Edited by: Soren K. Rasmussen, University of Copenhagen, Denmark
Reviewed by: Heinrich Grausgruber, University of Natural Resources and Life Sciences, Vienna, Austria; Emmanouil Apostolidis, Framingham State University, USA
*Correspondence: Tiancai Guo
This article was submitted to Crop Science and Horticulture, a section of the journal Frontiers in Plant Science
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Polyphenols in whole grain wheat have potential health benefits, but little is known about the expression patterns of phenolic acid biosynthesis genes and the accumulation of phenolic acid compounds in different-colored wheat grains. We found that purple wheat varieties had the highest total phenolic content (TPC) and antioxidant activity. Among phenolic acid compounds, bound ferulic acid, vanillic, and caffeic acid levels were significantly higher in purple wheat than in white and red wheat, while total soluble phenolic acid, soluble ferulic acid, and vanillic acid levels were significantly higher in purple and red wheat than in white wheat. Ferulic acid and syringic acid levels peaked at 14 days after anthesis (DAA), whereas
Phenolic acids can be found in many plant species. These compounds play diverse roles, functioning as signaling molecules, agents in plant defense, and regulators of auxin transport. Additionally, these compounds have received increasing attention due to their antioxidant activity and free radical scavenging ability, which function in degenerative disease prevention. Most studies of plant phenolics have focused on examining these compounds in vegetables and fruits (Nile and Park,
Wheat (
Recently, pigmented wheat has attracted increasing attention due to its high nutrient density. Purple- and blue-grained wheat have much higher free radical scavenging activity than white wheat. This antioxidant activity is positively correlated with the TPC of bran and whole wheat from these varieties (Li et al.,
The grain filling stage is an important step in the process of grain development and polyphenol accumulation. Knievel et al. (
Interest in the health benefits of whole grains has driven breeding programs and the development of cultivation practices aimed at further enhancing nutrient density in the grain. However, to date, the accumulation of phenolic acids and the expression patterns of phenolic acid biosynthesis genes in developing wheat grain have not been investigated. In this study, we investigated the expression profiles of phenolic acid biosynthesis genes in developing grains of white, red, and purple wheat via real-time PCR. The accumulation of phenolic acids was also examined. The results of this study provide a better understanding of phenolic acid biosynthesis in wheat grains.
The seeds of six wheat (
Total phenolic compounds were extracted from the samples using the method reported by Shen et al. (
Soluble-conjugated phenolic acid compounds were extracted according to the procedure described by Htwe et al. (
Individual phenolic acids compounds in the wheat extracts were analyzed using a Waters 2695 high-performance liquid chromatograph (HPLC) equipped with a DIONEX AD25 Absorbance Detector and a Welch Ultimate AQ-C18 (250 × 4.60 mm, 5 μm) column (Waters, Milford, USA). The mobile phase, containing a gradient of solvent A (water containing 1% [v/v] HAc) and solvent B (100% methanol), was used at a flow rate of 0.6 mL/min. The total run time was 65 min and the gradient program was as follows: 20% B for 18 min, 27% B for 15 min, 20% B for 15 min, and 27% B for 17 min. The time of post-run (for reconditioning) was 5 min. The injection volume was 20 μL. Detection was performed at 280 nm using the absorbance detector. Phenolic acids in samples were identified and quantified based on comparisons with chromatographic retention times and areas of external standards. The following phenolic acids were quantified: ferulic acid,
The FRAP (Ferric Reducing Ability of Plasma) assay was performed as reported by Benzie and Strain (
The ABTS+ (2, 2-azino-bis-(3-ehylbenzothiazoline-6-sulfonic acid) assay was performed according to the method of Shen et al. (
Phenylalanine ammonia lyase (PAL), coumaric acid 3-hdroxylase (C3H), cinnamic acid 4-hydroxylase (C4H), 4-coumarate CoA ligase (4CL), and caffeic acid/5-hydroxyferulic acid O-methyltransferase (COMT) are the key enzymes involved in phenolic acid biosynthesis. Primers for phenolic acid biosynthesis gene,
4CL1-F | TACAACAACGGGCTGACCT | CJ962785 | |
4CL1-R | CCTTGAAGCCGTAGTCCAG | ||
4CL2-F | GAGTCCACAAAGAACACCA | BE403254 | |
4CL2-R | TGATTATCTCCTTGAGCCTG | ||
C4H1-F | CAGCCTCCACATCCTCAAG | CK157495 | |
C4H1-R | CTTAGGACGAGCGAACAATC | ||
C3H1-F | ATTGACGAAGAAGGGCAG | CD895891 | |
C3H1-R | GGACACAGCCATCTCAAGT | ||
C3H2-F | TAGCAAGCATCATTTCGTG | AJ585990 | |
C3H2-R | TGTCCAACTCCTCTTGTAGC | ||
COMT1-F | ACGCTGCTCAAGAACTGCT | DQ223971 | |
COMT1-R | CGGGTTCACAGGCAGGAT | ||
COMT2-F | CAGGGAGAGGTACGAGAG | AY226581 | |
COMT2-R | GTAGATGTAAGTGGTCTTGATG | ||
PAL1-F | CACCACCCTGGACAGATTG | AY005474 | |
PAL1-R | TGAGGCGAAGTGCGGAG | ||
