Edited by: David Stec, University of Mississippi Medical Center, United States
Reviewed by: Libor Vitek, Charles University, Czechia; Terry D. Hinds Jr., University of Toledo, United States
*Correspondence: Shuchun Chen,
†These authors have contributed equally to this work
This article was submitted to Drug Metabolism and Transport, a section of the journal Frontiers in Pharmacology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
To investigate the effect of silibinin on the protein expression profile of white adipose tissue (WAT) in obese mice by using Tandem Mass Tag (TMT) and liquid chromatography-tandem mass spectrometry (LC-MS/MS).
According to experimental requirements, 36 C57BL/6JC mice were randomly divided into normal diet group (WC group), high fat diet group (WF group), and high fat diet + silibinin group (WS group). WS group was intragastrically administered with 54 mg/kg body weight of silibinin, and the WC group and the WF group were intragastrically administered with equal volume of normal saline. Serum samples were collected to detect fasting blood glucose and blood lipids. IPGTT was used to measure the blood glucose value at each time point and calculate the area under the glucose curve. TMT combined with LC-MS/MS were used to study the expression of WAT, and its cellular processes, biological processes, corresponding molecular functions, and related network molecular mechanisms were analyzed by bioinformatics. Finally, RT-PCR and LC-MS/MS were used to detect the mRNA and protein expressions of FABP5, Plin4, GPD1, and AGPAT2, respectively.
Although silibinin did not reduce the mice's weight, it did improve glucose metabolism. In addition, silibinin decreased the concentration of TC, TG, and LDL-C and increased the concentration of HDL-C in the serum of mice. In the WF/WS group, 182 differentially expressed proteins were up-regulated and 159 were down-regulated. While in the WS/WF group, 362 differentially expressed proteins were up-regulated and 176 were down-regulated. Further analysis found that these differential proteins are mainly distributed in the peroxisome proliferation-activated receptor (PPAR), lipolysis of fat cells, metabolism of glycerides, oxidative phosphorylation, and other signaling pathways, and participate in cell processes and lipid metabolism through catalysis and integration functions. Specifically, silibinin reduced the expression of several key factors such as FABP5, Plin4, GPD1, and AGPTA2.
High fat diet (HFD) can increase the expression of lipid synthesis and transport-related proteins and reduce mitochondrial related proteins, thereby increasing lipid synthesis, reducing energy consumption, and improving lipid metabolism
Obesity is a chronic metabolic disease caused by heredity, lifestyle, environment, and other factors, and the imbalance between energy intake and consumption was the root cause. With the increasing incidence of obesity, the incidence of diabetes, hyperlipidemia, fatty liver, cardiovascular disease, atherosclerosis, and other diseases is also increasing (
Adipose tissue is the main site for energy storage and it is found throughout the body in distinct subcutaneous and visceral depots, including white adipose tissue (WAT) and brown adipose tissue (BAT) (
Silymarin, a flavonoid complex isolated from the seeds of milk thistle, is composed primarily of silibinin with small amounts of other stereoisomers (
In this study, we used TMT combined with LC-MS/MS to observe the changes of WAT protein in epididymis of mice with high-fat diet before and after silibinin intervention and further explored the mechanism of silibinin on adipose tissue function in obese people, which provides a new basis for the prevention and treatment of obesity and its complications.
Male C57BL/6JC mice (7 weeks old) used in this study were purchased from Beijing Weilitonglihua Laboratory Animal Technology Co. Ltd. They were housed in a pathogen-free environment (22 ± 2°C, 55 ± 10% humidity, and 12—12 h/light–dark cycle) with free access to a standard laboratory diet and water. The animal experimental procedures were approved by the Animal Ethics Committee of Hebei People's Hospital. All experiments were carried out in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals.
After one week of adaptive feeding, the animals were randomly divided into normal diet group (WC group, n = 12) and high fat diet group (WF group, n = 24). In the WC group, mice were fed with normal diet consisting of 70% carbohydrate, 10% fat, and 20% protein. The total calories were 348 kcal/100g. In the WF group, mice were fed with high fat diet consisting of 20% carbohydrate, 60% fat, and 20% protein. The total calories were 524 kcal/100g. Mice in each group were fed daily with equal calories and fed with water freely. The food intake was recorded daily. Fasting weight was measured every week and changes were recorded. After 4 weeks, the mice in the WF group were further subdivided into two groups: WF group (n = 12) and WF + silibinin group (WS group, n = 12). The WS group was intragastrically administered with 54 mg/kg body weight of silibinin, and the WC group and the WF group were intragastrically administered with equal volume of normal saline for 4 weeks. After 4 weeks of drug intervention, blood glucose values at each time point were measured by IPGTT, and AUCglu was calculated.
