Edited by: Ajay Sharma, Chapman University, United States
Reviewed by: Sundararajan Jayaraman, University of Illinois at Chicago, United States; Christopher Michael Reilly, Edward Via College of Osteopathic Medicine, United States
This article was submitted to Experimental Pharmacology and Drug Discovery, a section of the journal Frontiers in Pharmacology
†These authors have contributed equally to this work.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Dendritic cells (DCs) are important to the immune system and are frequently recruited to hypoxic regions, especially during acute myocardial infarction (AMI). Emerging data indicate that histone deacetylase (HDAC) inhibitors possess immunomodulatory functions. We previously showed in a rat model of AMI that the HDAC inhibitor TSA improved tissue repair, and this was accompanied by increased DC infiltration in the infarct region, suggesting an important role of TSA in modulating DC functions. To study the potential modulatory effect of TSA on DCs, we exploited an
Dendritic cells (DCs) are prominent antigen-presenting cells with immunoregulatory functions that depend on maturation and activation, as indicated by the expression of costimulatory molecules (e.g., CD80 and CD86; Albert et al.,
Trichostatin A (TSA) is a broad-range HDAC inhibitor that inhibits class I and II HDACs. Preclinical studies show that TSA has potent anticancer activity and despite investigations in cancerous cells, its effects on immune function and DCs are not well known. DCs are frequently recruited to hypoxic regions, especially during acute myocardial infarction (AMI). Our unpublished data showed TSA could increase DCs at the infarct border region, and TSA-treated rats had improved tissue morphology after AMI. We previously showed in a rat model of AMI that TSA improved tissue repair accompanied by increased DC infiltration in the infarct region, suggesting an important role of TSA in modulating DC functions. Thus, we studied the potential modulatory effect of TSA on DC functions using an
DC2.4, a murine bone marrow-derived immortalized dendritic cell lines were purchased from Shanghai Huiying Biological Technology co., LTD (China). Cells were grown in PRMI-1640 medium (Gibco Company, city and state are required) supplemented with 10% fetal bovine serum (Biological Industries, city and state are required), penicillin (100 U/ml) and streptomycin (100 μg/ml). Cells were passaged at 80% confluence.
For hypoxia, cells were grown in a three-gas incubator (SANYO) with 1% oxygen, 5% CO2, and 94% nitrogen. For glucose deprivation condition, PRMI-1640 medium without glucose (#11879020, Gibco) was used.
The HDAC inhibitor Trichostatin A (TSA) was purchased from APEXBIO Technology (#A8183,USA).
Proliferating DC2.4 cells were seeded in 96-well plates at 20,000 cells/well and were grown overnight. Then cells were treated as indicated for 4 h. MTT assay was performed by adding 20 μl MTT (5 mg/ml, PBS) and 2 h later, supernatants were removed and 200 μl DMSO was added. Absorption was measured at 570 nm with a microplate reader (Tecan, Maennerdorf, Switzerland).
DC2.4 cells with indicated treatments were collected and fixed with 4% paraformaldehyde for 10 min at RT. Cells were the resuspended in PBS containing 0.5% BSA, followed by surface staining with FITC anti-mouse CD80 (1:20 in PBS, #104705, BioLegend, San Diego, CA) and anti-mouse CD86 (1:50 in PBS, #105007, BioLegend, San Diego, CA) antibodies at 4°C in the dark. Cells were then quantified using flow cytometry using a BD Accuri C6 Plus (BD, Mountain View, CA) and analyzed using FlowJo software (Tree Star, Inc., USA).
FITC-dextran was used as an endocytic substrate for dendritic cells.DC2.4 cells were treated as indicated. Then cells were collected and resuspended in PBS containing 1 mg/ml FITC-dextran at 37°C for 1 h. Negative control cells were incubated with FITC-dextran at 4°C. Signals from FITC channel were then detected using flow cytometry.
Confluent DC2.4 cells were scratched using a pipette tip and treated as indicated. After 16 h, cells were fixed with 4% formaldehyde and images were taken using an Olympus IX53 inverted microscope (Olympus, Japan). Evaluation of pictures was made using Image J software (NIH, city and state are required). Migration was quantified as the ratio of the area covered with cells and the area of the cell-free wound.