PAL2-F | GAGCGTGAGATCAATTCCG | X99705.1 | |
PAL2-R | GCAGACCGTTGTTGTAGAAGT |
Data were analyzed and evaluated using SPSS (Statistical Program for Social Science) software using one-way analysis of variance (ANOVA). Differences between wheat varieties were evaluated using Fisher's least significant difference (LSD) test;
As shown in Table
White | Yumai49-198 | 1147.0c ± 72.5 | 12.80c ± 0.27 | 10.55d ± 0.84 |
Zhengmai366 | 1208.7c ± 33.0 | 12.67c ± 0.25 | 10.79d ± 0.32 | |
Red | Yangmai15 | 1256.9bc ± 95.1 | 12.72c ± 0.04 | 11.39cd ± 0.53 |
Yangmai22 | 1347.6abc ± 65.5 | 13.00bc ± 0.18 | 12.29bc ± 0.62 | |
Purple | Zhouheimai1 | 1489.8ab ± 22.9 | 14.35a ± 0.55 | 15.73a ± 1.53 |
Shandongzimai1 | 1525.1a ± 110.8 | 14.08a ± 1.50 | 13.56b ± 0.48 |
As shown in Tables
White | Yumai49-198 | 573.3b ± 66.0 | 14.74b ± 1.81 | 9.63a ± 3.58 | 18.42b ± 0.74 | 0.11c ± 0.01 | 616.1c ± 145.7 |
Zhengmai366 | 563.9b ± 54.3 | 13.02b ± 6.75 | 9.40a ± 3.45 | 16.74b ± 1.73 | 0.11c ± 0.02 | 603.1c ± 145.2 | |
Red | Yangmai15 | 646.8b ± 89.6 | 24.14a ± 2.02 | 8.04a ± 1.46 | 23.44b ± 2.18 | 0.10c ± 0.02 | 702.5b ± 81.1 |
Yangmai22 | 701.4b ± 42.2 | 27.63a ± 3.85 | 9.58a ± 1.42 | 28.41b ± 3.11 | 0.13c ± 0.04 | 767.1b ± 42.5 | |
Purple | Zhouheimai1 | 823.8a ± 82.6 | 25.80a ± 7.29 | 9.17a ± 1.43 | 44.86a ± 10.95 | 0.34a ± 0.07 | 903.9a ± 65.6 |
Shandongzimai | 838.7a ± 83.0 | 28.46a ± 4.32 | 8.69a ± 0.53 | 41.14a ± 7.59 | 0.26b ± 0.03 | 917.2a ± 79.3 |
White | Yumai49-198 | 21.88c ± 4.72 | 10.63a ± 3.91 | 20.94c ± 1.15 | 13.69c ± 3.62 | 0.80b ± 0.18 | 67.94b ± 4.22 |
Zhengmai366 | 25.75c ± 3.87 | 11.24a ± 3.58 | 24.75bc ± 4.53 | 12.65c ± 0.95 | 0.97b ± 0.32 | 75.36b ± 10.43 | |
Red | Yangmai15 | 35.85a ± 5.24 | 10.99a ± 3.82 | 30.21ab ± 4.37 | 23.77ab ± 3.80 | 0.85b ± 0.25 | 101.67a ± 14.29 |
Yangmai22 | 32.39ab ± 5.23 | 22.07a ± 8.86 | 34.44a ± 4.55 | 24.14ab ± 7.40 | 0.61b ± 0.19 | 113.66a ± 22.91 | |
Purple | Zhouheimai1 | 33.73ab ± 3.76 | 8.20a ± 1.06 | 25.61bc ± 2.01 | 29.21a ± 1.96 | 1.43a ± 0.37 | 98.19a ± 2.99 |
Shandongzimai | 37.31a ± 2.11 | 15.61a ± 5.39 | 23.16bc ± 3.86 | 17.85b ± 4.39 | 1.78a ± 0.63 | 95.71a ± 11.12 |
Bound phenolics are the major phenolics in wheat. We therefore measured the accumulation of bound phenolics in wheat grains during development. Three different patterns of variation in phenolic acid contents were observed during grain filling (Figure
As shown in Figure
According to the above results and the significant differences in gene expression levels among sampling times (data not shown), the expression profiles of wheat phenolic acid biosynthesis genes during grain development were divided into three groups (Figure
Among gene family members,
Phenolics are biologically active substances in wheat grains. Regular intake of these antioxidants can reduce the risk of cardiovascular disease and certain cancers (Lutsey et al.,
Wheat grains change as they develop, including changes in the surface area-to-volume ratio, dry matter content, and antioxidant content. McCallum and Walker (
Phenolic acids in plants are primarily derived from the phenylpropanoid biosynthetic pathway. PAL functions in the entry point of the phenolic acid pathway by catalyzing phenylalanine to cinnamic acid (Nair et al.,
The expression patterns of two
Many genes are present in multigene families, with several copies present in the genome. In the current study,
In conclusion, in mature seeds, purple wheat had the highest total phenolic contents and antioxidant activity, while white wheat had the lowest values. White wheat and red wheat had the highest phenolic acid contents during early seed development, while the levels of phenolic acids during later development were highest in purple wheat. Nine phenolic acid biosynthesis genes exhibited three distinct expression patterns during grain filling, which were in accordance with the accumulation patterns of different phenolic acid compounds. The expression patterns of genes in the developing grain are likely responsible for the accumulation patterns of phenolic compounds in the grain. Further studies are needed to uncover the functions of various genes involved in the biosynthesis of different phenolic acid compounds in wheat grains.
The work presented here was carried out in collaboration between all authors. CW and TG defined the research theme and co-designed experiments, and discussed analyses. DM designed methods, experiments, and wrote this paper. YL carried out the laboratory experiments and analyzed the data. HD and HQ co-worked on associated data collection and their interpretation. YX and JZ co-worked on experimetns design and obtaining test data. All authors have contributed to, seen and approved the manuscript.
This project was funded by the Special Funds for Agro-scientific Research in the Public Interest (201203031), the Science and Technology Support Program (2015BAD26B00), and the Scientific and Technological Project of Henan Province (152102110067).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The Supplementary Material for this article can be found online at: