Tomato cv. Durinta and cucumber cv. Dasher II, both susceptible to RKN (Giné et al., 2016) were used in this study. For all the experiments seeds were surface-sterilized in a 50% bleach solution (40 g l^–1 NaOCl) for 2 min, washed three times in sterilized distilled water for 10 s each. The seeds were then sown in a tray containing sterile vermiculite and maintained in a growth chamber at 25°C ± 2°C with a 16 h:8 h (light:dark) photoperiod.

The Meloidogyne incognita isolate Agropolis used in this study came from a nematode population obtained from tomato cv. Durinta roots cultivated in a plastic-greenhouse in 2010 in which tomato and cucumber were previously cultivated. Twenty tomato plants cv. Durinta grown in 200 cm³ pots filled with sterile sand were inoculated with a single egg mass each and maintained in a growth chamber at 25 ± 2°C and 16 h:8 h photoperiod for 45 days. The adult females developing from a single egg mass were identified as M. incognita by the morphology of perineal pattern and by SCAR markers (Zijlstra et al., 2000). The offspring were maintained on tomato cv. Durinta for experimental purposes. J2 were used as inoculum. Eggs were extracted from tomato roots by blender maceration in a 5% commercial bleach (40 g l^–1 NaOCl) solution for 10 min (Hussey and Barker, 1973). The egg suspension was filtered through a 74 μm aperture sieve to remove root debris, and eggs were collected on a 25 μm sieve and placed on Baermann trays (Whitehead and Hemming, 1965) at 25°C ± 2°C. J2 were collected daily using a 25 μm sieve for 7 days and stored at 9°C until use.

The Bf I-1582 strain isolated from the VOTiVO^® formulation (Bayer CropScience) was used in the cardinal temperatures and biofilm formation experiments, as well as for the bacterial transformation with the green fluorescent protein (GFP) gene to study plant root and nematode egg interactions. The commercial formulate VOTiVO^® was used in the induction of plant resistance experiments and gene expression analysis.

Bf I-1582 was transformed with the GFP gene with a pAD43-25 plasmid (Dunn and Handelsman, 1999) kindly provided by the Bacillus Genetic Stock Center. Bacterial protoplasts were prepared according to Aono et al. (1992) with slight modifications. Three ml of Bf I-1582 cells grown overnight in Penassay medium (1.5 g l^–1 beef extract, 1.5 g l^–1 yeast extract, 5 g l^–1 peptone, 1 g l^–1 glucose, 3.5 g l^–1 NaCl, 3.6 g l^–1 dipotassium phosphate and 1.32 g l^–1 monopotassium phosphate) were harvested by centrifugation at 3000 g for 10 min at 4°C. The pellet was suspended in 0.1 ml of SMMP medium consisting of SMM (0.5M sucrose, 0.02 M maleic acid and 0.02 M MgCl₂) in double-strength Penassay media pH 6.4, supplemented with 40 mg of lysozyme, and incubated at 37°C with gentle shaking for 75 min. The B. firmus protoplasts were recovered by centrifugation at 1000 g for 30 min at 10°C, washed twice with SMMP medium and finally suspended in 0.1 ml of SMMP media.

Transformation of Bf I-1582 was performed according to Chang and Cohen (1979). Briefly, 150 ng of purified plasmid pAD43-25 were mixed with 5 μl of 2X strength SMM buffer and 50 μl of B. firmus protoplasts obtained as explained above. Then, 150 μl of 40% polyethylene glycol 8000 (Scharlau) were added, and 0.5 ml of SMMP media were added after 2 min of incubation. Protoplasts were recovered by centrifugation at 2500 rpm for 10 min. Protoplasts were suspended in 0.1 ml of SMMP media and kept at 30°C with gentle shaking for 4 h. Finally, cells were plated in solid Luria-Bertani (LB) supplemented with 20 μg ml^–1 chloramphenicol and incubated at 37°C. After 2 days, GFP expression of pAD43-25 of the transformed Bf I-1582 colonies was assessed in a Hertel and Reuss CN-hF microscope with appropriate filters.

