Edited by: Sergio A. Gradilone, University of Minnesota Twin Cities, United States
Reviewed by: Gianfranco Danilo Alpini, Indiana University, United States; Adrian Mansini, Rush University, United States
*Correspondence: Zhaolin Zeng,
†These authors have contributed equally to this work
This article was submitted to Cancer Molecular Targets and Therapeutics, a section of the journal Frontiers in Oncology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Our previous study observed that long non-coding RNA PKD2-2-3 (lnc-PKD2-2-3) is related to advanced tumor features and worse prognosis in cholangiocarcinoma (CCA). Then, this study aimed to further explore the linkage between lnc-PKD2-2-3, miR-328, and GPAM, as well as their effects on regulating CCA viability, mobility, and chemosensitivity.
Lnc-PKD2-2-3, miR-328, and GPAM expression in 30 pairs of CCA tumor and adjacent tissues, as well as in CCA cell lines, were determined. Two CCA cell lines (HuCCT1 and TFK1) were transfected by lnc-PKD2-2-3 overexpression plasmid, lnc-PKD2-2-3 siRNA, miR-328 inhibitor, and GPAM siRNA alone or in combination, followed by cell proliferation, apoptosis, invasion, and 5-FU chemosensitivity detection. Besides, xenograft mice were established for validation.
Lnc-PKD2-2-3 and GPAM were higher, whereas miR-328 was lower in CCA tissues versus adjacent tissues and also in CCA cell lines versus control cells; meanwhile, they were correlated with each other (all
Lnc-PKD2-2-3/miR-328/GPAM ceRNA network promotes CCA proliferation, invasion, and 5-FU chemoresistance.
Cholangiocarcinoma (CCA), although a relatively low-prevalence malignancy of the hepatobiliary system, is one of the deadliest cancers in the world (
Long non-coding RNA (lncRNA), as a newly discovered type of RNA in the current century with a length of more than 200 bp but less protein-coding ability, has been discovered to be closely involved in the pathogenesis of various cancers (
Our previous study identified a total of 4,223 upregulated and 4,596 downregulated lncRNAs in CCA tissues versus adjacent non-tumor tissues
A total of 30 primary CCA patients who underwent tumor resection from February 2019 to July 2021 were consecutively enrolled in this study, and the detailed eligible criteria were shown in our previous study (
The lncRNA and mRNA microarray data derived from our previous study was further analyzed here (
Human CCA cell lines, namely, HuH28, HuCCT1, RBE, and TFK1, were purchased from RIKEN BioResource Research Center (Koyadai, Japan), and then human normal biliary epithelial cells (HIBEpiC) were purchased from Sciencell Research Laboratories (Carlsbad, USA). The 10% fetal bovine (FBS, Gibco, USA) containing RPMI 1640 Medium (Gibco, USA) or epithelial cell medium (Sciencell, USA) was applied to culture CCA cells or HIBEpiC. Cell culture was performed in a 95% air/5% CO2 environment at 37°C.
The lnc-PKD2-2-3 or negative control (NC) DNA fragment was cloned into the pEX-2 vector (Genepharma, China) to construct an overexpression plasmid. NC small interference RNA (siRNA), lnc-PKD2-2-3 siRNA, GPAM siRNA, NC inhibitor, and miR-328 inhibitor were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). In the presence of Lipofectamine™ 2000 Transfection Reagent (Invitrogen, USA), 0.8 μg overexpression plasmid, 0.5 pM siRNA, or 0.5 pM inhibitor was transfected into HuCCT1 or TFK1 cells alone or together. The normally cultured cells were used as a control.
At 0, 24, 48, and 72 hours (h) after transfection, the cell proliferation was analyzed by cell counting kit-8 (CCK-8) (Beyotime, China). Cells were seeded in a 96-well plate with the amount of 1 × 104 in 10% FBS-containing RPMI-1640. Then 10 μl of CCK-8 reagent mixed with 100 μl of FBS-free RPMI-1640 was added and incubated with the cells at 37°C for 2 h. Finally, a microplate reader (BioTek, USA) was used to read optical density (OD) values under 450 nm.
At 48 h after transfection, the TUNEL Apoptosis Assay Kit (Beyotime, China) was applied to assess cell apoptosis. In brief, first the cells were fixed at room temperature with 10% neutral formalin (Sangon, China) for 30 minutes (min). Secondly, the cells were incubated with TUNEL working solution in the dark at 37°C for 1 h. Thirdly, the images were captured using an inverted fluorescence microscope (Motic, China).
