Introduction
Magnaporthe oryzae, the causative agent of rice blast disease, is a devastating fungus responsible for the loss of yield equivalent to the quantity of rice consumed by 60 million people annually (Bagnaresi et al., 2012; Martin-Urdiroz et al., 2016). The use of synthetic chemicals to control this fungus is harmful to the environment and, therefore, unsustainable (Wang et al., 2018). This phenomenon has attracted considerable attention in biopesticide research as an alternative with little or no adverse environmental hazards.
Plants recognize microbial molecules using cell-surface receptors to activate unique signaling cascades to aid their defense mechanisms. Two lines of immunity occur in plants. The detection of microbial-associated molecular patterns (MAMPs or PAMPs) through pattern recognition receptors evokes the first line of defense. PAMP-triggered immunity (PTI) is mediated by cell-surface receptor-like kinases (RLKs) that perceive PAMPs or MAMPs (Cheng et al., 2013). However, successful pathogens compromise PTI by secreting virulence effector proteins targeted at crucial host immune response mechanisms. Plants evoke the second line of defense against virulent effectors using intercellular nucleotide-binding domain leucine-rich repeat (NLR) proteins. NLR proteins initiate the second line of immunity (effector-triggered immunity) by recognizing effectors (Cheng et al., 2013).
After PRR perceives PAMPs, signaling activities commence, resulting in the activation of many defense arsenals such as phytoalexin production, callose deposition, and reactive oxygen species induction (Larroque et al., 2013). Accumulation of phytoalexins improves plant defense. Szatmári et al. (2014) demonstrated that phenylpropanoids enhance PTI induction against bacterial infections in tobacco plants. An aphid-derived elicitor was also reported to induce phytoalexin-deficient-3 gene for camalexin accumulation against green peach aphids (Prince et al., 2014). Although the function of phytoalexins in PTI is seldom disputed, omics techniques continue to expand the frontiers of characterized and novel defense compounds in plants. For example, Kariya et al. (2020) recently isolated M. oryzae–suppressive phytocassanes G and oryzalactone from rice.
Rice plants produce numerous metabolites, including phenolics, terpenes, and flavonoids. Diterpenoids are a C-20 superfamily of terpenes with antimicrobial and antifungal characteristics. The isolation of momilactone, oryzalexin, oryzalexin S, and phytocassane diterpenoids has been linked to rice blast infections (Lu et al., 2018). In addition, phenolic compounds such as lignin, cellulose, and pectin contribute to cell wall integrity (CWI) for PTI induction (Engelsdorf et al., 2018, 2019). Lignin also perverts pathogen-degrading enzymes and restricts the mobility of pathogens from infecting new cells (Shinde et al., 2017). Moreover, lignin and callose deposition block fungal haustoria (Cui et al., 2018). Benzoxazinoids (BXs) are robust phytochemicals that aid plant defense (Hu et al., 2018). Although there are no reports on BXs biosynthesis in rice, their protective and allelopathic activities in other Poaceae family members such as maize, wheat, and rye have been reported. BXs, such as 2,4-dihydroxy-1,4-benzoxazine-3-one (DIBOA_glycoside), dihydroxy-7-methoxy-1,4-benzoxazine-3-one (DIMBOA_glycoside), and 2,4,7-trihydroxy-2H-1,4-benzoxazine-3-(4H)-one (TRIBOA_glycoside) induce immunity against pests and diseases (Dick et al., 2012; Sue et al., 2021).
Elicitors are low-molecular-weight proteins, glycoproteins, lipids, and oligosaccharides derived from viruses, bacteria, and fungi (Patel et al., 2020). Fungal-derived elicitors induce defense metabolite accumulation to alter the physiological conditions of plants (Patel et al., 2020). For example, exogenous treatment of rice seedlings with MoHrip1 enhances salicylic acid elicitation against M. oryzae (Lv et al., 2016).
Our laboratory isolated a hypersensitive response-inducing protein (Hrip1) from Alternaria tenuissima that induces calcium influx, medium alkalinization, and salicylic acid-induced protein kinase. Hrip1 (GenBank accession numberHQ713431) also activates many defense genes and systemic acquired resistance after several days of treatment in tobacco leaves (Kulye et al., 2012). Hrip1 transgenic lines in Arabidopsis thaliana promote plant growth under stressful salt and drought conditions and confer resistance to Botrytis cinerea (Peng et al., 2015). The current study shows that Hrip1 also mediates immunity against rice blast fungi through cell wall enhancement and phytoalexin accumulation.