To corroborate that the species transformed with the pAD43-25 plasmid was B. firmus, one stable colony transformant was selected. This colony was inoculated in LB and growth O/N before performing a genomic DNA extraction and a PCR with BLS342F (5′ CAGCAGTAGGGAATCTTC 3′) and 1392R (5′ ACGGGCGGTGTGTACA 3′) primers following the conditions described in Blackwood et al. (2005). The 1050 bp PCR product obtained was sequenced and aligned against nr using nBLAST with default settings.

Tomato and cucumber seeds were surface-sterilized, as described previously, and were placed on a moist chamber at 25°C until the main root was ca. 2 cm long (5–7 days). Seedlings were transferred to an Erlenmeyer flask filled with 80 ml of 0.5X Murashige and Skoog (MS) semisolid agar medium (0.07% agar) and inoculated with 20 ml of the Bf I-1582-GFP overnight culture grown at 35°C in liquid LB supplemented with 20 μl ml^–1 chloramphenicol (Sigma). Seedlings were incubated at 25°C for 5 and 10 days, respectively (Hao and Chen, 2017). Afterward, roots were washed with distilled water to eliminate non-adhered bacteria and 10 fragments of the root system (ca. 1 cm long) were examined with laser-scanning confocal microscopy. To determine the spatial pattern of root colonization by Bf I-1582-GFP, roots were imaged using a Leica TCS 5 STED CW microscope (Leica Microsystem) equipped with hybrid detectors and with a 40x 1.25NA HCX Pl Apo CS Leica objective. A 488 nm laser was used for fluorescence excitation. GFP fluorescence was detected at 505–530 nm and autofluorescence of root cell walls at 580–620 nm, as described in Macià-Vicente et al. (2009). Stacks of 8–13 μm, step size of 0.2–0.3 μm, were acquired. Z projection-images and Z stack movies are shown at Figure 2 and Supplementary Video S1, respectively. All image analysis was performed using Fiji (Schindelin et al., 2012).

Nematode eggs were surface-sterilized as in McClure et al. (1973). A 200 μl suspension containing ca. 100 eggs were dispensed in a 1.5 ml microcentrifuge tube containing 50 μl of bacterial culture grown on LB supplemented with 20 μg ml^–1 chloramphenicol (Sigma) at 35°C for 2 days. After 3, 5 and 10 days of incubation at 35°C ± 2°C eggs were examined with laser-scanning confocal microscopy using a Leica TCS 5 STED CW microscope (Leica Microsystem) equipped with hybrid detectors and with a 63x 1.4NA HCX Pl Apo CS Leica objective. A 488 nm laser was used for fluorescence excitation and transmission-light detection. GFP fluorescence was detected at 505–530 nm and egg autofluorescence was detected at 580–620 nm (Escudero and Lopez-Llorca, 2012). Stacks of 8–13 μm, step size of 0.2–0.3 μm, were acquired. Z projection-images are shown in Figure 3. A three-dimensional (3D) reconstructed Z-stack (Supplementary Video S2) of an M. incognita egg after 10 days from bacterial inoculation was created using Huygens software (Huygens SVI, Netherlands).

Cardinal temperatures of Bf I-1582 were determined. Sets of three Petri dishes containing nutrient agar (3 g l^–1 beef extract, 5 g l^–1 peptone, 5 g l^–1 NaCl, 15 g l^–1 agar, pH 7) were inoculated with ca. 200 bacteria colony-forming units (CFU) and incubated in the dark at 4, 9, 20, 25, 30, 35, 40, 45, and 50°C for 96 h before counting.

Growth kinetics in liquid media were determined inoculating 10⁶ CFU in Erlenmeyer flasks containing 200 ml of LB. Sets of three Erlenmeyer flasks were incubated at 10, 15, 20, 25, 30, 35, 40, 45, and 50°C. Cultures were maintained with shaking and one aliquot of 3 ml was taken at 0, 2, 4, 6, 8, 10, 12, 24, 30, 36, and 48 h to measure the optical density at 590 nm (OD_{590 nm}) in an UV-Vis Evolution 300 spectrophotometer (Thermo Fisher Scientific, United States).

