These authors have contributed equally to this work
This article was submitted to Ethnopharmacology, a section of the journal Frontiers in Pharmacology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Drynariae Rhizoma (DR) has been demonstrated to be effective in promoting fracture healing in clinical use. In the study, we tried to predicate potential signaling pathways and active ingredients of DR
Large bone defects (LBDs) are commonly caused by factors such as high-energy traumas, infections, tumors or congenital malformations, which are important reasons for loss of limb function and seriously affecting quality of life (
Traditional Chinese medicine (TCM), as an important component of complementary and alternative medicine system, has been used to cure disease in China for over two thousand years (
Drynariae Rhizoma (DR) derived from Drynaria roosii Nakaike (Polypodiaceae) or Gusuibu is a classic Chinese herbal medicine contains mainly of flavonoids (flavanone) (
Traditional Chinese herbs include multi-components and multi-targets, making it’s difficult to analyze by conventional experimental methods. Moreover, the clinical application of TCM in the world has been hampered because of unclear effects and mechanisms. It is thus necessary to clarify the scientific basis and potential mechanisms of Chinese herbs based on new approach.
Network pharmacology, combined with pharmacology and pharmacodynamics, is a novel research field which clarifies the synergistic effects and the underlying mechanisms of numerous compounds by analyzing various networks of the complex and multi-levels interactions (
Therefore, this study will clarify the potential signaling pathway most related to bone defects and most active ingredients in DR based on network pharmacology before carried out experiments to uncover the underlying mechanism how DR activated the signaling pathway to improving LBDs.
The chemical candidates of each ingredient in Drynariae Rhizoma were gathered from TCM systems pharmacology database (TCMSP,
The physicochemical properties of these compounds include molecular weight (MW), liquid-water partition coefficient (AlogP), the number of donor atoms for H-bonds (Hdon), the number of acceptor atoms for H-bonds (HACC), drug-likeness (DL) and oral bioavailability (OB). The characteristics of compounds in TFDR were all obtained from TCMSP database and the variables of basic properties in each compounds of DR were analyzed next.
Protein targets are the fundamental ingredients of biology pathways and predicting the targets are actually helpful for clarifying the therapeutic mechanism of DR. The planar structure of each candidate was obtained from Pubchem database (
The associated targets were collected from three databases, including 1) GeneCards database (
The Uniprot IDs for related targets of osteogenesis were taken from the Universal Protein Resource (UniProt) (
The correlations between chemical candidates and potential therapeutic targets were visualized by using Cytoscape 3.7.1 to conduct a pharmacological network.
KOBAS 3.0, a web server, integrates five pathway databases (KEGG PATHWAY, PID, BioCyc, Reactome and Panther) and five disease databases (OMIM, KEGG DISEASE, FunDO, GAD and NHGRI GWAS Catalog), supplying functional annotation of gene or protein and enrichment of functional gene set. We performed the pathway and function analysis of the potential therapeutic targets
Animal experiments in the study were approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Guangzhou University of Chinese Medicine, China (No. 20190306032). A total of 120 SPF male Sprague-Dawley rats (age of 10–12 weeks, weight 280–320 g) were purchased from experimental animal center of Guangzhou University of Chinese Medicine and maintained at a room with constant temperature 23 ± 2°C, 12 h light/dark cycle, and free access to standard diet and water.
