Edited by: Ya Liu, Army Medical University, China
Reviewed by: Yang Yang, Northwest University, China; Claudia Penna, University of Turin, Italy
*Correspondence: Yingzhe Liu,
This article was submitted to Cardiovascular and Smooth Muscle Pharmacology, a section of the journal Frontiers in Pharmacology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Ischemic heart disease has become a major health challenge worldwide. Malva sylvestris L. (MS) is a traditional herbal medicine with anti-inflammatory properties and have been used as antioxidant and anti- inflammatory agent in infectious diseases and inflammatory diseases.In this study, we aimed at elucidating the mechanism of MS against ischemia-reperfusion (I/R)–induced injury in vivo and in vitro. The I/R animal model in rats and oxygen glucose deprivation/re-oxygenation (OGD/Re) model in H9c2 cells were used in this study. MS was used to pre-treat the rats and cells. Electrocardiogram, histology staining, qPCR, ELISA, CCK-8, and circRNA microarray were performed. We found that pre-treatment with MS extract attenuate OGD/Re-induced cell apoptosis and cell viability inhibition in H9c2 cells. In addition, pre-treatment with MS protected against I/R injury in vivo. The protective effects of MS pre-treatment were associated with inflammatory genes expression and cytokines release. Further mechanistic investigation revealed that MS protected cardiomyocytes through regulating circular RNA (circRNA). We identified a novel circRNA circ003593 that mediated the protective role of MS in vitro through NLRP3 complex, which was associated with reperfusion injury salvage kinase (RISK) signaling pathway. Conclusion: this study is the first time to demonstrate the protective role of MS on I/R injury. Our findings reveal a novel circRNA circ003593-mediated the protective role of MS through NLRP3 inflammasome. Circ003593 may serve as a potential therapeutic target for ischemic heart diseases.
Ischemic heart disease (IHD) has high mortality and morbidity rates (
The authenticated Malva sylvestris L. were collected from botanical garden (Xuzhou, China). The air-dried MS plants were coarsely ground into leaf powder, and the powder was macerated in 95% methanol for seven days. The concentrate was sifted through and the filtrate was dried utilizing a rotating evaporator. The final extract was used for next experiments at the dose of 300 mg/kg (in vivo) or 6 µg/mL (in vitro).
Sprague Dawley (SD) rats (n = 20; male, 8 weeks old, 200–250 g) were randomly classified into four groups [sham + normal saline (NS), n = 5; sham+ MS, n = 5; I/R + NS, n = 5; IR+MS, n = 5]. The I/R rats were established by ligating the left anterior descending coronary artery (LAD) for 45 min and reperfusion for 24 h; the sham group received the same operation without ligation. Twelve hours before the operation, the rats were intraperitoneally administrated with 300 mg/kg of MS or the equal volume normal saline. Animal experiments were approved by the Ethical Committee for Animal Research of Central South University.
ECG heartbeats monitor (BL-420S biological function experimental system, Chengdu Taifeng Technology Co., Ltd., Chengdu, China) is utilized to observe and record a standard limb II ECG before and during myocardial ischemia and reperfusion under anesthesia. The ST changes were assessed during 30 min period of ischemia, and the first 10 min of reperfusion.
The hearts were removed for H&E staining according to previously described (
After anesthetization with pentobarbital sodium, hearts were rapidly harvested and dipped/washed in potassium chloride saline solution buffer. Frozen heart tissues were cut into 2 mm transverse slices and then incubated in 1.5 % TTC (T8877, Sigma) at 37°C for 20 min and fixed with 10 % formalin overnight. Slices image were obtained to calculate the infarct area by ImageJ. The infarcted size was calculated as: size of infarcted region/size of whole heart *100%.
MDA, SOD, and CAT were measured by using an ELISA kit from Nanjing Jiancheng Company (catalog nos.: AOO3 for SOD, A007-2 for CAT, and A003-1 for MDA, Nanjing, China) according to the manufacturer’s protocol.
Animals were sacrificed, and the infarcted heart tissues were obtained 1 day after ischemia reperfusion. The total RNA was isolated from the ischemic heart tissues or cells by using Trizol following the manufacturer’s protocols, and the concentration of RNA was detected by Nano Drop 2000. qPCR for mRNAs and circRNA was measured by SYBR Green Realtime PCR Master Mix (code no. QPK-201, TOYOBO, Japan) following the manufacturer’s recommended protocol on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Primers sequences were as follow: TNF-α (forward primer, TGGCCTCCCTCTCATCAGTT; reverse primer, ACAAGGTACAACCCATCGGC), IL-1β (forward prime, GCAGTGGTTCGAGGCCTAAT; reverse primer, GCTGCTTCAGACACTTGCAC), IL-6 (forward primer, GTGGCTAAGGACCAAGACCA; reverse primer, ATAACGCACTAGGTTTGCCGA), IL-10 (forward primer, CCCCTTCACTTTCAGGGTCG; reverse primer, GGGGGTTTCTTAGGGGTCAG), circ_003593 (forward primer, GGCCTTGTCTCAAATCAGCT; reverse primer, TCCCCTTTAGTCACCTCAGAG), and GAPDH, (forward primer, CCTCTCATGCACCACCATCA; reverse primer, GCATTGCACCTCAGGGAAGA).