Experimental procedure
Plant growth and elicitor preparation
Rice cv. Nipponbare (Oryza sativa spp. japonica) seeds were surface-sterilized in a 5% NaClO solution for 10 min and rinsed seven times with double-distilled water (ddH2O). The seeds were spread on soaked Whatman filter paper, placed in a 30 mm Petri dish, and incubated in a growth chamber to sprout. The growth chamber was set at 30°C under light and 25°C in the dark under a 12/12 h photoperiod. Seedlings were transplanted into nutrient-rich soil after 5 days and grown in a greenhouse under the same conditions. All experimental plants were treated as below at the third-leaf stage.
The Hrip1 gene was amplified and inserted into the pPICZαA vector. The recombinant plasmid (pPICZαA-Hrip1) was transformed into Escherichia coli and electroporated into the competent yeast cells. A volume of 5 μl of pPICZαA-Hrip1 was spread on a YPD plate containing Zeocin for selecting positive clones. A single yeast cell was used to inoculate 50 ml YPD and shaken in an incubator at 200 rpm and 30°C for 48 h to attain an OD600 = 2–6 in 48 h. Yeast genomic DNA was isolated from 2 ml of the yeast using the yeast genomic DNA extraction kit from Solarbio Biotechnology Company (Beijing). The Hrip1 DNA was then amplified using PCR primer pairs (Forward primer: GCTCCTACTACTATGAACGGCC Reverse primer: GCACTGAGGCAAGTTACAGAC). A volume of 50 μl PCR mix consisting of H2O (35 μl), dNTPs (5 μl), MgSO4 (5 μl), 1.5 μl each of forward and reverse primers, 1 μl each of KOD-Plus and Hrip1 DNA was prepared. A thermocycler condition for 35 cycles was set at 94°C predenaturation for 2 min, and denaturation for 15 s. Also 68°C was set for 30 s annealing and 1 min extension. The Hrip1 band was purified using the EasyPure quick gel extraction kit purchased from Transgen Biotechnology Company (Beijing). An aliquot of 20 μl was taken into a clean microcentrifuge tube for commercial sequencing at Sangon Biotechnology Company (Beijing). The Hrip1 sequence alignment was performed using the DNAMAN software.
After the correct sequences were determined, 1,000 ml of yeast nitrogen base (YNB) medium was inoculated with 10 μl of the recombinant pPICZαA-Hrip1 and shaken as described for 4 days. After centrifugation at 3,000 × g, the cells were resuspended in 100 ml YNB medium (without glycerol), incubated under the same conditions, and induced every 24 h with 500 μl of 100% methanol. The supernatant was collected after centrifugation at 10,000 × g at room temperature for 15 min and filtered through a 45 μm Millex-HV syringe filter. Hrip1 secreted protein was then subjected to affinity chromatography on a HiTrap column (GE Healthcare, Waukesha, WI, United States) and ion-exchange chromatography on a Cytiva HiPrep 26/10 Desalting column. The molecular weight of the protein was confirmed by loading 15 μl into 12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE). The protein concentration was analyzed using the Solar Bio BCA protein assay kit (Beijing, China). A volume of 30 μm Hrip1 was reconstituted from the stock protein to treat rice seedlings by spraying at the third-leaf stage. Control plants were sprayed with 30 μM Tris–HCl buffer, pH8.0. Triplicate samples of leaves were obtained from both Hrip1-treated (HT), and control buffer-treated (CB) plants after 6, 12, 24, and 48 h for RNA-seq analysis. A 0 h sample was included as a control (mock) for RT-qPCR to validate RNA-seq results.
Rice blast disease bioassay
Plant growth and Hrip1 induction were performed as previously described for RNA_Seq and qPCR. M. oryzae (KJ201) spore preparation and treatment were performed in accordance with Zhao et al. (2018) and Mondal et al. (2021) descriptions. In brief, M. oryzae (KJ201) spores were inoculated on oatmeal agar and incubated in darkness for 10 days at 30°C, then at 24°C to induce spore formation for 4 days. Spores on each plate were washed with 2000 μl ddH2O containing 0.25% tween-20 and diluted to 1 × 105 spores ml−1. After 48 h of Hrip1 treatment, the rice seedlings were evenly sprayed with M. oryzae (KJ201) spores, covered with black polythene, and placed in the greenhouse at 25°C for 48 h in the dark. The 12 h photoperiod was restored afterward, and the temperature was set at 24°C in darkness, 28°C under light, and 85% relative humidity. Disease score analysis was performed after 7 days of continuous growth. The blast score was assigned based on the number and area covered by the lesions according to the 0–9 scale described by Li et al. (2021a,b).