DC2.4 cells were treated pre-treated with TSA for 4 h. Then cells were grown under indicated conditions and 24 h later, cell supernatant was collected, centrifuged at 3,000 rpm for 10 min. Then IL-1β, IL-10, IL-12, and TGF-β were measured using mouse ELISA kits (Bioss, Beijing, China). ATP and lactate was measured with kits from Camacho (Shanghai) Biological Technology Co. Ltd.
Plasmids coding mouse SRSF3 and PKM2 shRNA were purchased from Changchun Sai Xin Biological technology co, LTD. DNA transfection were performed using Lipofectamine® 2000 Reagent according to the manufacturer's protocol. Briefly, 1 μl DNA plus 3 μl transfection reagent were mixed in 500 μl medium to form a DNA complex. Then, 15 min later, the mixture was added to cells and 4 h later, supernatants were replaced with fresh media and the cells were grown for 24 h before experiments were performed.
Total RNA isolation was performed using Trizol® Reagent according to the manufacturer's protocol. Briefly, after treatment, cells were washed twice with ice cold PBS. Then, 1 ml Trizol reagent was added and 5 min later, samples were transferred into an RNA-free Eppendorf tube and mixed with 200 μl chloroform. After centrifugation (12,000 rpm, 15 min), supernatants were transferred to a new set of tubes and RNA was precipitated with isopropanol and resuspended in RNA-free water.
Total RNA (1,000 ng) was reverse transcribed into cDNA using TransScript First-Strand cDNA Synthesis SuperMix (Transgen, Beijing, China). Reactions were carried out at 42°C for 30 min and were terminated at 85°C for 5 min.
Semi-quantitative real-time PCR was performed on an ABI 7300 Real-Time PCR system using TransScript® II Green One-Step qRT-PCR SuperMix. The following primers were used.
PKM2 | GTCTGGAGAAACAGCCAAGG | CGGAGTTCCTCGAATAGCTG |
PKM1 | GTCTGGAGAAACAGCCAAGG | TCTTCAAACAGCAGACGGTG |
GAPDH | AGCTTGTCATCAACGGGAAG | TTTGATGTTAGTGGGGTCTCG |
HIF-1α | ACCTTCATCGGAAACTCCAAAG | CTGTTAGGCTGGGAAAAGTTAGG |
Ldha | GCTCCCCAGAACAAGATTACAG | TCGCCCTTGAGTTTGTCTTC |
HK2 | TGATCGCCTGCTTATTCACGG | AACCGCCTAGAAATCTCCAGA |
Tpi1 | TGAGCCGTTTCCACCGCCCTATTA | GCTCCAACCATGAGTTTCCAGCCC |
SRSF3 | TCGTCGTCCTCGAGATGATT | CTCCTTCTTGGGGATCTGC |
Fluorescence was analyzed using ABI 7300 system software. Calculation of relative mRNA quantity was done according to methods published by Pfaffl (
Immunoblotting was performed as described in the literature (Liebl et al.,
Experiments were performed at least 3 times in duplicates/triplicates. Data are presented as mean ± S.E.M. To compare the differences of more than three groups, one-way ANOVA followed by Tukey's
We first performed MTT assay to determine suitable durations for glucose and oxygen deprivation and TSA dosages. As shown in Figure
TSA improves DC2.4 cell survival under glucose and oxygen deprivation. DC2.4 cells were either left untreated or with treatment TSA for 4 h at indicated concentrations under normoxia (controls), glucose and oxygen deprivation (OGD). DC viability was assessed.
Changes in oxygen and glucose had no apparent effect on basal expression of surface CD80 and CD86 expression (Figure
TSA increases expression of co-stimulatory molecules CD 80 and in DC2.4 cells under oxygen and deprivation.