In the network pharmacology study, researchers have confirmed that TFDR was the most effective ingredients of DR. Therefore, in this study, we applied Qianggu capsules as experimental drugs
A self-made patented Annular External Fixation Device and 3% Pentobarbital sodium (1.5 ml/kg) were used for intraperitoneal injection anesthesia in rats. After the anesthesia was in effect, rats’ right tibiae were shaved and prepared, and the surgical area was repeatedly sterilized with 75% alcohol. 80,000 units of gentamicin diluted with 250 ml of normal saline for lavage were prepared. Rat’s right knee joint and ankle joint was gently held the with both hands of researchers. Then, took the apex of the tibia as the body surface mark, and made a 1 cm longitudinal incision, applying blunt separation to superficial fascia. Researcher deeply detected the fibula that behind the tibia along the intermuscular space, cut the fibula with scissors and silk sutured the incision skin. The first ring-shaped tablet was placed. A 0.5 mm diameter Kirschner wire was drilled with an electric drill. The anterior medial portion of the upper tibia was inserted at 45° perpendicular to the tibial axis. Through the same method, used the second Kirschner wire to make an 30°–45°angle with the first coronal plane, and penetrated near the point of the first Kirschner wire. In the next place, placed the second ring-shaped tablet, and the two tablets and the crossed Kirschner wires between them were fixed with short screws. The position was adjusted so that the central axis of the calf of the rat coincided with the central axis of the circular tablet. Moreover, placed the third ring-shaped tablet, applied the above method inserting two Kirschner wires in the middle tibia, and placed the fourth tablet, using long screws to link the fixed tablets near and far. Finally, after the fixation was firmly fixed, removed the incision of the front end of the tibia, and re-exposed the tibia. A 1 mm drill bit was drilled through the midpoint of the tibia (while gentamicin was used for lavage and cooling). Surgeon cut the sieve-shaped tibia cut and measured the length of the osteotomy for 4 mm, trimmed the cortical edge, tightening the long screw nut. Research assistant flushed, sutured, and sterilized the surgical incision after the fixation was satisfied. To prevent infection, Penicillin was injected intramuscularly. The dosage was 40,000 units per day for three consecutive days. The medication time would be appropriately increased according to the wound healing condition, usually under 7 days. Fasting for 24 h, each rat was raised in a single cage until the lower limbs swelling disappeared within 7 days after the operation.
After successful establishment of large tibial defects model, 120 rats were divided into five groups including: 1) TFDR low dosage group (CEF rats,
Three rats were randomly selected from each group at the fourth week after surgery. After anesthesia, the thorax was dissected and the venipuncture needle was inserted into the left ventricle. Rats were poured with heparin sodium saline (500 ml 0.9% physiological saline contained 100 Uml-1 heparin sodium), while 10% neutral buffered formalin was perfusion for tissue fixation. After that, heparin sodium saline was poured again into the rats, silicone rubber injection compound (Microfil MV-122, Flow Tech) was fully perfused.
At the 12th week after surgery, general anesthesia was performed to each rat, and an X-ray machine was used to obtain X-ray images of the right tibia and fibula. The Lane-Sandhu X-ray score table was applied to evaluate the bone reconstruction level in the distraction area (
Lane-sandhu X-ray scoring.
Points | |
---|---|
Bone formation | |
No evidence of bone formation |
|
Bone formation occupying 25% of defect |
|
Bone formation occupying 50% of defect |
|
Bone formation occupying 75% of defect |
|
Full gap bone formation |
|
Union | |
Full fracture line |
|
Partial fracture line |
|
Absent fracture line |
|
Remodeling | |
No evidence of remodeling |
|
Remodeling of intramedullary canal |
|
Full remodeling of cortex |
|
Micro-CT examination was performed on the specimens after X-ray examination to analyze the parameters of bone histomorphometry. The specimen were placed in the detection tube of the Micro-CT system and scanned from top to bottom along the long axis of the tibia to obtain a connected Micro-CT image with an image resolution of 1,024 × 1,024, a pixel size of 36 × 36 μm, and a gray image Degree level 16 bit, layer spacing 27.37 μm, manual and semi-automatic selection of ROI, measurement and analysis of bone mineral density, bone volume fraction, bone mineral volume, bone surface area to bone volume ratio, structural model index, bone trabecular thickness, number of trabecular bone, trabecular bone clearance.
The tibia specimens obtained at the 12th week after surgery were fixed in 4% paraformaldehyde for 48 h, decalcified with 10% ethylenediaminetetraacetic acid (EDTA) for 21 days, embedded in paraffin, and a tissue microtome was used to longitudinally cut 4 μm slice that contained the backbone and callus. The morphological structure of the distraction area that observed stained with hematoxylin-eosin (HE) or Masson trichrome dye, and the bone reconstruction level in the bone defect area was evaluated.
The decoction of TFDR and boiled water was concentrated, stored at 4°C and returned to room temperature before medication. Twenty SPF male Sprague-Dawley rats were randomly divided into four groups, including the control group, TFDR low dosage group, TFDR medium dosage group, and TFDR high dosage group, with five rats in each group. All rats were gavaged at 8 a.m. and 2 p.m. per day for three consecutive days. The treatment groups were gavaged with different dosage of TFDR, 0.11, 0.22, and 0.44 g·kg−1·d−1, respectively. The control group was administered with equal volume of physiological saline. The blood from the abdominal aorta was collected 1.5 h after the last administration, then stood for 2 h and centrifuged with the speed of 2,500 r·min-1 at 4°C for 15 min to remove the upper serum. The serum was immersed in the 56°C water bathe to inactivate complements, filtered with 0.22 μm micropore filtration and preserved at −20°C.