The rat cardiomyocyte-like H9c2 line was cultured in DMEM medium (11-995-040, Gibco) supplemented with 10% (v/v) fetal bovine serum (FBS) (SH30071.03, Hyclone), 1% penicillin/streptomycin (v/v), (15-140-122, Gibco) and 2 mM L-glutamine (25-030-081, Gibco). The cells were cultured in a humidied under 5% CO2 and 95% N2 at 37°C in a standard incubator and reached about 80% for experiments.
The H9c2 cardiomyocytes were pre-treated with of MS extract (6.0 µg/mL) for 24 h and then for OGD/Re (
To knockdown circ_003593, circ_003593 shRNA (shRNA sequence, CCGGTCTGACGTGGATATTAGTAATCTCGAGATTACTAATATCCAC GTCAGATTTTTG) was constructed and packaged into lentivirus by Genomedi tech Co. Ltd. (Genomedi tech, Shanghai, China). The lentivirus with scramble sequence was used as negative control. Briefly, 1 × 106 H9c2 cells were seeded in six-well plates to an 80% confluence and then infected with lentivirus at 100 multiplicity of infection for 48 h.
The cellular viability of H9c2 cells was determined with the CCK-8 assay. The treated cells were seeded into 96-well plates (3000 cells/well), and cell proliferation was assessed using a CCK-8 kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions.
The percentage of apoptotic cells were measured by flow cytometry using an Annexin V Alexa Fluor (488)/ propidium iodide (PI) apoptosis kit (V13245, Invitrogen). The cells were washed with cold PBS buffer for twice and incubated with 5 µl of Alexa Fluor 488-annexin V and 1 µl of PI working solution at room temperature for 15 minutes. The celluar fluorescence was analyzed by using a BD FACS CaliburTM flow cytometer.
The infarcted heart tissues were used for microarray assay to determine differentially expressed circRNAs using the circRNAs chip (Arraystar circRNAs chip, AraryStar) containing 14,236 probes specific for circular RNAs splicing sites. The microarray hybridization including purifying RNA transcribing into fluorescent cRNA was performed based on the manufacturer’s standard protocols and then hybridized onto circRNA arrays. After the hybridized slides were washed and fixed, the slides were scanned using Agilent Scanner G2505C, followed by the data collection by Agilent Feature Extraction software.
ccording to the qPCR results, rat_circRNA_003593 (circ003593) was selected for annotation and function prediction. In addition, cytoscape (
The paraffin-embedded tissues were serially cut at 4 μm. Slides were regularly deparaffinized and dehydrated. Tissues were retrieved in boiling citric acid buffer (pH 6.0) for 15 min. After natural cooling, the slices were blocked with normal goat serum and incubated with primary antibody (rabbit polyclonal anti-cleaved caspase 3; 1:200 dilution, catalog no. 2302, Abcam) overnight at 4°C. Following secondary antibody incubation, the sections were stained by using the DAB Detection Kit (Maxim, Xiamen, China). Finally, the sections were counterstained with hematoxylin. Semi-quantification was analyzed using ImageJ.
Proteins were extracted using RIPA buffer. A BCA Protein Assay kit (Thermo Fisher Scientific, Rockford, IL, USA) were used to determine protein concentrations. Protein (60 μg) was separated on a 10% SDS-PAGE gel and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). Then, the membranes were blocked in 10% nonfat milk for 1 h and then incubated with corresponding primary antibodies (anti–TNF-α: 1:1,000 dilution, catalog no. ab1793, Abcam; anti–IL-1β: 1:1,000 dilution, catalog no. ab2105, Abcam; anti–IL-6: 1:1,000 dilution, catalog no. ab6672, Abcam; IL-10: 1:1,000 dilution, catalog no. ab34843, Abcam; anti-NLRP3: 1:1,000 dilution, catalog no. ab263899, Abcam; anti-ASC: 1:1,000 dilution, catalog no. ab155970, Abcam; anti-cleaved caspase 1: 1:1,000 dilution, catalog no. ab207802, Abcam; anti–p-AKT: 1:1,000 dilution, catalog no. ab38499, Abcam; anti-AKT: 1:1,000 dilution, catalog no. ab18785, Abcam; anti–p-ERK1/2: 1:1,000 dilution, catalog no. ab214342, Abcam; anti-ERK1/2: 1:1,000 dilution, catalog no. ab17942, Abcam; anti-GAPDH: 1:1,000 dilution, catalog no. ab181602, Abcam) overnight at 4°C. Following incubation with appropriate secondary antibody, the bands were visualized using an ECL kit (Millipore). Signals were quantified by ImageJ software and normalized to GAPDH.