RNA extraction and cDNA construction
Total RNA was extracted using the Easy Pure Plant RNA Kit (Transgene Biotechnology Company) by following the manufacturer’s protocol. Total RNA (3 μg) was reverse transcribed into first-strand cDNA following the instructions and kit from Transcript all-in-one first-strand cDNA Synthesis SuperMix (Transgene Biotechnology Company).
Genome sequencing, quality assessment, and mapping
RNA extracted from 24 samples (triplicate samples per time point) of Hrip1-treated and buffer-treated seedlings were sequenced using the RICfoiR_BGISEQ-500 RNA_Seq platform (BGI Co., Ltd., Beijing, China), following the RICfoiR_BGISEQ-500 protocol. Quality control analysis was performed using the java program RNA-seQC to remove sequence adaptors, low-quality reads (bases with sequencing quality below 5), and reads with a high content of unknown bases greater than 10%. Clean reads were mapped to the reference genes and genome (Os-Nipponbare-Reference-IRGP-1.0) using Bowtie2 and HISAT.
DEGs, GO, and KEGG pathway analyses
DEGs screening between treatment and control groups was performed using the NOISeq package. The gene expression level of each sample was computed as log2 [foldchange], M, and absolute differences, D for all paired conditions, to build a noise distribution model.
M
i
=
log
2
X
1
i
X
1
i
and
D
i
=
|
X
1
i
−
X
2
i
|
P
A
=
P
(
M
A
≥
{
M
}
&
&
D
A
≥
{
D
.
}
)
The mean expression levels of the control (Control_avg) and treatment (Treat_avg) groups were computed. The treatment and control averages were used to calculate the fold change, MA and absolute difference D: (MA = log2 ((Treat_avg)/ (Control_avg))) and DA = |Congrol_avg-Treat_avg|. A gene is differentially expressed (DEG) if MA and DA diverge from the noise distribution model. Based on this, a default criterion was set to consider a gene as differentially expressed if the foldchange was ≥2 and the diverged probability was ≥0.8.
All DEGs were first mapped to GO terms1 by calculating the gene numbers for each term. A hypergeometric test was then performed to identify significantly enriched GO terms on the GO term finder platform.2
KEGG pathway enrichment analysis was performed using the public database for genes and genomes3 to enhance the overall understanding of the biological functions of the DEGs. KEGG analysis revealed DEGs with significant metabolic or signal transduction pathways than the genome background.
RT-qPCR analysis
Verification of selected genes from the RNA_Seq data was performed on the QuantStudio 5 system using sequence-specific primers designed on primer premier 5 (Supplementary Table 1). The OsActin1 (Os03g0718100) gene was used as the internal reference, and buffer-treated plants were taken at 0 h as control (mock). The 2× RealStar green fast mixture with ROX II kit (GenStar) was used to perform the analysis. A total of 20 μL qPCR mixture consisting of 1 μL cDNA, 0.5 μL each of forward primer and reverse primer, 8 μL RNA_free water, and 10 μL of 2× RealStar green fast mixture was prepared. The PCR condition was as follows: 95°C (2 min), 95°C (15 s), 60°C (30 s), and 72°C (30 s) for 40 cycles. The relative expression of genes was computed as described (Zhang et al., 2021) using the 2−ΔΔCt method with three biological replicates.
Phylogenetic analysis of disease-responsive genes
CDS sequences of DEGs were downloaded4 (Goodstein et al., 2012) to build neighbor-joining trees to investigate DEGs’ evolutionary and functional relatedness using the maximum composite likelihood method. The parameters used to construct the trees on MEGA7 were 1,000 bootstrap replications and the complete deletion of gaps and missing data (Kumar et al., 2016).
