National Institutes of Health, Bethesda, MD; available at
Data were expressed as mean ± SEM. One-way analysis of variance followed by Tukey's multiple comparison tests was used to analyze the differences between groups. Differences were considered significant at p < 0.05, using GraphPad Prism®, USA.
Wistar and WAR were submitted to chronic stimulation and the seizure behaviors were categorized according to Rossetti et al. (
After hippocampus removal, oxygen consumption and redox state were monitored in the whole tissue (biopsy). Biopsies from WAR group presented higher oxygen consumption compared to Wistar rats in almost all respiratory states: NADH-linked (in the presence of exogenous NADH-linked substrates) and in respiratory states related to the maximum capacities of phosphorylation and electron transfer system, such as OXPHOS (in the presence of exogenous ADP), and non-coupled (ETS, in which the protonophore CCCP collapses the electrochemical H+ potential across the inner mitochondrial membrane, stimulating maximal electron transfer system and respiration) (
Mitochondrial respiration in brain biopsies from WAR and Wistar rats submitted to chronic stimulation (kindling) or not (naïve). Oxygen consumption in states of NADH-Linked, OXPHOS, LEAK, NON-COUPLED (ETS) in
Mitochondrial content and redox state in hippocampus biopsies from WAR and Wistar rats submitted to chronic stimulation (kindling) or not (naïve).
Mitochondrial density and morphology in hippocampus from WAR and Wistar rats (naïve) or WAR submitted to chronic stimulation (kindling).
Naïve WAR did not differ from naïve Wistar rats in mitochondrial respiratory parameters in cortex biopsies (
Mitochondrial content and redox state in cortex biopsies from WAR and Wistar rats submitted to chronic stimulation (kindling) or not (naïve).
Together, these results show that naïve WARs have an elevated mitochondrial metabolism/content and oxidative stress in hippocampus and cortex. In order to verify the relationship between mitochondrial energy metabolism and oxidative stress and seizure severity, we have treated WAR with 2,4-dinitrophenol (DNP) or N-acetylcysteine (NAC), two effective
A sound stimulus was performed before and after NAC or DNP treatments and cSI was measured. Afterwards, animals were divided into three groups, balancing the same seizure behaviors (cSI = 4.2). After the treatment period, the cSI were 7.25 ± 0.16 for WAR group, 7.00 ± 0.21 for WAR-DNP group, and 5.80 ± 0.57 for WAR-NAC group (
As expected, treatment with DNP increased oxygen consumption in LEAK state in the hippocampus and cortex (
Mitochondrial respiration in brain biopsies from WAR, and WAR treated with DNP or NAC. Oxygen consumption in states of NADH-Linked, OXPHOS, LEAK, NON-COUPLED (ETS) in
Mitochondrial content and redox state in hippocampus biopsies from WAR, and WAR treated with DNP or NAC.
Mitochondrial content and redox state in cortex from WAR, and WAR treated with DNP or NAC.