Sets of three Petri dishes (40 mm diameter) with 10 ml of Schaeffer’s sporulation medium plus glucose and glycerol (SGG) (5 g l^–1 beef extract, 10 g l^–1 peptone, 2 g l^–1 KCl, 0.5 g l^–1 MgSO₄ 7H₂O, 1 mM Ca(NO₃)₂, 0.1 mM MnCl₂⋅4 H₂O, 1 μM FeSO₄, 1 g l^–1 glucose, and 1% glycerol) were inoculated with 10⁶ CFU and incubated at 10, 15, 20, 25, 30, 35, 40, 45, and 50°C in the dark for 2 days to determine the effect of the temperature on the Bf I-1582 biofilm formation (Hsueh et al., 2015).

Tomato and cucumber were grown in a split-root system as described in previous studies (Ghahremani et al., 2019). In this system, the main root is divided into two halves transplanted in two adjacent pots: the inducer, inoculated with Bf I-1582 and the responder inoculated with 200 J2 of M. incognita. Briefly, the main root of 5-day-old seedlings was excised and plantlets were individually transplanted into seedling trays containing sterile vermiculite and maintained in a growth chamber at 25 ± 2°C and 16 h:8 h photoperiod for 3 weeks for tomato and 2 weeks for cucumber. Afterward, plantlets were transferred to the split-root system by splitting roots into two halves planted into two adjacent 200 cm³ pots filled with sterilized sand. The experiment consisted of three treatments: Bf I-1582/M. incognita (Bf-Mi) and M. incognita (None-Mi) to assess the capability of Bf I-1582 to induce plant resistance against M. incognita, and a control non-inoculated with neither bacteria or nematode to assess the effect of the split-root system on each root half development. Each treatment consisted of ten individual plants. Two experiments were conducted with tomato, and one with cucumber.

The inducer pot was inoculated with a liquid suspension of 10⁹ CFU of BF I-1582 one week after transplantation. One week after bacterial inoculation, the responder pot was inoculated with a liquid suspension to achieve a soil density of 1 J2 of M. incognita per cm³. The treatment None received the same volume of water. The plants were maintained in a growth chamber under the same conditions described previously in a completely randomized design for 43 days. Plants were irrigated as needed and fertilized with Hoagland solution twice per week. Soil temperatures were recorded daily at 30 min intervals with a PT100 probe (Campbell Scientific Ltd.) placed in the pots at a depth of 4 cm. At the end of the experiment, plants were uprooted and fresh root weight of both inducer and responder halves from the non-inoculated control treatment were measured. Roots from responder pots inoculated with M. incognita were immersed in a 0.01% erioglaucine solution for 45 min to stain the egg masses (Omwega et al., 1988) before counting them. Afterward, the nematode eggs were extracted from the roots according to the Hussey and Barker (1973) procedure in a 10% commercial bleach solution (40 g l^–1 NaOCl) for 10 min and counted.

Endophytic root colonization by Bf I-1585 was estimated at the end of the first and second experiment with cucumber and tomato, respectively. Bacterial DNA was quantified by qPCR from three individual biological samples from the Bf-Mi treatment. Each composite biological sample consisted of the inducer half of the roots from three plants. For the composite inducer sample, half of the roots (of three plants) were surface sterilized using 50% commercial bleach solution (40 g l^–1 NaOCl) for 2 min and washed three times with sterile distilled water for 10 s each, and then blotted onto sterile paper. The DNA was extracted from each biological replicate following the López-Llorca et al. (2010) procedure. The qPCR reactions were performed using the Brilliant Multiplex QPCR Master Mix (Agilent Technologies) in a final volume of 25 μl containing 50 ng of total DNA and 0.5 μM of each primer (5′–3′ direction): Votivo-2F (forward) CTCCAATTCCTAATATCCTGCAAAG, Votivo-2R (reverse) GGAAAGTCACGGGACAGTTAT (Mendis et al., 2018). Negative controls containing sterile water instead of DNA were included. Reactions were performed in duplicate in a Stratagene Mx3005P thermocycler (Agilent Technologies) using the following thermal cycling conditions: initial denaturation step at 95°C for 15 min, then 39 cycles at 95°C for 30 s, and 58°C for 1 min. DNA of Bf I-1582 was used to define a calibration curve ranging from 5 pg to 50 ng. PCR specificity was verified by means of melting curve analysis and agarose gel electrophoresis. The Bf DNA referred to the total DNA biomass (50 ng) is expressed as a proportion.