Quantification of lignin
Lignin content was analyzed using the thioglycolic acid (TGA) method described by Bonawitz et al. (2014). Treated rice leaves were sampled at 0, 6, 12, 24, 48, 72, and 168 h into a 2 ml microcentrifuge tube containing a grinding ball (RETSCH 53680021, Al2O3 10 mm). Samples were frozen in liquid nitrogen and pulverized into powder using a Retsch MM400 Laboratory Mixer Mill (20.745.0001, Germany). The grinding conditions were 4 min and 30 Hz. 100 mg of the homogenate was placed in a fresh 2 ml microcentrifuge tube, mixed with 10 volumes of 100% methanol, and extracted for 2 h at 80°C on a digital block heater. The extracts were centrifuged at 12,000 g, pellet was washed three times with 10 volumes of ddH2O. The pellet was then resuspended in a solution containing 750 μL ddH2O, 250 μL concentrated HCl, and 100 μl TGA and incubated at 80°C for 3 h. After centrifugation at 12,000 × g, the pellet was washed with 1 ml ddH2O, dissolved again in 1 ml of 1 M NaOH, and rocked in a shaking incubator at 28°C for 12 h. Samples were centrifuged at 12,000 × g for 10 min, and the supernatant was collected into a clean 2 ml microcentrifuge tube without disrupting the pellet. Concentrated HCl (200 μL) was added to the supernatant, vortexed to mix, and incubated at 4°C in a refrigerator. The lignin precipitate formed was collected by centrifugation at 12,000× g for 10 min, dissolved in 1 ml of 1 M NaOH, and absorbance was detected at 280 nm.
Transmission electron microscopy of cell wall morphology
TEM was performed as Mravec et al. (2017) described with little modifications. Leaf samples were quickly cut into approximately 3 mm2, then evacuated in 4 ml fixative buffer containing 2% glutaraldehyde (pH = 7.2) using a glass syringe. Samples were then completely submerged in 1 ml of the same buffer in a 1.5 ml pointed-end microcentrifuge tube and incubated at room temperature for 48 h. The sections were dehydrated in a graded series of ethanol solutions for 15 min each at 30, 50, 70, 80, 90, 95, and 100%. The specimens were transferred into freshly prepared resin: acetone (1:1) solution and left overnight at 35°C, then immersed in acetone for 60 min with six substitutions. Specimens were then polymerized by UV for 48 h. Ultra-thin sectioning (50–70 nm) was performed using an ultramicrotome. Finally, specimens were double-stained with uranium acetate and lead citrate and observed using the HITACHI H-7500 (Japan).
The ImageJ software was used to measure cell wall thickness at seven points per image.
UPLC-MS/MS analysis of diterpenoids
Rice growth, elicitor treatment, and sample preparation were the same as those described for lignin content analysis. Leaf samples were obtained after 3 days of treatment and extracted with 20 volumes of 80% HPLC grade methanol. The extract was analyzed by UPLC-MS/MS in the multiple reaction monitoring (MRM) mode, as described by Kariya et al. (2020). The UPLC-MS/MS parameters included Colum: Acquity UPLC BEH C18 (2.1 × 50 mm, 1.7 μm). Waters: the flow rate was set at 0.2 ml/min, and the column temperature was at 40°C. The solvents used were 0.1% aqueous formic acid (A) and 0.10% formic acid in acetonitrile (B); a 42% (2 min) gradient, followed by a 42–47% B/(A + B; 8 min). Compounds were analyzed in the positive ion mode with nitrogen as the collision gas.
Data analysis
Statistical analysis was performed using GraphPad Prism, version 9.0.0. The RT-qPCR data sets were subjected to a one-way analysis of variance using Dunnett’s multiple comparison tests. Lignin and cell wall thickness analyses were performed using the two-way ANOVA (Bonferroni’s multiple comparison tests). Violin plots of means for quantified diterpenoids were also performed on GraphPad prism 9.0.0. Chemical structures were drawn and analyzed using ChemDraw professional version 20.0.
Discussion
Plants develop intricate mechanisms to withstand antagonistic pathogens. Their immune systems recruit secondary metabolites whose accumulation is controlled at the transcriptional level for defense and environmental cues (Li et al., 2021a,b). Transcriptional profiling techniques have been used to unearth complex metabolic machinery triggered by elicitor treatment and have therefore become a stopgap tool in functional genomics. RNA sequencing has established itself as a leading whole-genome transcript quantification technology that produces reliable results (Lachmann et al., 2018). Here, we present the transcript changes induced by Hrip1 in O. sativa immunity against rice blast fungi. Three defense metabolic pathways: (a) phenylpropanoids/lignin, (b) diterpene, and (c) BXs pathways, are induced by Hrip1 treatment and contributed to the physical and chemical resistance against the rice blast fungus.