TSA decreases DC2.4 cell FITC-dextran uptake. Flow cytometry for FITC-dextran uptake by DC2.4 cells treated with TSA under normoxia, glucose and OGD. *
As shown in Figure
TSA promotes DC2.4 cell migration. Images of scratch wounds from untreated or TSA-treated DC2.4 cells (normoxia and OGD) after the scratch or after migration, *
Under normoxic conditions, TSA had no apparent effect on the expression of those cytokines (Figure
TSA decreases expression of IL-1β, IL-10, IL-12, and TGF- β in DC2.4 cells. Results are from three independent experiments.
Under GD or OGD, ATP production were severely decreased (Figure
TSA improves energy production by inducing glycolytic gene expression.
As shown in Figure
TSA promotes glycolysis by upregulating pyruvate kinase M2.
SRSF3 protein was slightly upregulated with OGD, and TSA increased SRSF3 protein and mRNA (Figures
As shown in Figure
Silencing of SRSF3 and PKM2 attenuates TSA induced glycolysis.
With normoxia, lactate production was induced even when SRSF2 or PKM2 were silenced (Figures
As shown in Figure
SRSF3/PKM2 pathway influences cytokine production in DCs. Cytokines in culture supernatant from DC2.4 cells with SRSF3 or PKM2 silencing, with/without TSA treatment.
In the present study, we investigated the protective effects of TSA under hypoxic and glucose-deprivation conditions. TSA modulated the function and phenotype of DCs by upregulating critical costimulatory molecules in DCs associated with antigen-specific immune responses. CD80 and CD86 are two important surface markers for transducing T-cell activation signals. Hypoxia slightly reduced expression of CD86, and this was abolished by TSA treatment. CD80 and CD86 were upregulated under OGD, indicating a more mature phenotype. These data partially agree with a recent report evaluating another HDAC inhibitor LBG589 in DCs (Song et al.,
Furthermore, hypoxia decreased endocytic activity, a specialized function of immature DCs (Sallusto et al.,
Our model reflects an immune response under the deprivation of nutrients and oxygen. Immune cells recruited from high oxygen content blood flow to pathologic lesions with inflammatory conditions must rapidly adapt their metabolism to cope with reduced oxygenation (Sitkovsky and Lukashev,
Dendritic cells undergo metabolic reprogramming, as they upregulate glycolysis/gluconeogenesis and pentose phosphorylation genes (Cummins and Taylor,
As immunomodulators, DCs secrete numerous cytokines or chemokines, which modulate the balance between adaptive immunity and inflammatory response (Banchereau and Steinman,
We compared cytokine expression under normal conditions, hypoxia, and hypoxia and OGD. Cytokine production was altered by hypoxia, and glucose deprivation alone had no effect on cytokines. IL-12 and TGF-β were attenuated by GD, and cytokines were upregulated by OGD. Our findings differ from recent findings showing that hypoxia influences IL-1β and IL-10 expression (Mancino et al.,
Pyruvate kinase M2 (PKM2) has been shown to promote rapid glycolytic energy production. It is generally upregulated in cancer cells and is important for metabolic programming in immune cells under LPS stimulation, so it contributes to activation of macrophages and DCs (Altenberg and Greulich,
Here, we show that TSA treatment favors the expression of PKM2 over PKM1 mRNA and protein, and SRSF3 expression was upregulated by TSA. Silencing PKM2 or SRSF3 via shRNA confirmed our hypothesis that SRSF3 acts upstream of PKM2. Furthermore, TSA could partially rescue the effects of PKM2 or SRSF3 silencing on ATP and lactate production. Finally, the interplay between PKM2 and SRSF3 also affected IL-1β, IL-10, IL-12, and TGF-β. These findings suggest that TSA increases PKM2 expression via upregulation of SRSF3, thus improving DC 2.4 cell glycolytic activity and function.
In summary, our findings suggest that TSA significantly modulated the phenotype and function of murine DCs under hypoxia and glucose deprivation, suggesting a therapeutic immunomodulatory role for HDAC inhibitors.
HJ and SZ conducted the experiments. HJ and SZ contributed equally to the project. SZ and XC designed the experiments and SZ wrote the paper. TS, XG, and RZ helped with some of the experiments.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
We would like to thank LetPub for providing linguistic assistance during the preparation of this manuscript.