The bone marrow mesenchymal stem cells (BMSCs) were divided into the control group, TFDR low dosage group, TFDR medium dosage group, and TFDR high dosage group. The control group was given L-DMEM, 100 kU·L−1 streptomycin, 100 kU·L-1 penicillin, and 10% serum-containing medium. The other three groups were given L-DMEM, osteogenetic differentiation inducer, and the corresponding dosage of TFDR-containing serum.
The Sprague-Dawley rats were anesthetized and soaked in 75% alcohol for 15 min. The surrounding tissues were removed rapidly, the tibial bone was separated and soaked in 75% alcohol for 30 s. The bone biting forcep was used to remove the epiphysis, and the L-DMEM medium containing 10% fetal calf serum, 100 kU·L−1 streptomycin as well as 100 kU·L−1 penicillin was sucked to wash the medullary cavity repeatedly until the osseous substance appearing slightly bright. The washing fluid of the medullary cavity was collected and transferred to a 25 cm two culture bottles. After culturing in a 5% CO2 incubator at 37°C for 24 h, then liquid exchange was performed for the first time and afterward every 2 days. When cell fusion reached over 80%, 0.25% trypsin was used to digest. Then the cells were subcultured at a ratio of 1:3. The well-grown cells of the third generation were selected to detect cell surface antigen with flow cytometry, thus immunophenotype of BMSCs was determined.
The flow cytometry was adopted to detect the expression of surface markers of BMSCs. The third generation of BMSCs were all blown into single cell suspension, transferred to the 10 ml centrifuge tube (1,000 r·min −1, 5 min). After removal of the supernatant, the cells were washed with PBS, centrifuged repeatedly, and continuously washed for three times. The BMSCs concentration was adjusted to 2 × 109 L−1 and filtered with 200-mesh screen cloth. Four special tubes of flow cytometry were chosen, with 100 μlcell suspension, 5 μl CD34-PE, 5 μl CD44-APC mouse anti-human monoclonal antibody as well as 5 μl isotype antibody added in. The suspension was incubated for 15 min, and the flow cytometry was applied for statistical analysis.
The third generation of good growth of BMSCs in each group were selected. The single cell suspension was prepared after digested by trypsin, and then planted into the 12-well plates at a density of 1 × 107 L−1. Each well was added with 100 μlcell suspension containing about 1,000 cells. There were six holes in each group with corresponding medium added in, which were labeled and incubated in a 5% CO2 incubator at 37°C. The BMSCs exposed for 3, 5, 7, and 9 days were detected, respectively. The 10 μl Cell Counting Kit 8 (CCK-8) reagent was supplied to each hole and cell culture was terminated after incubation at 37°C for 4 h. The absorbance (A) of each hole was measured at 490 nm measured by microplate reader, therefore A490 reflected the cell viability level.
Other third generation of BMSCs in each group were seeded into the 12-well plates at a density of 1 × 107 L−1 and the corresponding concentration of medium was added in. ALP activity was detected when BMSCs were consecutively cultured for 3, 10, and 13 days, respectively. The absorbance at 562 nm was also assessed. The third generation of BMSCs in each group were planted into the 12-well plates. When cells of each group were cultured for 21 days, the culture medium was discarded. After PBS washing, cells were fixed with 95% alcohol for 30 min, stained with 0.2% alizarin red for 30 min and rinsed with water. Then the cells were observed with a microscope and images were captured under 40 × microscopy. Twelve fields of vision were randomly selected to calculate the number of mineralized nodes in each group, indicating the mineralization ability of the BMSCs.
The BMSCs were seeded into the 12-well plates at a density of 1 × 107L-1. When the bottom of the bottle was covered with more than 80% cells, the corresponding culture medium was added in each group. The liquid was exchanged every 2 days. After culturing BMSCs for 7 days, the total RNA of each group was extracted using the Trizol reagent. Ranged from 1.8 to 2.2, A260/A280 was tested by ultraviolet spectrophotometer to determine the purity of RNA. The reaction conditions of qPCR were as follows: predenaturation at 95°C for 5 min, a total of 40 circles of 95°C for 20 s, deformation at 62°C for 15 s, annealing at 72°C for 15 s, extension at 72°C for 5 min. The mRNA expression of each group was assessed, and the fluorescence amplification curves, standard curves as well as melting curves were drawn after reaction. The number of copy genes of each group was calculated based on the standard curves of target genes and the CT value was recorded. Relative expression of BMP-2 mRNA, p38 MAPK mRNA, VEGF mRNA, RUNX-2 mRNA, and HIF-1α mRNA was calculated according to the 2−ΔΔCt method. Repeated the test three times on each sample and the test primers were shown in
Sequences of primers.