All the experiments were repeated independently three times. Values are expressed as means ± standard deviation.Statistical analysis was performed using SPSS15.0(SPSS, Inc., Chicago, IL, United States). Student t test and one-way ANOVA followed by the Newman–Keuls test were used for statistical analysis. Statistical significance was determined as p < 0.05.
To determine whether MS pre-treatment was able to protect against cardiac injury induced by OGD/Re, we examined the cell viability and cell apoptosis after MS pre-treatment and OGD/Re stimulation. H9c2 cardiomyocytes were pretreated with a serial concentrations of MS extracts for 24 h and then were exposed to oxygen glucose deprivation for 3 h followed by reoxygenation for 3 h. Cell viability was then detected by CCK-8 assay. OGD/Re significantly decreases the cell viability compared with control group. Pre-treatment with MS extracts increased the cell viability in OGD/Re-challenged cells at concentrations of 2, 4, 6, 8 µg/mL. MS extract exhibited the highest protective effect at a concentration of 6 µg/mL, whereas higher concentrations provoked a further decline in cell viability (
Protective effect of
In order to evaluate the effect of MS on myocardial infarction in vivo, we established the ischemia/reperfusion (I/R) animal model. I/R group showed larger myocardial infarcted size than the sham group. Pre-treating with MS (300 mg/kg) significantly decreased the infarcted size compared with I/R group (
The effects of
We next investigated the effects of MS on cytokines release in vivo. I/R significantly increased IL-6, IL-1β, TNF-α expression and reduced IL-10 expression at protein and mRNA levels compared with the Sham group. MS pretreatment significantly decreased the expression of IL-6, IL-1β, TNF-α, while increased IL-10 expression in comparison with I/R groups (
The effects of
To investigate the potential mechanism underlying MS protects cardiomyocytes from I/R injury, we obtained circRNA expression profile in myocardial infarcted tissues by circRNA microarray (
The effects of
The circRNA-miRNA-mRNA interaction network of circ003593 was analyzed using cytoscape software. Nine miRNAs (miR-1199-3p, miR-149-5p, miR-217-3p, miR-22-5p, miR-29a-5p, miR-3550, miR-3568, miR-3575, and miR-423-3p) have binding sites with circ003593. Previous studies have showed that miR-29a-5p and miR-423-3p play important role in I/R injury (
The downstream targets and pathways of circ_003593.
MS possesses anti-inflammatory and antioxidant activities to protect against myocardial ischemia reperfusion (
During the response to I/R-induced injury, the injured myocardium are associated with an inflammatory response characterized by the accumulation of leukocytes (
We further investigated the possible mechanism underlying MS protects myocardial. Circular RNAs (circRNA) have been implicated on the effects of traditional medicine (
We also found that circ003593 might potentially interact with nine miRNAs including miR-1199-3p, miR-149-5p, miR-217-3p, miR-22-5p, miR-29a-5p, miR-3550, miR-3568, miR-3575, and miR-423-3p. Moreover, KEGG pathway analysis indicated that circ_003593 was involved in the pathways of PI3K-AKT signaling pathway, pathway in cancer, JAK-STAT signaling pathway, and cytokine-cytokine receptor interaction. These pathways are closely associated with I/R injury (
In light with recent results, we will investigate the expressions of circ_003593 in human samples and validate the network of circRNA-targeted miRNAs and mRNAs in further studies. This study is the first time to describe the protective role of MS on I/R injury. Our findings reveal a novel circRNA circ_003593 that regulates cardiomyocyte apoptosis and proliferation and may serve as a potential therapeutic target for ischemic heart diseases.
The datasets generated for this study are available on request to the corresponding author.
The animal study was reviewed and approved by the Ethical Committee for Animal Research of Central South University.
YX and YL conceived and designed the study and experiments. SW and DBO performed the experiments in vitro and analyzed the data. DBO provided the reagents and performed the animal experiments. All authors contributed to the article and approved the submitted version.
This research was supported by Natural Science Foundation of Hunan Province (2018JJ3864 to SW).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The Supplementary Material for this article can be found online at:
The original Electrocardiogram (ECG) records. The ST changes in I/R rat model with or without MS pre-treatment. MS,