We initially analyzed HeLa hTR/hTERT cells, a previously established cell line in which telomeres were greatly elongated by the ectopic expression of both the RNA and of the reverse transcriptase subunits of human telomerase (Cristofari and Lingner, 2006). While in the parental cell line telomeres were on average 7 kb long, in hTR/hTERT cells, telomeres were up to 50 kb long, as determined by Terminal Restriction Fragment (TRF) analysis (Cristofari and Lingner, 2006). In Figure 1A the results of a fluorescent in situ hybridization experiment with a telomeric PNA probe are shown: the intense signals at all hTR/hTERT telomeres confirm that the transduced cell line has longer telomeres compared to its parental cell line. We then measured TERRA levels by northern blotting using a telomeric DNA probe (Figure 1B): the intensity of the autoradiographic signals in the hTR/hTERT and in the parental line were similar indicating that the total amount of TERRA was not influenced by telomere elongation. This result is in agreement with a recent finding from Farnung et al. (2012) who showed that, in a hTERT infected HeLa cell line in which telomeres were elongated, no substantial alteration in total TERRA levels was detectable.

Since it was previously shown that in tumor cell lines telomere length can be heterogeneous (Bryan et al., 1998; Savre-Train et al., 2000), we planned to measure TERRA levels and telomere length in a number of clones isolated from different human cell lines in search of a possible correlation between these two parameters.

We isolated single clones from five human cell lines. Four of these cell lines derive from different types of tumors: HeLa, from cervical carcinoma (Scherer et al., 1953); BRC-230, from primary ductal infiltrating breast carcinoma (Amadori et al., 1993); AKG and GK2, from a gastric cancer pleural and an ascitic effusion, respectively (Bertoni et al., 1998). One cell line, GM847, derives from human skin fibroblasts immortalized by SV40 (Bryan et al., 1995); in this line telomerase is inactive and telomeres are maintained through the ALT mechanism. At least seven clones were isolated from each cell line; the clones were expanded until about 10⁸ cells, RNA and genomic DNA were then extracted. For TRF analysis the DNA was digested with the restriction enzymes RsaI and HinfI, separated by electrophoresis, blotted to nylon membranes and hybridized to a telomeric DNA probe (Bertoni et al., 1994; Azzalin et al., 1997). Mean TRF length was measured using the densitometric method and the equation previously described (Kimura et al., 2010). Total TERRA levels were evaluated by northern blotting followed by densitometric analysis of signal intensities on the autoradiograms. In Figure 2A the results of TRF length analysis of the clones and of their respective parental cell lines is shown. In the eight HeLa clones the heterogeneity in TRF average length was remarkable, ranging from 2.8 to 8.3 kb, while TRF average length of the parental cell lines was approximately in the middle of this range. TRF length variation, comprised between 2.1 and 8.3 kb, was also observed among the clones derived from the GK2 gastric cancer cell line and, to some extent, among those derived from the other gastric cancer line, AKG (3.1–4.8 kb). In the seven clones isolated from the breast cancer cell line BRC-230 and in their parental cell line, TRFs were always rather short being ranging from 1.8 to 2.6 kb. In all the clones derived from the GM847 cell line, most TRFs were longer than 20 kb, however, shorter fragments, distributed over a wide range of sizes, were also detected; in the parental GM847 cell line a similar distribution of TRFs was previously described (Bryan et al., 1995). Great intracellular variation of telomere length is a typical feature of ALT cells (Henson et al., 2002) and seems to be a direct consequence of the recombination events involved in the maintenance of telomeres. The distribution of TRFs in the seven clones and in the GM847 parental line is similar (Figure 2A), however, we cannot exclude that some variation in the high molecular weight fragments may be present but is not detectable using conventional electrophoresis.

In Figure 2B the results of northern blotting experiments performed with total RNA from all the clones and from their respective parental cell lines are shown. TERRA levels were evaluated as ratio between signal intensity in each clone and in its parental cell line; these values showed inter-clonal heterogeneity, ranging from 34 to 167% in HeLa cells, from 15 to 83% in BRC-230, from 33 to 129% in AKG, and from 52 to 104% in GK2 cells (Figure 2B). Also the clones isolated from the ALT cell lines GM847 showed variable TERRA levels, ranging from 37 to 90%. In six of the HeLa clones, TERRA levels from specific chromosome ends were also evaluated by quantitative RT-PCR using primers for the 15q and the Xp/Yp subtelomeres; the amount of TERRA in each clone was normalized with respect to the value of the parental cell line. As shown in Figure 3, TERRA expression from the two subtelomeres follows a similar trend and inter-clonal variability was observed also with this type of analysis: TERRA levels in the different clones ranged from 0.45 to 4 times those of the parental cell line. The comparison between northern blot and qRT-PCR results, indicates that telomere specific expression does not always reflect total TERRA levels; for example in the clones 11 and 13 the total amount of TERRA is very similar (Figure 2B); however, while the expression of the XpYp subtelomere in the two clones is also similar, TERRA levels from the 15q subtelomere are about six times higher in clone 11 compared to clone 13. These results support the hypothesis that the regulation of TERRA expression is telomere specific, as previously suggested (Deng et al., 2012).