Gene | Primer sequences (5′–3′) | |
---|---|---|
HIF-1α | Forward | ACAAGAAACCGCCTATGACG |
Reverse | TAAATTGAACGGCCCAAAAG | |
VEGF | Forward | GTCGGAGAGCAACGTCACTA |
Reverse | TGCGCTTTCGTTTTTGACCC | |
RUNX2 | Forward | GCTTGATGACTCTAAACCTA |
Reverse | AAAAAGGGCCCAGTTCTGAA | |
BMP2 | Forward | CAGCGAGTTTGAGTTGAGG |
Reverse | CGGTACAGGTCGAGCATAT | |
β-actin | Forward | ATATCGCTGCGCTGGTCGTC |
Reverse | AGGATGGCGTGAGGGAGAGC |
The protein expression of BMP-2, p38 MAPK, phosphorylation of p38 MAPK (p-p38 MAPK), VEGF, and RUNX-2 in each group was detected by specific antibodies using western blot analysis. Proteins from BMSCs were lyzzed with RIPA lysate. After the samples were centrifuged (12,000 r·min-1, 10 min, 4°C), the supernatant was extracted. The protein concentration was tested using a BCA protein assay kit. The protein sample (50 μg) was separated by SDS-PAGE, transferred to a PVDF membranes. The membranes were blocked with nonfat dry milk for 1 h. After incubation with antibodies (1:1,000, BMP-2, p38 MAPK, p-p38 MAPK, VEGF, RUNX-2, and HIF-1α) at 4°C overnight, the corresponding secondary antibodies (1:5,000) were added in and incubated at room temperature for 1 h. After displaying color by ECL kit, the gray values of protein strips were determined by the SensiAnsys image analysis software. The beta-actin was served as internal reference to compare the relative expression of proteins in each group.
Statistical analysis was carried out by SPSS 19.0. Two-way analysis of variance was applied to measure the significance of comparisons between groups after the homogeneity of variance was confirmed. Fisher’s Least Significant Difference test was utilized for comparative analysis between control group and other groups. Differences were considered statistically significant when p-value was less than 0.05. All quantitative data are shown as mean ± SEM.
In order to explore in-depth about these ingredients, we compared six parameters including MW, ALogP, Hdon, Hacc, OB and DL, and all results were shown in
As described in the methods section, we carried out a “candidates-targets” network (
The core targets and their network degrees and related pathways.
Target | Description | Degree | Involved in pathway |
---|---|---|---|
VEGF | Vascular endothelial grow factor | 45 | MAPK, PI3K-Akt, VEGF signaling pathway |
FGF2 | Fibroblast growth factor 2 | 38 | MAPK, PI3K-Akt, RANKL signaling pathway |
RUNX2 | Runt-related transcription factor 2 | 34 | FoxO, NK-kappB signaling pathway |
BMP2 | Bone morphogenetic protein 2 | 30 | TGF-beta, RANKL, BMP2 signaling pathway |
NOTCH2 | Neurogenic locus notch homolog protein 2 | 27 | Notch signaling pathway |
Sema 3A | Semaphorin 3A | 23 | RANKL, T cell receptor signaling pathway |
CD31 | Platelet/endothelial cell adhesion molecule | 20 | MAPK, CD31 signaling pathway |
FGFR2 | Fibroblast growth factor receptor 2 | 17 | MAPK, PI3K-Akt, RANKL signaling pathway |
HIF-1 | Hypoxia-inducible factor 1 | 15 | HIF-1, PI3K-Akt signaling pathway |
The network of TFDR consisted of 18 candidate points.