Hrip1 defense activation is similar to Mohrip1 and Mohrip2. Lv et al. (2016) reported that Mohrip1 promotes growth and defense against rice blast fungi by activating the expression of genes encoding SA, gibberellin, and diterpenoid biosynthesis, in addition to pathogenesis-related proteins such as NAC. Moreover, MoHrip1 and MoHrip2 transgenic rice plants enhanced immunity against rice blast disease via SA induction (Wang et al., 2017). In contrast to Mohrip1 and Mohrip2, which induce fewer genes encoding diterpenes (8), NAC (2), and PAL (1), Hrip1 activated 68 genes encoding all steps in the lignin pathway, 12 MYB TFs, and 24 diterpene synthases. Moreover, unlike Mohrip1 and Mohrip2, Hrip1 activated the expression of BXs genes (7).
Lignin is a hydrophobic aromatic polymer abundant in plant secondary cell walls and is synthesized via the phenylpropanoid pathway. It is partly responsible for bundling cellular components to enhance CWI rigidity for PTI induction. A lignified cell wall also confers physical barriers to pathogens such as fungal haustoria and restricts trans-cellular infections (Cui et al., 2018; Vermaas et al., 2019; Wan et al., 2021). Lignin also modulates insect attacks, as He et al. (2020) demonstrated that brown planthopper (BPH) lost its piercing efficiency against rice hosts after lignin and SA accumulation were activated by R2R3 MYB TF induced expression of OsPAL genes. Li et al. (2021a,b) revealed the role of OsPAL and other phenylpropanoid genes in lignin, SA, melatonin, and flavonoids’ defense against leaf folder herbivores and BPH.
Hrip1 mediates cell wall immunity by inducing the accumulation of 68.45% lignin in rice leaves, resulting in 100% cell wall rigidity. Our findings are consistent with several reports demonstrating that cell wall-associated genes in isolation or combination encode lignin accumulation and defense modulation (Govender et al., 2017; Yuan et al., 2019; Li et al., 2020a,b; Chen et al., 2021a,b). For example, OsPAL genes induce immunity against M. oryzae, Rhizoctonia solani, and Xanthomonas oryzae pv oryzae (Xoo; Duan et al., 2014; Tonnessen et al., 2015). C4H encodes p-coumaric acid hydroxylation from cinnamic acid, which drives lignification and biosynthesis of other essential defense metabolites (Li et al., 2020a,b; Wang et al., 2020). The soybean C4H1 gene has been linked to defensive lignification against Phytophthora sojae. Furthermore, Agrobacterium-mediated transformation of the CAD2 gene from Pyrus pyrifolia (pear) into tomato plants significantly increased lignin accumulation in the leaves, stems, and fruits (Li et al., 2019). The CAD gene family encodes the NADPH-dependent reduction of hydroxy-cinnamaldehydes to monolignol alcohols, leading to physical reinforcement of cell walls (Park et al., 2018).
Transcriptional factors such as OsNAC5 mediate lignin biosynthesis by activating OsCCR10 (Bang et al., 2021). Also, adenosine and cytosine enrichment of DNA motifs promotes lignin production by binding to MYB TFs. MYB46 and its MYB83 homolog increase phenylpropanoid and lignin biosynthesis (Chen et al., 2021a,b). Moreover, AtMYB15 and OsMYB30 were reported to regulate PAL, C4H, 4CL, HCT, C3H, COMT, and CAD to enhance lignin accumulation and defense against Pst DC3000 (AvrRpm1) and BPH, respectively (He et al., 2020; Kim et al., 2020). Chezem et al. (2017) also showed that AtMYB15 induced lignification and basal immunity in Arabidopsis by binding to cell wall-responsive apparatus containing AC components. A total of 12 MYB genes are linked to Hrip1 induction. Their complementary roles in lignin accumulation might have influenced the cell wall thickness, especially OsMYB61, which enhances 53% culm tissue lignin and cell wall enrichment when overexpressed in rice protoplast (Zhao et al., 2019).
There is no consensus regarding the transport of lignin monomers into the apoplast. Some schools of thought suggest active transport mechanisms are involved in moving glycosylated lignin monomers mediated by ABC transporters. Other studies have linked monomeric transport via passive diffusion (Miao and Liu, 2010; Tsuyama et al., 2013; Shimada et al., 2021). Notwithstanding these contrasting views, monolignol transport is crucial for lignification. Peroxidases (hydrogen peroxide) and laccases (molecular oxygen) genes encode lignin polymerization for extracellular support, nutrient transport, and defense (Xie et al., 2020). Hrip1 activated 33 PRX genes that contributed to cell wall-mediated immunity. Consistent with our results, Meng et al. (2021) identified DcPrx30, DcPrx32, and DcPrx62 as lignification genes in carrot. In Arabidopsis, PRX33 and PRX34 activate PTI. Confirmatory knockdown of these genes compromised H2O2 content in response to PAMP treatment and PAMP-induced protein expression (O'Brien et al., 2012)
Plant defense is also activated by phytochemical elicitation (Nasir et al., 2018). Plants inductively or constitutively accumulate defense metabolites from biochemical pathways to enhance PTI (Mujiono et al., 2021). Diterpene accumulation is associated with M. oryzae and Xoo infections (Zhan et al., 2020). Momilactone (A and B), phytocassane (A and G), and oryzalactone levels were higher in Hrip1-treated plants than in the control groups. The biosynthesis of these metabolites is encoded by well-characterized synthases initiated by a C-20 prenyl-substrate, the GGPP precursor. Two gene clusters on chromosomes Os02g-ent- and Os04g syn-CPS and kaurene synthase have been reported to play crucial roles in the downstream biosynthesis of diterpenoids (Jia et al., 2019). The results reported here showed that ent-CPS2 and syn-CPS4 genes and their KSL paralogs were activated by Hrip1. OsCPC2 and OsCPS4 encode kaurenes. The OsKSL paralogs also encode the formation of the carbon skeletons of labdane-related phytoalexins. These two steps are essential for the downstream biosynthesis of phytoalexins (Miyamoto et al., 2016). OsCPC2 and OsKLS7 enrichment might have accounted for the increased phytocassane A and G levels in Hrip1-treated plants compared to control plants.
Furthermore, short-chain dehydrogenases/reductases (SDRs) are a large family of NAD- or NADP-dependent genes that oxidize 3-hydroxy-syn-pimaradien-19, 6-olide to a typical momilactone A carbon-3 (C3) keto group. Therefore, SDR genes are classified as momilactone synthases (Kitaoka et al., 2016; Miyamoto et al., 2016; Mao et al., 2020). Hrip1 activation of SDR genes (OsSDR11C-MS1, OsSDR11C-MS2, and OsSDR11C-MS13) might have accounted for the enhanced levels of momilactone A and B. Also, cytochrome P450 plays a crucial role in ent-sandaracopimaradiene hydroxylation to form oryzalexin diterpenoids. Wu et al. (2013) reported that CYP76M6 and CYP76M8 were involved in a non-redundant reaction with 3α-hydroxy-ent-sandaracopimaradiene to form oryzalexin. Hrip1 induces cytochrome CYP76M sub-family members, which catalyze oryzalexin formation. Hrip1 also enhanced the expression of four cytochrome P450 sub-family genes (CYP71Z) that participate in oryzalide biosynthesis. For example, OsCYP71Z2 is reported to induce resistance to Xoo infection (Li et al., 2013).
BXs are encoded by genes serially named BX1, BX2, and BX3, depending on the reaction step they catalyze. The role of BX1 in converting indole-3-glycerolphosphate to indole is a significant step in BXs biosynthesis (Tzin et al., 2017). Hrip1 activated seven BXs genes in the rice genome. Although we could not quantify these metabolites due to the absence of authentic standards, reports on wheat and maize showed that transcript abundance of BX genes results in high BX glycoside accumulation (Duan et al., 2021; Sue et al., 2021).
Our findings show that Hrip1 adopts a dual-barrier approach in defense modulation. (1) Hrip1 induced the upregulation of lignin and MYB TFs to confer cell wall-mediated immunity. (2) Hrip1 also increased the expression of genes encoding diterpenoids for phytoalexin accumulation. The enrichment of BXs genes might have contributed to rice immunity against M. oryzae. Other defense-significant metabolites such as lignans, coumarins, stilbenes, and caffeic acid might have also been induced to accumulate since their elicitation partly depends on lignin synthetic genes. This study provides novel insights into the mechanisms underlying Hrip1-treated immunity in plants.