Edited by: Rubina Sirri, Università di Bologna, Italy
Reviewed by: Mamdouh Moawad Ali, National Research Centre (NRC), Egypt; Giuseppa Rita Distefano, Technische Universität Darmstadt, Germany
*Correspondence: Maria V. Brundo
This article was submitted to Aquatic Physiology, a section of the journal Frontiers in Physiology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
The use of nanomaterials in several application fields has received in the last decades a great attention due to their peculiar properties, but also raised many doubts about possible toxicity when these materials are used for some specific applications, such as water purification. Indeed a careful investigation is needed in order to exclude possible harmful side effects related to the use of nanotechnology. Nanoparticles effects on the marine organisms may depend on their chemical composition, size, surface structure, solubility, shape and how the individual nanoparticles aggregate together. In order to make the most of their potential, without polluting the environment, many researchers are trying to trap them into some kind of matrix that keeps them active but avoids their dispersion in the environment. In this study we have tested nanocomposite membranes prepared using Nafion polymer combined with various fillers, such as anatase-type TiO2 nanoparticles and graphene oxide. The non-toxicity of these nanocomposites, already shown to be effective for water purification applications in our previous studies, was recognized by testing the effect of the different materials on zebrafish embryos. Zebrafish was considered an excellent model for ecotoxicological studies and for this motivation zebrafish embryos were exposed to different concentrations of free nanoparticles and to the nanocomposite membranes. As biomarkers of exposure, we evaluated the expression of heme-oxygenase 1 and inducible Nitric Oxide Synthases by immunohistochemistry and gene expression. Embryo toxicity test showed that nor sublethal effects neither mortality were caused by the different nanoparticles and nano-systems tested. Only zebrafish larvae exposed to free nanoparticles have shown a different response to antibodies anti-heme-oxygenase 1 and anti- inducible Nitric Oxide Synthases. The immunolocalization analysis in fact has highlighted an increase in the synthesis of these biomarkers.
Nanotechnology has advanced exponentially over the past decade, and nanoscale materials being exploited in several applications (Tsuzuki,
Engineered nanoparticles (NPs) represent an intermediate supramolecular state of matter between bulk and molecular material (Hoet et al.,
Because of the nanoscale nature of nanoscience and nanotechnology, they already bridge many fields including medicine, pharmaceuticals, manufacturing technologies, electronics and telecommunications (Perkel,
The recent biomedical applications of graphene and derivatives have determined a rapid increase of the studies related to the biological interactions of these materials (Sanchez et al.,
For graphene use are important to know the level of toxicity that it might reach in a biological system and the degree of safety; unfortunately, potential toxicity of graphene is little studied compared with that of other carbon nanostructures, such as carbon nanotubes (Seabra et al.,
Nanoparticles in terrestrial organisms can be absorbed throughby inhalation or ingestion (Brigger et al.,
The toxic effects of Engineered Nanoparticles (ENPs) essentially depend on several key factors such as their intrinsic nature and capacity to form larger aggregations, the route of exposure, dose response, exposure time, the response of the receptor organisms to the lack of biocompatibility of ENPs, and the interactions in the mechanisms involved in the physiological process of uptake.
ENPs enter the environment via different exposure routes (Moore,
One of the most important factors related to the toxicity of ENPs is oxidative stress, with production of reactive oxygen species (ROS) (Lushchak,
In aquatic organisms, the effect of ROS on lipids can be measured by monitoring the intermediate species of lipid peroxidation and end products, that are tightly associated with exposure to NPs ROS-induced DNA damage may bring physiological consequences that impair reproduction (Guerriero et al.,
The effects of ENPs on aquatic ecosystems are produced essentially by oxidative damage (internalization by cells) and interaction between ENPs and the cell membrane (without internalization) (Reyman et al.,
According to these results, ecotoxicology research is urgently required to explain and clarify the behavior of ENPs in their different forms and their environmental impact on the ecosystems. Fish Embryo Toxicity (FET) testis a modern non-animal test representing an effective alternative to acute test with adult fish (Embry et al.,
Within the great variety of nanomaterials used for environmental applications, titania and graphene-based materials are extensively investigated (Scuderi et al.,
Titania shows photocatalytic activity under UV light irradiation and TiO2 NPs are extensively used in the degradation of organic contaminant from water (Fujishima et al.,
In our paper we have evaluated the toxicity of Nafion based nanocomposites by zebrafish embryo toxicity test (ZFET), an alternative method to animal testing (Council Directive 86/609/EEC,
The materials tested in the present work are nanocomposite membranes prepared by dispersing various fillers, such as anatase-type TiO2 nanoparticles and graphene oxide (GO) in Nafion polymer. Furthermore, the ZFET results performed on the nanocomposite materials, were compared with results obtained for free TiO2 nanostructures and GO flakes dispersed as powder in the water solution.
Nafion as a 20 wt% dispersion in water and lower aliphatic alcohols was supplied by Aldrich.