No | Candidate | Molecular formula | 2D conformer |
---|---|---|---|
1 | Eriodictyol | C15H12O6 |
|
2 | Digallate | C14H9O9- |
|
3 | Luteolin | C15H10O6 |
|
4 | 22-Stigmasten-3-one | C29H48O |
|
5 | Cyclolaudenol acetate | C33H54O2 |
|
6 | Cycloartenone | C30H48O |
|
7 | Cyclolaudenol | C31H52O |
|
8 | Davallioside A_qt | C25H29NO12 |
|
9 | Marioside_qt | C22H34O10 |
|
10 | Xanthogalenol | C21H22O5 |
|
11 | (2R)-5,7-Dihydroxy-2-(4-hydroxyphenyl)chromen-4-one | C15H12O5 |
|
12 | Aureusidin | C15H10O6 |
|
13 | Eriodyctiol (flavanone) | C15H12O6 |
|
14 | Stigmasterol | C29H48O |
|
15 | Beta-sitosterol | C29H50O |
|
16 | Kaempferol | C15H10O6 |
|
17 | Naringenin | C15H12O5 |
|
18 | (+)−catechin | C15H14O6 |
|
What’s more, this network showed the complex relationship between candidates and therapeutic targets, which contributed to identifying the curative features of TFDR in promoting osteogenesis (different components might act on the same targets meanwhile a targets could be regulated by multiple components).
In order to uncover the mechanism of TFDR in promoting osteogenesis and improving LBDs, we implemented function and pathway enrichment analysis for the potential therapeutic targets. As highlighted in
At the 12th week after surgery, the fracture line became more indistinct and more callus had jointed the two fracture ends in the bone defect area of rats in the TFDR groups and Model (MOD) group compared with the model group. Among the TFDR groups, TFDR medium dosage group had the densest callus, the fracture line was the vaguest, and the osteotomy gap nearly disappeared. All the radiological scores from X-ray films were showed in
Evaluation of radiological, micro-CT images, angiogenesis of tibial bone repair of five groups
The callus volume of rats in the TFDR groups were higher than that in the model group as illustrated by the Micro-CT scanning (
The rats were perfused with Microfil to observed vascular formation in tibial defects at 4 weeks (
In accordance with the outcomes of molecular studies (
The expression levels of VEGF, HIF-1α, RUNX-2, and BMP-2 in serum and in bone respectively
Histological evaluation showed that the newly formed bone (NB
Histological analysis of newly formed tissues within distracted gaps at 12 weeks after surgery. Representative histological images of newly formed tissues within distracted gaps at 12 weeks after surgery (five random visual fields per section, three sections per staining, nine sections per rat). From up to down: H&E, Masson’s. We mainly observed six points from the histomorphology assay, including newly formed bone (NB), bone marrow (BM), osteoid matrix (OM), chondroid matrix (CM), and fibrous tissue (FT), to evaluated the bone reconstruction level.
The BMSCs, just planted on the culture plate, were in shape of round mixed with other cells. After culturing for 24 h, the BMSCs grew adherent to the wall with small quantity and the spindle shape. 3 days later, the adherent BMSCs showed an increase both in size and quantity, which extended gradually into fusiform or polygonal, and began to grow in clusters. After incubation for 7–9 days, the number of colonies was gradually increased and merged with each other. When it came to the 9th–11th days, the cell fusion state could be achieved more than 80%. The cells were in round shape after passage and adherent to the wall within 12 h of inoculation. The BMSCs morphology was stretched out like a uniform shape of spindle by degrees. The cell proliferation rate grew quickly that the bottom of the bottle was covered with over 80% cells in shape of vortex on day 5 of culture. The BMSCs morphology on the 3rd, 10th, and 13th day of culture are displayed in
Identification and cell viability assay of BMSCs
The surface marker CD44 accounted for 4.60%, indicating negative results (
The absorbance value at each time point was higher in the TFDR treatment groups compared with the control group, and the difference was statistically significant (
When BMSCs were cultured in corresponding culture medium for 7–14 days, the ALP activity of the control group, TFDR low dosage group and TFDR medium dosage group was gradually increased over time and maintained at a high level. The ALP activity of TFDR medium dosage group reached a relative high level after culture for 10 days, while there was a fallen tendency with time increased. The ALP activity of each group on day 10 of culture is shown in
The ALP staining assay is performed to evaluate ALP activity after incubated for 10 days
After 21 days of intervention, mineralized nodules were formed in each group. The alizarin red staining showed red dense nodules with uneven size in each group (
Representative images of BMSCs with the alizarin red staining to determine the mineralized nodules.