Two-week-old cucumber seedlings and 3-week-old tomato seedlings were transferred to 200 cm³ pots filled with sterilized sand, and maintained in a growth chamber as previously described. The assessed treatments were: non-inoculated plants (Control), plants inoculated with Bf I-1582 (Bf), plants inoculated with M. incognita (Mi) and plants co-inoculated with both organisms (Mi+Bf). Bf I-1582 treatments were inoculated with 10⁹ CFU 1 week after transplantation, and those M. incognita treatments were inoculated with 200 J2 2 weeks after transplanting. The expression of the genes related to JA and SA pathways was evaluated at 0 days after nematode inoculation (DANI), at 7 DANI, when the nematode infected the roots, and at 40 DANI. Root infection was determined by staining the nematode into the root with acid fuchsin (Byrd et al., 1983). At 40 DANI, the nematode eggs were extracted by the Hussey and Barker (1973) from roots of three individual tomato or cucumber plants from all inoculated treatments. Total tomato and cucumber root colonization by Bf I-1585 was estimated from three different plants of each Bf treatment by qPCR at 0 and 40 DANI. Roots were washed three times in sterilized distilled water for 10 s each and then blotted onto sterile paper. The DNA extraction and qPCR were conducted as described under section “Induction of Plant Resistance by Bf I-1582 Against M. incognita.”

For the expression study, three biological replicates were assessed at each sampling time. Each biological replicate consisted of a composite sample of roots from three plants that were pooled. Roots excised from the aboveground plant parts were washed three times with sterile distilled water, blotted on sterile filter paper, and immediately frozen with liquid nitrogen. Samples were stored at −80°C until used. RNA isolation and retrotranscription were conducted according to Ghahremani et al. (2019). Dynamic regulation in the JA pathway was determined by the expression of the lipoxygenase D (LOX-D) gene for tomato (Fujimoto et al., 2011) and lipoxygenase 1 (LOX1) gene for cucumber (Shoresh et al., 2004). In the SA pathway we evaluated the expression of the pathogenesis-related 1 (PR1) gene for tomato (Gayoso et al., 2007) and the phenylalanine ammonia-lyase (PAL) gene for cucumber (Shoresh et al., 2004). The ubiquitin (UBI) gene was used as a reference gene for both plant species (Yang et al., 2012; Song et al., 2015). Relative gene expression was estimated with the 2(-Delta Delta C(T)) method (Livak and Schmittgen, 2001). The sequences of the primers used in the RT-qPCR are shown in Supplementary Table S1. The qPCR reactions were performed in a final volume of 20 μl with 1 μl of cDNA, 0.3 mM primers and 1X Fast SYBR Green Master Mix (Applied Biosystems) in a 7900HT Fast Real Time PCR System thermocycler (Applied Biosystems). Reactions were performed with two technical replicates per each biological replicate using the following conditions: 20 s at 95°C followed by 40 cycles of 30 s at 95°C and 1 min at 60°C for tomato (Gayoso et al., 2007) and 20 s at 95°C followed by 40 cycles of 15 s at 95°C and 1 min at 60°C for cucumber (Shoresh et al., 2004). PCR specificity was verified by means of melting curve analysis and agarose gel electrophoresis.