After fasting for 12 hours, FPG was measured by fasting blood drops from the tail tip on the Roche rapid glucose meter strip, followed by intraperitoneal injection of 50% glucose 2 g/kg. Blood glucose values of the tail tip were measured at 15, 30, 60, and 120 minutes after glucose injection, and the area under the glucose curve of each mouse was calculated. The calculation formula is: AUCglu = (0′+15′)/8+(15′+30′)/8+(30′+60′)/4+(60′+120)/2.
All mice fasted overnight. After weighing, the mice were anesthetized intraperitoneally with 1% pentobarbital sodium (60 mg/kg), and blood was taken from the eyeball. The blood was then coagulated for 30 min at 4°C and centrifuged at 3,000 × g for 20 min. The serum supernatant was collected and stored at –80°C. After taking blood from the eyeball, the adipose tissue of the epididymis was removed by laparotomy and quickly placed in liquid nitrogen, followed by cryopreservation at –80°C.
Insulin levels in mice were determined by antibody sandwich ELISA; the insulin ELISA kit was purchased from ALPCO, USA. Blood samples were transferred to the tubes containing anticoagulants (4.80 g/L citric acid, 14.70 g/L glucose, and 13.20 g/L tri-sodium citrate). Measurements of serum TC, TG, HDL-C, and LDL-C levels in the samples were performed by enzymatic methods with commercially available kits (RANDOX Laboratories Ltd., Ardmore, Diamond Road, CrumlinCo. Antrim, United Kingdom, BT29 4QY; Daiichi Pure Chemicals Co., Ltd., Tokyo, Japan). All determinations were performed with full automatic blood biochemical analyzer (Sysmex Shanghai Ltd., Shanghai, China).
The epididymal adipose tissue of mice was grinded with liquid nitrogen, added in lysate (8M urea, 1% protease inhibitor, and 2 mm EDTA), and ultrasonicated 10 times for 10 seconds once, followed by centrifugation at 1200 g at 4°C for 10 minutes. The supernatant was added with a final concentration of 5 mmol/LDTT and reduced at 56°C for 30 min. LAA with a final concentration of 11 mmol/L was added and incubated at room temperature in the dark for 15 min. Samples were then digested using 40 μL of 0.05 g/L Trypsin (Bruker, Beijing, China) at 37°C for 14 to 16 hours. After trypsin digestion, peptide was desalted by Strata X C18 SPE column (Phenomenex) and vacuum-dried. Peptide was reconstituted in 0.5 M TEAB and processed according to the manufacturer's protocol for TMT kit/iTRAQ kit. Briefly, one unit of TMT/iTRAQ reagent were thawed and reconstituted in acetonitrile. The peptide mixtures were then incubated for 2 hours at room temperature and pooled, desalted, and dried by vacuum centrifugation.
The desalted peptides were dissolved in a buffer containing 2% acetonitrile 0.1% formic acid before separation by high pH on Q ExactiveTM HF-X using a Zorbax C18 column (2.1 × 150 mm). Peptides were eluted with a linear gradient of 20 mM ammonium formate, 2% ACN to 20 mM ammonium formate, 90% ACN at 0.2 mL/min. The 95 fractions were concatenated into 12 fractions and dried down. Each fraction was analyzed by electrospray ionization mass spectrometry using the Shimadzu Prominence nano HPLC system [Shimadzu] coupled to a 5600 TripleTOF mass spectrometer [Sciex]. Samples were loaded onto an Agilent Zorbax 300SB-C18, 3.5 μm [Agilent Technologies] and separated with a linear gradient of water/acetonitrile/0.1% formic acid (v/v). Fourteen percent of the labeled sample was loaded on the mass spectrometer.
The tandem mass spectra were extracted and analyzed for the removal of isotopes and resolved by the Mascot Distiller software suite from Matrix Science, Boston, MA (version 2.6). Mass spectral data was retrieved using Maxquant (v1.5.2.8). At the same time, all mass spectrometry results were evaluated using a reverse database search method to estimate the false positive rate (FDR) of data caused by random matches. The FDR of proteins and peptides is <1%.
Gene Ontology (GO) is a comprehensive resource of computable knowledge regarding the functions of genes and gene products. Kyoto Encyclopedia of Genes and Genomes (KEGG) is a tool for mapping differentially expressed genes to increase our knowledge of the molecular interaction and reaction networks. The InterPro database can classify protein sequences into families, predicting their domains and important sites. Here, GO and InterProScan software were used to preliminarily analyze the cellular processes of the differential proteins, the biological processes involved, and the corresponding molecular functions. InterPro database and InterProScan software were used to annotate the protein domain of the identified protein. KEGG was used to annotate protein pathways and classify these pathways according to the KEGG website pathway hierarchy classification method.