Transwell was conducted to measure invasion ability at 48 h after transfection. The transwell insert was coated with Matrigel Basement Membrane Matrix (BD, USA) at 37°C for 1 h. The cells (5 × 104) in FBS-free RPMI-1640 were added to the insert, which was plated into a 24-well plate. The on-invasive cells were wiped out after being incubated at 37°C for 24 h, while the invasive cells were fixed and stained at room temperature. An inverted microscope (Motic, China) was used to take pictures.
For clinical samples, the RT-qPCR was performed after sample acquirement; for cell samples, the RT-qPCR was performed 48 h after transfection. The RNA was extracted with Beyozol (Beyotime, China). The RNA with a concentration of 1 μg was transcribed by the RT reagent Kit (Takara, Japan). The thermal cycle of reverse transcription was as follows: 37°C for 15 min, 85°C for 5 seconds (s). The qPCR was completed by TB Green® Fast qPCR Mix (Takara, Japan) and the following thermal cycles were conducted: 95°C for 30 s, 1 cycle; 95°C for 5 s, and 61°C for 15 s, 40 cycles. The results were calculated using the 2−ΔΔCt method. The primer sequences (5’->3’) were as follows: lnc-PKD2-2-3, forward, AGGCTGATTCTGGAAGTTCTGAG, reverse, AGGAGATTCTGCTTCTGAGATGG; GPAM, forward, AGAATGAGAGCCTGTGGAGTGTA, reverse, TCTACCTTCATCAGCAGCATCAC; GAPDH, forward, GAGTCCACTGGCGTCTTCAC, reverse, ATCTTGAGGCTGTTGTCATACTTCT; miR-328, forward, GGGGGCAGGAGGGGC, reverse, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCTGA; U6, forward, CTTCGGCAGCACATATACTA, reverse, AATATGGAACGCTTCACGAA.
At 48 h after transfection, RIPA lysis buffer (Beyotime, China) was utilized to lyse the cells. The total protein was then quantified with a BCA kit (Sangon, China). The 20 μg of protein was separated by 4–20% precast gel (Willget, China), and then transferred to a nitrocellulose membrane (PALL, USA). The membrane was then blocked by 3% skim milk (Beyotime, China) at 37°C for 45 min, followed by incubation with GPAM antibody (1:100) (Invitrogen, USA) or GAPDH antibody (1:5,000) (Invitrogen, USA) at 4°C overnight. After being incubated with goat anti-rabbit antibody (1:2,000) (Beyotime, China) at 37°C for 90 min, the membrane was incubated with ECL substrate (Beyotime, China), and exposed with X-ray film (Kodak, USA). Quantification of protein bands was performed by ImageJ 1.8.0 (NIH, USA).
Drug sensitivity was measured 48 h after transfection. The 4 × 104 cells were seeded in a 96-well plate with 10% FBS-containing RPMI-1640. Then, 200 ng/ml of 5-fluorouracil (5-FU) (MCE, China) was cultured with cells for another 24, 48, and 72 h. For cell viability measurement, 10 μl CCK-8 reagent in 100 μl RPMI-1640 was added and cultured with cells for 2 h at 37°C. Finally, the OD value at 450 nm was measured by a microplate reader. The relative cell viability when setting the control group as the reference is calculated as follows: cell viability of each group/cell viability of the control group × 100%. Relative cell viability (5-FU/No treatment) when setting no treatment as a reference was also calculated as follows: cell viability under 5-FU/cell viability with no treatment × 100%.
The miR-328 mimic and NC mimic were designed and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The lnc-PKD2-2-3 wild type (WT) plasmid, lnc-PKD2-2-3 mutant type (MT) plasmid, GPAM WT plasmid, and GPAM MT plasmid were constructed with the pGL6 vector (Beyotime, China). For the binding detection of lnc-PKD2-2-3 and miR-328, 0.8 μg of lnc-PKD2-2-3 WT/MT plasmid and 0.5 pM of miR-328/NC mimic were co-transfected into HuCCT1/TFK1/293T cells (ATCC, USA) and incubated for 48 h. Then, 293T cells were lysed and incubated with a Luciferase Reporter Gene Assay Kit (Beyotime, China). In the end, the luciferase activity was measured by a fluorescence microplate reader (BioTek, USA). For the binding detection of miR-328 and GPAM, 0.8 μg of GPAM WT/MT plasmid and 0.5 pM of miR-328/NC mimic were co-transfected into 293T cells. After 48 h, the cell lysis and luciferase activity detection were completed as mentioned above.