Graphene oxide in aqueous suspensions was synthesized by a modified Hummers' method (Hummers and Offeman,
Organo-modified GO (GOSULF) was prepared starting from GO produced by the Staudenmaier's method and then modified by using 3-amino-1- propanesulfonic acid, as described in a previous work (Enotiadis et al.,
The preparation of hybrid nanocomposite Nafion membranes consists of the following steps: dispersing the fillers (anatase-type TiO2 nanoparticles and GO flakes) directly in Nafion solution, with a filler/polymer weight ratio of 3%, ultrasonicating for 1 day and stirring for another day at room temperature until a clear suspension is obtained. After that, the suspension was cast on a petri dish 50°C overnight to remove the solvents. Finally, the hybrid membrane is removed from the petri dish by immersing the glass plate in deionized water for several minutes. To reinforce the membrane, it is sandwiched and pressed between two Teflon plates and placed in oven at 150°C for about 25 min. All composite membranes produced by casting are subsequently treated by rinsing in: (1) boiling HNO3 solution (1 M) for 1 h to oxidize the organic impurities; (2) boiling H2O2 (3 vol%) for 1 h to remove all the organic impurities; (3) boiling deionized H2O for 40 min three times; (4) boiling H2SO4 (0.5 M) for 1 h to remove any metallic impurities; and again (5) boiling deionized H2O for 40 min twice to remove excess acid.
The membranes, as well as the fillers, were analyzed by scanning electron microscopy (SEM), using a ZEISS Supra 35 field emission SEM, in order to observe their morphology, homogeneity and size.
Zebrafish eggs fertilized within 4 h post fertilization (hpf) were provided from the Center of Experimental Ichthyiopathology of Sicily (CISS), University of Messina, Italy, and for experiments eggs were collected and chosen under a stereomicroscope (Leica M0205C, Multifocus). All embryos were derived from the same spawns of eggs.
Fish Embryo Toxicity (FET) test was performed according to OECD (
Some larvae were used for immunodetection of biomarkers by immunofluorescence. Non-specific binding sites for immunoglobulins were blocked by incubations for 1 h with normal goat serum (Vector Laboratories) in PBS (1:10) (Salvaggio et al.,
The larvae were incubated overnight in a humid chamber at 4°C with the primary antibody anti-rabbit-heme-oxygenase 1 (1:500, Enzo Life Sciences, ADI-SPA-896) and anti-mouse-inducible Nitric Oxide Synthases (1: 500, Santa Cruz Biotechnology, Inc. Dallas, Texas USA, sc-7271). After a rinse in PBS for 10 min, the samples were incubated for 2 h at room temperature with fluorescein tetramethylrhodamine (TRITC) conjugated goat anti-rabbit IgG (1:1,000, Sigma-Aldrich) and fluorescein isothiocyanate (FITC) conjugated goat anti-mouse IgG (1:1,000, Sigma-Aldrich). Negative controls were performed by incubation with sera without antibodies. Observations were carried out using a microscope ZEISS AXIO Observer Z1 with Apotome2 system, equipped with the ZEN PRO software.
Gene expression was performed by internal method, already described in Brundo et al. (
Primer sequences used for gene expression assays.
HO-1 | ACGCTTACACCCGCTACCTC | ATCCCCTTGTTTCCAGTCAG |
iNOS | CCTCCTCATGTACCTGAATCTCG | GCTCCTGCTTTAGTATGTCGC |
β-actin2 | AAGCAGGAGTACGATGAGTC | TGGAGTCCTCAGATGCATTG |
Statistical analysis was performed with Prism Software (Graphpad Software Inc., La Jolla, CA, USA). Data were expressed as ± SEM. Statistical analysis was carried out by unpaired
In Figures
Image of nanomaterials.
Figures
Image of Nanocomposite membranes.
Environmental safety of the nanocomposite materials and fillers was investigated through the ZTET, a modern toxicity test that representing an effective alternative to an acute test with adult fish. Zebrafish is considered an excellent animal model for the investigation of developmental toxicity mechanisms in environmental studies. ZFET revealed neither mortality nor sublethal effects caused by the different nanocomposites and free nanoparticles tested. In particular, no one of the evaluated endpoints (viability, growth, brain morphology, pharyngeal arches and jaw, heart, fins, notochord, somites, body shape, cardiovascular function, yolk sac and locomotor function) were satisfied. Significant differences were detected, conversely, in the expression of biomarkers in larvae exposed to the nanocomposites or to the free nanoparticles. Immunohistochemical analysis, in fact, performed in larvae exposed to nanocomposite membranes, did not show the presence of biomarkers, as well as control samples. Vice versa, the larvae exposed to GO flakes and TiO2 NPs showed a positive response to anti-HO1 and iNOS in the whole body (Figures
Larvae zebrafish 96 hpf free GO treated. Zebrafish exposed to free GO showed a positive response to anti-HO-1
mRNA gene expression of HO-1 in zebrafish after exposure to free nanoparticles and nanocomposites. The HO-1 mRNA expression was increased only in free GO treatment. Bars represent the mean ± SEM of three independent experiments. **
mRNA gene expression of iNOS in zebrafish after exposure to free nanoparticles and nanocomposites. The iNOS mRNA expression was increased only in free GO treatment. Bars represent the mean ± SEM of three independent experiments. ***
In this work, we evaluated the toxicity of nanocomposite membranes prepared using Nafion polymer combined with anatase-type TiO2 nanoparticles and graphene oxide. The analyses were also carried out with free TiO2 nanoparticles and GO flakes.
The results confirmed the non-toxicity of these nanocomposites, already shown to have great potential in eco-friendly water/wastewater purification in our previous studies (Filice et al.,
MB, RP, and FM have carried out the planning of experiments, have elaborated the data and have drafted the manuscript; FC and CI take care fish facilities; RP, ES, and DT have carried out experiments of immunohistochemical and gene expression analysis; AS and GG have revised the manuscript; DD, SS, SF, and IN have realized NPs/nanocomposite membranes and have revised the manuscript.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.