After intervention with TFDR-containing serum for 7 days, the expression of BMP-2, p38 MAPK, VEGF, RUNX-2 mRNA levels in the TFDR treatment group were markedly increased compared with the control group (
The expressions of p38 MAPK, BMP-2, VEGF, HIF-1α, and RUNX-2 mRNA on BMSCs by quantitative real-time PCR. The data are expressed as the mean ± SEM of three independent experiments. *
The results of western blot analysis showed an enhanced phosphorylation of p-p38 MAPK level in BMSCs, which reflected the activity of p38 MAPK. TFDR treatments led to an obvious increase in the protein expression of BMP-2, p38 MAPK, p-p38 MAPK, VEGF and RUNX-2 compared with the control group. What’s more, the expression of BMP-2, p38 MAPK, p-p38 MAPK, VEGF and RUNX-2 protein in the TFDR medium dosage group were significantly higher than those in the control group, TFDR low dosage group and TFDR high dosage group (
LBDs refers to the length of a long bone defect formed by various reasons that exceeds 1.5 times of the long bone or the bone defect is larger than 1/5–1/4 of the bone(
At present, DO has become one of the indispensable methods for various bone diseases in orthopedics field. It has greatly improved the quality of life of millions of people around the world and had a profound impact on the treatment of orthopedic diseases(
TCM has thousand years of history in treating fractures and has proven effective in practice. Hulth pointed out that bone lengthening is actually a continuous regeneration of bone healing, that is, the healing mechanism of large bone after DO surgery is the same as fracture healing(
The total flavonoid in the DR accounted for 1.42% and the content of naringin was 1%. The active ingredient of DR was TFDR, which is characterized with promoting blood circulation, removing blood stasis, repairing bones and enhancing the function of myocardial cells (
In this study, based on network pharmacology, we found that the MAPK is the most related signaling pathway in bone defects. The MAPK signaling pathway mainly consists of ERK1/2 signaling pathway, p38MAPK signaling pathway and JNK signaling pathway. However, the p38 signaling pathway is an important part of the MAPK signaling pathway. Through external stimuli such as cytokines, extracellular signals are transduced into cells to exert biological regulation effects, which could improve body inflammation and regulate cell growth, differentiation and death as well(
VEGF plays an important role in regulating the vascular growth. At present, VEGF is one the best growth factors in inducing angiogenesis in bone tissue engineering. VEGF has been recognized as a key factor in the formation of vessels and is highly specific for directly inducing the proliferation of vascular endothelial cells. What’s more, VEGF is able to make intravascular protein extravasate by increasing capillary permeability, and provide suitable conditions for the migration of vascular endothelial cells and the formation of capillary network (
In addition, through conditional knocking out the over expression HIF1α of VHL in osteoblasts, researchers found that the bone mass and VEGF expression in mice were increased significantly after birth, and could resist bone loss in older mice(
In this study, we found that the viability of BMSCs in the TFDR high dosage group started to decline from the 7th to the 9th day in CKK-8 assay. Moreover, Jeong., et al. showed that the cells cultured with 0.2 mg/ml of TFDR had the most vigorous growth by MTT. Although the above or below TFDR concentration of cells proliferated more vigorously than the standard group, the experimental results indicated that 0.2 mg/ml TFDR has the most optimal effect on promoting the proliferation of BMSCs, which is quite similar to the results of our study(
The limitation of study was that a positive control drug group in the animal experiment was not included. Bone morphogenetic protein and parathyroid hormone were currently effective and certified by the Food and Drug Administration. However, the effectiveness of these two drugs were not ideal as expected in clinical practice because they were unstable in efficacy. Therefore, we had not put these two drugs into our consideration in the animal experiment, which is also a limitation in the clinical treatment of LBDs.
There are many different therapeutic targets being tested for LBDs. However, most treatments highlight the role of one cell, one cytokine, or one signaling molecule, without considering the complexity of LBDs, thus cannot produce anticipated therapeutic effects. TFDR, as a new ingredient affecting p38 MAPK signaling pathway, up-regulating the expression of VEGF, HIF-1α, RUNX-2 and BMP-2, finally promoting the differentiation of BMSCs, showed a promising future, and we hope TFDR could be widely used for treating LBDs soon.
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.
Animal experiments in the study were approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Guangzhou University of Chinese Medicine, China (No. 20190306032).
Study design: ZJ, WS, LX and LL Acquisition of data: LX, ZM, ZL, ZY Analysis and interpretation of data: HD and FH Drafting the manuscript: WS, ML, LX and LL Revising the manuscript: ML, ZS, YZ, LL and ZY Approved the final version of the paper: ZS and ZJ. ZS and ZJ take responsibility for the integrity of the data and the accuracy of the data analysis.
The project was funded by General Programs of National Natural Science Foundation of China (No. 81974575, No. 81774337). The funder had no role in study design, data collection and analysis, decision to publish, or paper preparation. The research work was performed at facilities provided by the Guangzhou University of Chinese medicine, China.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.