In Figure 4, the values of TRF length and total TERRA levels, are displayed in four scatter plots comprising data of HeLa, AKG, GK2, and BRC-230 clones, respectively. The plots show that the two parameters are independent. These results are in contrast with the previous hypothesis according to which long telomeres should correspond to low TERRA amounts. This hypothesis was initially postulated based on the observation that TERRA-like oligonucleotides inhibit human telomerase in vitro (Redon et al., 2010). However, as mentioned above, the effect of TERRA on telomerase activity was not confirmed in vivo (Farnung et al., 2012). A negative correlation between telomere length and TERRA level was also observed in ICF patients (Yehezkel et al., 2008) and in cell lines expressing exogenous telomerase or carrying naturally long telomeres (Arnoult et al., 2012).

In telomerase deficient mice and in cells derived from them, a clear correlation between telomere shortening and radiosensitivity was demonstrated (Goytisolo et al., 2000; Wong et al., 2000; Latre et al., 2003; Genescà et al., 2006); also in human cells in which telomerase is not expressed, such as primary fibroblasts (Drissi et al., 2011) and lymphocytes (McIlrath et al., 2001), an inverse correlation between telomere length and radiosensitivity was observed; whether this correlation holds true in telomerase positive cells is still a matter of debate. In a previous work, we showed that three telomerase immortalized fibroblast clones, characterized by different TRF length, had the same radiosensitivity (Zongaro et al., 2008), whereas radiosensitive murine lymphoma cells exhibited a sevenfold reduction in telomere length in comparison with their parental radioresistant cells (McIlrath et al., 2001). To gain new insight into this matter and to elucidate whether TERRA expression may be related to radiosensitivity, we evaluated the sensitivity to γ-irradiation in the cellular systems described above.

As shown in Figure 5A, the survival curve of HeLa hTR/hTERT cells is nearly identical to the one of the HeLa parental cell line. Therefore, in a telomerase positive background, telomere elongation due to telomerase hyper-expression does not make cells more resistant to ionizing radiations. We then measured the survival to γ-irradiation of five HeLa, five GM847 subclones, and their parental cell lines. In the five HeLa derived clones, although telomere length and TERRA expression levels were variable (Figure 2), the sensitivity to ionizing radiation was similar. The survival curves of the GM847 cell line and its five clones are also similar (Figure 5B) suggesting that, in ALT cells as well as in telomerase positive cells, TERRA expression does not influence radiation sensitivity. However, GM847 cells are more sensitive to irradiation (10% survival between 2 and 4 Gy) than HeLa cells (10% survival at 5 Gy); this relative hypersensitivity may be related to the ALT phenotype.

In this work we used six human cell lines: HeLa, human cervical carcinoma; hTR/hTERT, HeLa cells transduced with retroviral vectors encoding hTR and hTERT (Cristofari and Lingner, 2006); BRC-230, cell line established from surgical material of primary ductal infiltrating breast carcinoma (Amadori et al., 1993); AKG and GK2, two gastric cancer cell lines established from a pleural and an ascitic effusion, respectively (Bertoni et al., 1998); GM847, an SV40 immortalized human skin fibroblasts cell line. All cell lines were routinely cultured in 5% CO₂ at 37°C. HeLa, HeLa hTR/hTERT, and GM847 cell lines were propagated in Dulbecco’s Modified Eagle’s Media (Euroclone), supplemented with 10% Fetal Bovine Serum (Euroclone), 1% l-glutamine (Sigma), 1% Penicillin–Streptomycin (Sigma) and 1% non-essential amino acids (Euroclone). For BRC-230, AKG and GK2 cell lines the culture medium was composed of a 1:1 mixture of Dulbecco’s Modified Eagle’s Medium (Euroclone) and of HAM’S Nutrient Mixture F12 (Euroclone), supplemented with 10% Fetal Bovine Serum (Euroclone), 1% l-glutamine (Sigma), 1% Penicillin–Streptomycin (Sigma), and insulin 10 μg/ml (Sigma).