Since
Compared to Wistar rats, hippocampus of WAR presented elevated mRNA expression of glucose transporters isoform-3 (GLUT3, predominant in neurons), isoform-1 (GLUT1, predominant in astrocytes), and glycolytic enzymes Glucose-6-Phosphate Dehydrogenase (G6PD), Phosphofructokinase (PFK), Hexokinase 1 (HK1), and Pyruvate Kinase (PK) (
mRNA expression of genes related to energetic metabolism in hippocampus from Wistar, WAR, and WAR treated with DNP, or NAC. GLUT3 and GLUT1, Glucose Transporters; G6PD, Glucose-6-Phosphate dehydrogenase; HK1, Hexokinase 1; PK, Pyruvate kinase; PFK, Phosphofructokinase; EAAT1 and EAAT, transporters of excitatory amino acids; Na+/K+ ATPase, MCT1, MCT-2, and MCT-3/4, monocarboxylate transporters; and LDH-1 and LDH-5, lactate dehydrogenases. Mean ± SEM,
Together, these results suggest an accentuated transport and metabolism of glucose and lactate in hippocampus of WAR. Due to the near absence of mitochondria, accelerated glucose uptake followed by glycolysis in astrocytes culminates in higher lactate production, which is exported to neurons. The latter, in turn, convert lactate into pyruvate, in addition to the pyruvate provided by its own glycolysis, to fuel the high mitochondrial metabolism with acetyl-CoA. Higher mitochondrial content and phosphorylation capacity improves the supply of ATP to Na+/K+ ATPase pumps and, consequently, increase ROS production. NAC treatment, in WAR, reversed oxidative stress, and unlike DNP, reduced gene expression of almost all enzymes involved in glucose uptake and metabolism in neurons and astrocytes (
As found in hippocampus, cortex of WAR presented elevated mRNA expression of GLUT3, GLUT1, G6PD, PFK, HK1, PK, and EAAT1, which were reversed by DNP or NAC treatments, except for GLUT3 (
mRNA expression of genes related to energetic metabolism in cortex from Wistar, WAR, and WAR treated with DNP, or NAC. GLUT3 and GLUT1, Glucose Transporters; G6PD, Glucose-6-Phosphate dehydrogenase; HK1, Hexokinase 1; PK, Pyruvate kinase; PFK, Phosphofructokinase; EAAT1 and EAAT, transporters of excitatory amino acids; MCT1, MCT-2, and MCT-3/4, monocarboxylate transporters; and LDH-1 and LDH-5, lactate dehydrogenases. Mean ± SEM,
Our results revealed that in naïve (non-stimulated) WAR, the cerebral cortex and hippocampus have a highly efficient powerhouse, characterized by elevated mitochondrial density and/or activity, which leads to increased oxidized state and oxidative damage (
Although we have observed several profound alterations in mitochondrial physiology and biochemistry in naïve WARs, there is no effect of audiogenic kindling in WAR. Curiously, chronic auditory stimuli in Wistar rats induced alterations observed in naïve WAR, such as increased mitochondrial respiration at OXPHOS state and oxidative state. In addition, chronic auditory stimuli induced respiration at LEAK states in Wistar rats, an effect which increases energy expenditure and decreases mitochondrial ROS generation (
The
The metabolic effects of NAC observed are very similar to those obtained using ketogenic diet (low carbohydrates, high lipids and proteins) (
In a previous study of our group, we found the same mitochondrial and oxidative profile in the liver, soleus muscle and cardiac tissue of WAR (
In WAR, the cerebral cortex and hippocampus display elevated mitochondrial density and/or activity associated with oxidative damage, upregulated genes of glucose and lactate metabolisms, and overexpression of Na+/K+ ATPase (
Schematic figure of metabolism of neurons and astrocytes from hippocampus of WAR. ROS, reactive oxygen species; GLUT3 and GLUT1, Glucose Transporters; EAAT1 and EAAT, transporters of excitatory amino acids; PK, Pyruvate kinase; MCT1 and MCT-2, monocarboxylate transporters; and LDH-1 and LDH-5, lactate dehydrogenases.
The datasets generated for this study are available on request to the corresponding author.
The animal study was reviewed and approved by Ethics Committee on the use of animals at USP (CEUA, 011/2015).
CD conducted all the experiments. JO provided rats from the breeding colony. GF made primer sequences and corrected the English version. GF and JS conducted the experiments of respiration. JO and CD conducted the experiments regarding audiogenic kindling. RS-J and AC conducted the image experiments. CD, NG-C, and LA conceived the idea of the experimental design and analyzed all the results. CD, RS-J and NG-C wrote part of the paper. LA wrote the paper. All authors have approved the final version of the manuscript and agree to be accountable for all aspects of the work.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We thank Maria Dolores Seabra Ferreira and José Augusto Maulim from Multiuser Electron Microscopy Laboratory for the excellent technical assistance.