Statistical analyses were performed using the JMP software v8 (SAS institute Inc., Cary, NC, United States). Both data normality and homogeneity of variances were assessed. When confirmed, a paired comparison using the Student’s t-test was undertaken. Otherwise, paired comparisons were conducted using the non-parametric Wilcoxon test (P < 0.05).

Bf I-1582 grew in temperatures ranging from 15 to 45°C, with 35°C being the optimal growth temperature in both solid (Figure 1A) and liquid media (Figure 1B). Similarly, biofilm formation was observed between 15 and 45°C, being thicker and uniform at 35°C (Figure 1C).

Both tomato and cucumber roots were colonized by B. firmus (Figure 2). In tomato, Bf I-1582GFP was observed on root hairs and epidermal cells at 5 days after inoculation (DAI) (Figure 2a). At 10 DAI bacterial colonies were observed in root hairs and some lone bacteria were found inside the root (Figure 2c). In cucumber, few bacteria were observed on epidermal cells at 5 DAI (Figure 2b). There were no bacteria found inside the root at 10 DAI (Figure 2d) with the few cells observed being attached to the surface of the root section, as shown in Supplementary Video S1.

M. incognita egg-shell degradation and egg colonization by Bf I-1582-GFP were studied with confocal-scanning laser microscopy (Figure 3). At 3 DAI, bacteria were surrounding and degrading the nematode egg and embryo (Figure 3a); at 5 DAI, bacterial colonies were adhered to the egg-shell and some bacteria were found inside the egg (Figure 3b); at 10 DAI bacterial biofilms adhered to the egg-shell and bacteria inside the egg were observed (Figure 3c). Egg-shell erosion and egg colonization by Bf I-1582-GFP can be observed in the Supplementary Video S2.

Fresh root weight of the two halves of the non-inoculated split-root system did not differ significantly (P < 0.05; data not shown) in either tomato or cucumber, proving that the treatment did not hamper root development.

Lower number (P < 0.05) of egg masses and eggs per plant were recorded in the responder part of the tomato root of the Bf-Mi treatment compared to the None-Mi, irrespective of the experiment (Figures 4A,B,D,E). However, no effect was detected in cucumber (Figures 4C,F).

The standard curve for qPCR used for estimating the bacterial DNA density was: Ct = −3.1413 ^∗ log10 DNA concentration + 24.522 (R² = 0.9591). B. firmus colonized roots of both plant species endophytically, but ca. 61% higher (P < 0.05) density of bacterial DNA was recorded in tomato than in cucumber roots (Figure 5).

The regulation of genes related to JA and SA pathways varied between tomato and cucumber (Figure 6). In tomato, at 0 DANI, which corresponds to 7 days after Bf I-1582 inoculation and just after nematode inoculation, both JA (LoxD) and SA (Pr1) pathways were up-regulated in plants inoculated with the bacteria in comparison to non-inoculated plants (Figure 6A). At 7 DANI, when nematode infection was established, only the plants co-inoculated with nematode and bacteria showed an up-regulation of the JA related gene (Lox D) (Figure 6B). At 40 DANI, when J2 hatching began and new root infections occurred, tomato plants co-inoculated with the nematode and Bf I-1582 had repressed the JA related gene (LoxD). Meanwhile the gene related to the SA pathway (Pr1) was up-regulated in plants co-inoculated and also inoculated with Bf I-1582 alone, but was suppressed in plants inoculated only with the nematode (Figure 6C).

In cucumber plants, no differences between treatments were found at 0 DANI (Figure 6D). At 7 DANI Pal I was up-regulated both in the M. incognita inoculated plants and those co-inoculated with the bacteria and the nematode (Figure 6E). At 40 DANI, both JA and SA pathways were suppressed in plants inoculated with M. incognita but only JA in the co-inoculated plants (Figure 6F).

Nematode reproduction in tomato co-inoculated with bacteria was reduced (P < 0.05) in a 53%, but did not differ between treatments in cucumber. Bacterial colonization of tomato roots was ca. 65% higher in tomato than in cucumber at 0 and 40 DANI (Figure 7).