The animal experimental procedures were conducted in accordance with the guidelines of our institution. The procedures were approved by the animal ethic committee of our institution. Nude mice were obtained from SLAC (Shanghai, China) and maintained in a 12 h light/dark, specific pathogen free condition. The HuCCT1 cells were infected with scramble, lnc-PKD2-2-3 overexpression, and lnc-PKD-2-3 knockdown lentivirus (Genepharma, China) to generate scramble, oeLnc, and shLnc cells, respectively. The scramble, oeLnc, and shLnc cells were inoculated subcutaneously into the dorsal flanks of mice (N = 6 for each group) with an amount of 2.5 × 106. The tumor sizes were measured every week for 4 weeks and calculated using the formula: volume = length × width2/2. The mice were sacrificed at 4 weeks after cell implantation. The tumors were harvested and weighed. Each tumor was split into two, and stored in −80°C or embedded in paraffin. The paraffin embedded tumors were cut into 4 μm sections for hematoxylin–eosin (HE), TdT-mediated dUTP-biotin nick end labeling (TUNEL), and immunohistochemistry (IHC) staining, with the involvement of HE staining kit (Sangon, China), TUNEL staining kit (Beyotime, China), and GPAM antibody (1:40) (Invitrogen, USA). The frozen tumors were lysed for RT-qPCR and western blot.
In the aspect of clinical analysis, data were shown as count (%) or median (interquartile range (IQR)); comparison between two groups or among three groups was determined by Wilcoxon rank sum test or Kruskal–Wallis test, correlation between two variables was detected by spearman test. In terms of experimental analysis, data were shown as mean ± standard deviation; comparison among groups was determined by one-way ANOVA followed by Tukey’s or Dunnett’s multiple comparisons test. GraphPad Software 7.0 (GraphPad Int., USA) or SPSS software (IBM, USA) was adopted to complete data analysis. Statistical significance was defined as
Further bioinformatic analysis using our previous data (
Measurement of lnc-PKD2-2-3, miR-328 and GPAM in CCA patients. Identification of lnc-PKD2-2-3/miR-328/GPAM network related to CCA pathology
Tumor lnc-PKD2-2-3 positively correlated with poor differentiation and N stage (both
Correlation of lnc-PKD2-2-3, miR-328 and GPAM with clinical features of CCA patients.
Items | Patients, n (%)(N = 30) | Lnc-PKD2-2-3, median (IQR) |
|
MiR-328, median (IQR) |
|
GPAM, median (IQR) |
|
---|---|---|---|---|---|---|---|
Age (years) | 0.601 | 0.706 | 0.917 | ||||
≤60 | 17 (56.7) | 2.850 (1.684-4.551) | 0.513 (0.334-0.867) | 3.058 (2.031-4.068) | |||
>60 | 13 (43.3) | 2.038 (1.548-3.677) | 0.616 (0.416-0.808) | 3.075 (1.727-4.876) | |||