RNA extraction from whole cells was performed using TRIzol reagent (Invitrogen) according to manufacture’s protocol. To eliminate any DNA contaminations, the RNA was treated twice with RNase-free DNase I (Promega), and then purified with the RNA Clean and Concentration kit (ZYMO Research). For northern blots, 10 μg of RNA were electrophoresed in 1.2% formaldehyde agarose gels and blotted to nylon membranes (Amersham HybondTM-N, GE Healthcare). The membranes were hybridized for 18 h in Church buffer containing ³²P-α[dCTP]-labeled probes at 58°C. The strand-specific telomeric probe used to detect total TERRA was described previously (Azzalin et al., 2007). After hybridization, the membranes were washed twice with a 2× SSC, 0.5% SDS solution for 15 min at 58°C and once with a 0.2× SSC, 0.5% SDS solution for 30 min at 58°C. Radioactive signals were detected using a phosphorimager (Cyclone, Packard).

Total RNA purified as described above was reverse transcribed using the RevertAid Premium First Strand cDNA Synthesis Kit (Fermentas) using the primers: (CCCTAA)₅ at a final concentration of 0.4 μM for TERRA molecules and GGAACTCGAGTTTGCGTGTCATCCTTGCGC at a final concentration of 0.04 μM for U6 snRNA, used as a control.

We PCR amplified 2 μl of reverse transcription reaction using GoTaq qPCR Master Mix (Promega), in a final volume of 25 μl. To amplify TERRA molecules, we used the following pairs of primers: CAGCGAGATTCTCCCAAGCTAAG and AACCCTAACCACATGAGCAACG for TERRA derived from the 15q subtelomere, GCAAAGAGTGAAAGAACGAAGCTT and CCCTCTGAAAGTGGACCAATCA for TERRA derived from the XpYp subtelomere. As a normalization control, we amplified U6 snRNA using GGAATCTAGAACATATACTAAAATTGGAAC and GGAACTCGAGTTTGCGTGTCATCCTTGCGC as primers. The following PCR profile was used: 5 min at 95°C, 45 cycles at 95°C for 10 s and 60°C for 30 s. Data were analyzed with the Opticon^® Monitor 3 software.

Genomic DNA was extracted with phenol/chloroform standard method and purified with Proteinase K and Ribonuclease A (Sigma). For TRF length measurement, 10 μg of high molecular weight genomic DNA were digested with the RsaI and HinfI restriction enzymes (Fermentas). After electrophoresis in 0.6% agarose gel, DNA was denatured and transferred to nylon membranes (Amersham HybondTM-N, GE Healthcare). The membranes were hybridized at 64°C for 18 h in Church buffer containing a ³²P-α[dCTP]-labeled probe generated by random primer labeling of a mixture of 1–5 Kb long telomeric DNA fragments, prepared as previously described (Bertoni et al., 1994; Azzalin et al., 1997). After hybridization, the membranes were washed twice in 2× SSC, 0.5% SDS for 15 min at 64°C and once in 0.2× SSC, 0.5% SDS for 30 min at 64°C. Radioactive signals were detected using a phosphorimager (Cyclone, Packard).

We measured TERRA amounts quantifying northern blotting signals and 18S rRNA ethidium bromide-stained bands with the software ImageJ. TERRA signals were normalized against the intensity of 18S rRNA bands. For every cell line the parental line were arbitrarily set at 100%. Average telomere length was determined by comparing the molecular weight of the telomeric signal with a calibration curve based on the molecular weight marker, as previously described (Kimura et al., 2010).

PNA-FISH was carried out as previously described (Ruiz-Herrera et al., 2011). Briefly, metaphase spreads were denatured at 72°C for 3 min and then hybridized with a cy3-conjugated PNA (CCCTAA)₅ probe (Panagene) in 10 mM TRIS-HCl pH 7.2, 70% formamide and 0.5% blocking reagent (Roche). Post-hybridization washes were carried out twice for 15 min in 70% formamide, 10 mM TRIS-HCl, 0.1% BSA at pH 7.5, and then three times for 5 min in TBS buffer (0.1 M TRIS-HCl, 0.15 M NaCl, 0.08% Tween 20 pH 7.5). Chromosomes were dehydrated in ethanol, air dried and counterstained with DAPI 0.2 mg/ml. Image were acquired using a ZEISS Axioplan fluorescence microscope equipped with a Photometric CCD camera and processed with IP-Lab software.

Exponentially growing cells were trypsinized, resuspended in complete medium and irradiated. Irradiation was carried out using a ⁶⁰Co-ray source at a dose rate of 1.3 Gy/min. After irradiation, the cells were diluted and plated in 100-mm dishes (500 cells/plate). After 10 days, colonies were fixed, stained and the number of colonies with more than 50 cells was counted.