Total RNA was harvested and extracted using TRIzol kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol, and then it was reverse transcribed to cDNA using a Sensiscript RT kit (ThermoFisher Scientific Inc., USA). Subsequently, RT-qPCR was performed. The thermocycling conditions were as follows: 95°C for 5 min; 30 cycles of 95°C for 30 sec, 56°C for 30 sec, and extension at 72°C for 1 min. Relative quantities of mRNA were calculated using the 2-∆∆Ct method and normalized to housekeeping gene β-actin. PCR primer sequences are shown below: β-actin F: GGCTGTATTCCCCTCCATCG, β-actin R: CCAGTTGGTAACAATGCCATGT; Fabp5 F: ATGGCAACAACATCACGG, Fabp5 R: TCATCAAACTTCTCTCCCAGG. GPD1 F: TGGAGAAGGAGATGCTAAATGG, GPD1 R: TGTGTTGGAGAATGCTGTGC. AGPAT2 F: GTTCGTTCGGTCCTTCAAG, AGPAT2 R: CCTCCAGTTTCTTCTGTCCG. Plin4 F: GCAGTATCTGGAGGTGTGATG, Plin4 R: TGTGTCCTTCGTATTGGTGAG.
The tryptic peptides were dissolved in 0.1% formic acid (solvent A), directly loaded onto a home-made reversed-phase analytical column. The gradient was comprised of an increase from 6% to 23% solvent B (0.1% formic acid in 98% acetonitrile) over 38 min, 23% to 35% in 14 min and climbing to 80% in 4 min, then holding at 80% for the last 4 min, all at a constant flow rate of 700 nL/min on an EASY-nLC 1000 UPLC system. The peptides were subjected to NSI source followed by tandem mass spectrometry (MS/MS) in Q Exactive™ Plus (Thermo) coupled online to the UPLC.
All statistical analyses were performed using the GraphPad Prism 5.0 software (San Diego, CA). The experimental data are presented as mean ± SD. The multiple comparisons were analyzed using one-way ANOVA followed by Bonferroni post test. χ2 text was used to test for differentially expressed proteins. A P < 0.05 was defined as statistically significant.
Silibinin cannot reduce the body weight of mice, but can improve glucose metabolism.
Further, we detected the changes in the concentrations of TC, TG, LDL-C, and HDL-C in the serum. As shown in
The comparison of TC
A total of 300,152 secondary spectrograms were obtained by mass spectrometry. After searching the theoretical data of protein, the available number of mass spectrometry secondary spectrogram was 45830, and the utilization rate of spectrogram was 15.27%. Through spectral analysis, we identified a total of 30,121 peptides with a specific peptide of 29,108. In addition, we identified a total of 5108 proteins, of which 4,623 were quantifiable (quantitative proteins indicate at least one comparison group has quantitative information).
Mass spectrometry detection of whole protein quantification experiments was repeated three times. When P < 0.05, the threshold of differential expression was more than 1.3 as a significant up-regulation and less than 1.3 as a significant down-regulation. According to the above screening criteria for differentially expressed proteins, we compared the protein expressions of the three treatment groups, and the quantitative information of statistically obtained differentially expressed proteins was shown in
Quantitative information on differential protein identification.
Volcano plot can be very intuitive and reasonable to screen out the differentially expressed genes between the two samples. In order to show the differentially expressed genes more vividly, we drew the volcano plot. The red dots indicated the significantly different expressions of up-regulated proteins, while the blue dots indicated the significantly different expressions of down-regulated proteins (
The GO database was used to analyze the final selected differentially expressed proteins and to determine their biological process (BP), molecular function (MF), and cellular component (CC). In the BP analysis, the functions of WF/WC group and WS/WF group were basically the same, mainly involved in cell process, single-cell biological process, biological regulation, molecular metabolism, and stress response (
The proportion of differential protein biological process (BP), cell composition (CC), and molecular function (MF) protein species (Left: WF/WC group; Right: WS/WF group).
The pie chart of
Subcellular localization chart of differentially expressed proteins. The differential proteins in the two comparison groups are roughly distributed, mainly in the cytoplasm, nucleus, extracellular matrix, cell membrane, mitochondria, and endoplasmic reticulum.
It was found that the differential protein domain in the WF/WC group were mainly composed of apolipoprotein/fatty acid binding protein domain, calycin, calycin-like and phospholipid/triglyceride acyltransferase (
Protein domain enrichment plot of differentially expressed proteins.
According to the KEGG pathways, the differentially expressed proteins in WF/WC group were involved in PPAR, lipolysis of fat cells, metabolism of glycerides, Parkinson's disease, and dilated cardiomyopathy pathways (
The KEGG pathway enrichment of differentially expressed proteins.