Gender | 0.836 | 0.092 | 0.097 | ||||
Female | 6 (20.0) | 2.552 (1.049-6.923) | 0.396 (0.292-0.615) | 4.792 (2.065-6.661) | |||
Male | 24 (80.0) | 2.499 (1.650-4.123) | 0.631 (0.432-0.893) | 2.991 (1.682-3.767) | |||
Smoke | 0.917 | 0.384 | 0.520 | ||||
No | 15 (50.0) | 2.460 (1.630-4.736) | 0.562 (0.424-0.896) | 3.616 (2.100-3.905) | |||
Yes | 15 (50.0) | 2.537 (1.465-4.366) | 0.576 (0.311-0.732) | 2.923 (1.637-4.310) | |||
Drink | 0.253 | 0.379 | 0.202 | ||||
No | 20 (66.7) | 2.571 (1.731-4.644) | 0.569 (0.402-0.732) | 3.632 (1.887-4.932) | |||
Yes | 10 (33.3) | 2.350 (1.036-3.535) | 0.736 (0.345-1.127) | 2.685 (1.813-3.454) | |||
HBV infection | 0.914 | 0.322 | 0.747 | ||||
No | 19 (63.3) | 2.537 (1.630-4.736) | 0.616 (0.424-0.883) | 3.075 (2.100-3.784) | |||
Yes | 11 (36.7) | 2.500 (1.465-4.366) | 0.488 (0.311-0.732) | 3.058 (1.525-5.274) | |||
ECOG PS | 0.220 | 0.078 | 0.107 | ||||
0 | 19 (63.3) | 2.296 (1.465-3.392) | 0.645 (0.395-0.983) | 2.832 (1.637-3.784) | |||
1 or 2 | 11 (36.7) | 2.850 (2.460-4.736) | 0.454 (0.236-0.680) | 3.648 (2.538-5.968) | |||
Tumor site | 0.530 | 0.620 | 0.825 | ||||
Intrahepatic | 8 (26.7) | 1.918 (1.289-3.159) | 0.520 (0.322-0.824) | 3.395 (2.055-3.878) | |||
Perihilar | 14 (46.6) | 2.571 (1.647-5.176) | 0.549 (0.390-0.772) | 3.014 (1.590-5.976) | |||
Distal | 8 (26.7) | 2.730 (1.335-4.074) | 0.647 (0.463-1.044) | 2.991 (2.210-3.640) | |||
Differentiation | 0.021 | 0.145 | 0.343 | ||||
Well | 6 (20.0) | 1.501 (0.895-2.496) | 0.782 (0.538-1.291) | 2.954 (1.389-4.165) | |||
Moderate | 13 (43.3) | 2.537 (1.753-4.064) | 0.562 (0.385-0.732) | 3.616 (1.727-3.845) | |||
Poor | 11 (36.7) | 2.850 (2.296-5.588) | 0.454 (0.236-0.983) | 3.058 (2.538-5.968) | |||
T stage | 0.061 | 0.040 | 0.025 | ||||
T1 ~ T2 | 18 (60.0) | 2.167 (1.323-3.109) | 0.706 (0.475-0.886) | 2.218 (1.590-3.843) | |||
T3 ~ T4 | 12 (40.0) | 3.121 (2.496-4.741) | 0.439 (0.241-0.573) | 3.700 (2.957-4.932) | |||
N stage | 0.006 | 0.016 | 0.021 | ||||
N0 | 19 (63.3) | 1.798 (1.175-2.610) | 0.680 (0.488-0.983) | 2.588 (1.637-3.714) | |||
N1 ~ N2 | 11 (36.7) | 3.197 (2.604-4.736) | 0.436 (0.236-0.576) | 3.795 (3.058-5.968) | |||
TNM stage | 0.055 | 0.010 | 0.020 | ||||
I ~ II | 17 (56.7) | 2.038 (1.274-2.904) | 0.732 (0.505-0.940) | 2.336 (1.581-3.681) | |||
III ~ IV | 13 (43.3) | 3.079 (2.480-4.740) | 0.436 (0.246-0.569) | 3.784 (2.945-5.621) |
CCA, cholangiocarcinoma; Lnc, long non-coding; IQR, interquartile range; miR, microRNA; GPAM, glycerol-3-phosphate acyltransferase; HBV, hepatitis B virus; ECOG PS, Eastern Cooperative Oncology Group Performance Status.
The expression of lnc-PKD2-2-3, miR-328, and GPAM was further validated in CCA cell lines to uncover their potential engagement in CCA. It was observed that lnc-PKD2-2-3 was increased in multiple CCA cell lines compared to the control cell line (most
Measurement of lnc-PKD2-2-3, miR-328 and GPAM in CCA cell lines. Comparison of lnc-PKD2-2-3
The lnc-PKD2-2-3 was determined to be greatly modified after transfection in both HuCCT1 and TFK1 cells (all
Effect of lnc-PKD2-2-3 on cell proliferation, apoptosis, invasion and miR-328 in CCA cell lines. Lnc-PKD2-2-3 expression
Additionally, lnc-PKD2-2-3 negatively regulated miR-328 in both HuCCT1 and TFK1 cells (all
The miR-328 inhibitor was then transfected into HuCCT1 and TFK1 cells as well. Lnc-PKD2-2-3 was determined to be largely decreased after transfection of lnc-PKD2-2-3 siRNA but not miR-328 inhibitor; meanwhile, miR-328 was determined to be greatly reduced after transfection of miR-328 inhibitor in both HuCCT1 and TFK1 cells (
Effect of miR-328 knockdown on cell proliferation, apoptosis, and invasion in CCA cell lines. Lnc-PKD2-2-3 expression
Lnc-PKD2-2-3 knockdown decreased GPAM mRNA and protein expressions; while miR-328 knockdown increased GPAM mRNA and protein expressions, as well as weakened the regulatory effect of lnc-PKD2-2-3 knockdown on GPAM mRNA and protein expressions (all
Effect of lnc-PKD2-2-3 knockdown and miR-328 knockdown on GPAM in CCA cell lines. GPAM expression among groups after transfection
Inhibition of miR-328 was determined to be largely lowered after transfection of miR-328 inhibitor (
miR-328 and GPAM expressions after their siRNA/inhibitor transfection in CCA cell lines. miR-328 expression
Effect of GPAM knockdown on cell proliferation, apoptosis, and invasion in CCA cell lines. Cell proliferation
Since our previous study observed that lnc-PKD2-2-3 modified CCA sensitivity to 5-FU (
Effect of lnc-PKD2-2-3/miR-328/GPAM network on 5-FU sensitivity in CCA cell lines. Relative cell viability (when setting control group as reference) among groups after transfection at 24, 48, and 72 h in HuCCT1 cells
Subsequently, the relative cell viability when setting no treatment as reference (5-FU/No treatment) was also calculated, and it was observed that relative cell viability (5-FU/No treatment) was reduced by lnc-PKD2-2-3 knockdown at 24, 48, and 72 h, and decreased by GPAM knockdown at 24, 48, and 72 h, while it was elevated by miR-328 knockdown at 48 and 72 h (all
Benefiting from the advancement of high-throughput sequencing and microarray technology, tens of thousands of lncRNAs have been discovered (
Based on the importance of lncRNAs engaged in CCA and its potential application for CCA treatment, our previous study applied microarray assay and RT-qPCR validation to explore the comprehensive lncRNA expression profile related to CCA (
Inspired by our previous study on the regulation of lnc-PKD2-2-3 on CCA stemness and drug resistance (
To further identify the deep intercorrelation of lnc-PKD2-2-3 with miR-328 and GPAM at the molecule level, subsequent rescue experiments and luciferase gene reporter assays were performed in our present study. Then it was observed that lnc-PKD2-2-3 promoted CCA proliferation and invasion by targeting miR-328; miR-328 regulated CCA proliferation and invasion by targeting GPAM; furthermore, lnc-PKD2-2-3 directly bound miR-328 and miR-328 directly bound GPAM. These suggest the ceRNA network of lnc-PKD2-2-3/miR-328/GPAM is closely engaged in CCA progression and 5-FU sensitivity. The possible reasons derived are from (1) the anti-oncogene role of miR-328
Furthermore, to validate the role of lnc-PKD2-2-3 in regulating CCA progression, xenograft mouse experiments were performed. Then it was observed that lnc-PKD2-2-3 overexpression promoted tumor volume and weight but repressed tumor apoptosis in xenograft mice; meanwhile, it increased GPAM expression but decreased miR-328 expression. Conversely, lnc-PKD2-2-3 knockdown exhibited the opposite effects. These data further confirmed our findings.
In conclusion, the lnc-PKD2-2-3/miR-328/GPAM ceRNA network promotes CCA proliferation, invasion, and chemoresistance, which could serve as a treatment target for CCA.
The original contributions presented in the study are included in the article/
The studies involving human participants were reviewed and approved by The 2nd Affiliated Hospital of Harbin Medical University. The patients/participants provided their written informed consent to participate in this study.
ZZ conceived and designed the study. LZ and DM collected and analyzed the data. FL, GQ, and DS prepared the figures and tables. LZ, DM, FL, GQ, and DS wrote the manuscript. ZZ revised the manuscript. All authors contributed to the article and approved the submitted version.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
The Supplementary Material for this article can be found online at:
Luciferase reporter gene assay in CCA cell lines. Relative activity of luciferase gene reporter assay of lnc-PKD2-2-3 and miR-328 in HuCCT1 cells