Network of phenylalanine metabolic pathways.
Network of glycerophospholipid metabolic pathways.
Network of oxidative phosphorylation.
In
Silibinin down-regulated the mRNA expression of GPD1, Fabp5, Plin4, and Agpta2.
To confirm whether differently expressed proteins were consistent with that determined by TMT‐coupled‐LC‐MS/MS, we identified 4 of them. It was found that the expression of fatty acid-binding proteins 5 (Fabp5), glycerol triphosphate dehydrogenase (GPD1), perilipin 4 (PLIN4), and AGPTA2 increased in obese mice induced by high-fat diet, while the expression level decreased after silibinin intervention (
The ion peak area distribution of Fabp5, GPD1, Plin4, and Agpta2 proteins in each sample. After induction of high-fat diet, protein Fabp5, GPD1, Plin4, and Agpta2 increased significantly. When silibinin was added, all the above proteins in WS group were decreased.
A large number of clinical experiments and animal experiments have shown that silibinin has the functions of anti-oxidation, membrane stability, anti-fibrosis, immune regulation, and attenuation of tumor invasion (
Fatty acid-binding proteins (FABPs) are a kind of lipid chaperone protein that can regulate fatty acid transport, signal transduction, and nuclear transcription (
Lipids are one of the body's most important energy sources, and lipid droplets (LDs) are the basic structure of adipose tissue, whose function is related to many protein molecules in cells. Lipid droplets coat proteins (PLINs) family included perilpin, ADRP, and TIP47, then S3-12 and MLDP protein was discovered (
The glycerophosphate pathway is an important pathway for
In this study, it was found that the expression of fat transporter FABPS and lipid synthesis protein PLINS, AGPAT2, and GPD1 in the adipose tissue of obese mice increased, while their expression decreased after the intervention of silibinin; further verification results and mRNA expression of FABP5, PLIN4, GPD1, and AGPAT2 were consistent with our proteomics results. In addition, in our study, we also observed that high-fat diet could increase the concentration of TC, TG, LDL-C, and HDL-C in mice, while after silibinin intervention, the concentration of TC, TG, and LDL-C in mice decreased, and the glucose metabolism capacity was significantly improved. More notably, in another set of our studies (the same batch of mice), lipid deposition in the liver was significantly reduced by oil red staining of the liver tissue (unpublished data). Therefore, it can be speculated that high-fat diet can promote the expression of fat transporter and lipid-synthesis related proteins, promote FFA transport and FFA re-esterification, further promote TG deposition in fat cells and ectopic deposition in liver and skeletal muscle, and finally induce obesity and other metabolic syndrome manifestations in the body. On the other hand, silibinin can reduce lipid accumulation and ectopic deposition, improve lipid metabolism in the body, and avoid the occurrence of diseases related to metabolic syndrome such as insulin resistance, cardiovascular disease, type 2 diabetes, and obesity by down-regulating the expression of related proteins.
Mitochondria play an important role in biological processes such as oxidative stress, inflammation, apoptosis, and metabolic function and are closely related to neurodegenerative diseases, obesity, dyslipidemia, cancer, and other diseases (
Numerous clinical and demographic studies have shown that elevated serum bilirubin levels can prevent cardiovascular and metabolic diseases such as obesity and diabetes. Bilirubin is an effective antioxidant, and the beneficial effect of appropriately increasing plasma bilirubin is thought to be due to the antioxidant effect of this bile pigment (
There are still some limitations in our manuscript. Firstly, the study lacked the hepatic lipid analyses. This is because another subject of our experimental group is the study of liver tissue, so the part of biochemical data belongs to our unpublished part, which we cannot provide in this study. What we can say is that the liver tissue results also show that differential proteins are closely related to fatty acid metabolism, glucose metabolism, oxidative stress, inflammatory response, and PPAR signaling pathways. Secondly, because our serum has been used up during the experiment, we have not measured some important adipokines and the concentration of silibinin in the serum. Finally, we did not observe weight loss in mice after silibinin intervention, which we hypothesized that the cause of this phenomenon may be related to the time of intervention, drug dosage, and drug utilization (
Silibinin can reduce the expression of lipid synthesis and transport-related proteins in obese mice and increase mitochondrial related proteins, thereby reducing lipid synthesis, increasing energy consumption, and improving lipid metabolism
The data can be found in Proteome exchange using the accession number PXD016635.
The animal experimental procedures were approved by the Animal Ethics Committee of Hebei General Hospital.
SC and LR conceived and designed the experiments. FW provided materials and samples and analyzed the data. YW, ZL, TS, HZ and QY collected and collated the data. All the authors have approved the manuscript.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.