This article was submitted to Developmental and Reproductive Toxicology, a section of the journal Frontiers in Toxicology
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Paracetamol, or acetaminophen (AAP), is the most commonly used analgesic during pregnancy and early life. While therapeutic doses of AAP are considered harmless during these periods, recent findings in both humans and rodents suggest a link between developmental exposure to AAP and behavioral consequences later in life. The aim of this study is to evaluate the impact of neonatal exposure to clinically relevant doses of AAP on adult spontaneous behavior, habituation, memory, learning, and cognitive flexibility later in life using a mouse model. Markers of oxidative stress, axon outgrowth, and glutamatergic transmission were also investigated in the hippocampus during the first 24 h after exposure. In addition, potential long-term effects on synaptic density in the hippocampus have been investigated. In a home cage setting, mice neonatally exposed to AAP (30 + 30 mg/kg, 4 h apart) on postnatal day 10 displayed altered spontaneous behavior and changed habituation patterns later in life compared to controls. These mice also displayed reduced memory, learning and cognitive flexibility compared to control animals in the Morris water maze. An increase of markers for oxidative stress was observed in the hippocampus 6 h after AAP exposure. As AAP is the first choice treatment for pain and/or fever during pregnancy and early life, these results may be of great importance for risk assessment. Here we show that AAP can have persistent negative effects on brain development and suggest that AAP, despite the relatively low doses, is capable to induce acute oxidative stress in the hippocampus.
Paracetamol, or acetaminophen (AAP), is administrated to pregnant woman and neonates as an analgesic and antipyretic. This drug has for a long time been the most common analgesic and antipyretic drug during pregnancy, partly due to its alleged safety. In Northen America and in Northern and Western Europe the prevalence of using AAP during pregnancy is ∼50–60% (
The safety of developmental exposure to AAP has under the recent years been under scrutiny. Epidemiological evidence suggest that developmental exposure to AAP is associated with adverse neurodevelopmental outcomes later in life. More specifically, these studies suggested that there is an association between prenatal AAP exposure and the neurodevelopmental outcomes such as attention deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD), lower IQ and language delay (
Regarding the neurodevelopmental adverse effects of AAP
Owing to the uncertain mechanism of action of AAP, and the accumulating indications that exposure to this drug may interfere with brain development, it is important to continue the neurotoxicological evaluation of this commonly used painkiller. In a consensus statement from 2020, a group of researchers (consisting of clinicians, epidemiologists and scientists) state their concern about the recent findings regarding the developmental effects of AAP (
Pregnant NMRI mice (from Charles River Laboratory) were purchased from Scanbur, Sollentuna, Sweden and were housed individually in plastic cages in a temperature-controlled (22°C) and light-controlled (12 h light/dark cycle) room with a relative humidity in the range 45–65%. All experimental animals had free access to standardized pellet food (Lactamin, Stockholm, Sweden) and tap water. The pregnant NMRI mice were checked for birth once daily (18.00 h) and day of birth was counted as PND 0. Within 48 h after birth, litter sizes were adjusted to 10–12 pups of both sexes.
AAP (Paracetamol Fresenius Kabi, 10 mg ml−1; Fresenius Kabi AB, Sweden; CAS no. 103-90-2) was purchased from Apoteksbolaget, Uppsala, Sweden, and a stock solution containing 6 mg AAP ml−1 saline (0.9% sodium chloride in water) was made.
Male mice were exposed on PND 10 to either saline vehicle or AAP (30 + 30 mg AAP mg/kg, 4 h apart) with a subcutaneous injection at the scruff.
For the recordings of adult behaviors, male mice at the age of around 4 weeks (after weaning) were separated from their female siblings, which were euthanized, and were kept with their male siblings from each treatment group. Litters contained four to nine animals. When the animals reached 3 months of age they were subjected to spontaneous behavior testing. For biochemical evaluation, male pups, randomly selected from different litters, were administered subcutaneously with either 30 + 30 mg AAP/kg or vehicle on PND 10.
For mechansitical investigations on the neonatal brain, pups were euthanized by decapitation at different time-points during the following 24 h, more specifically following either 2, 6, 12 or 24 h post-dose. Brains were dissected on an ice-cold glass plate and hippocampi were collected and individually snap frozen in liquid nitrogen and then stored at −80°C until assayed.
For mechansitical investigations on the adult brain, adult male mice were anesthetized by intraperitoneal injection of 0.01 mg/g body weight sodium Pentobarbital (Apoteket Farmaci, Sweden) and the tissues were fixed by transcardiac perfusion with 4% formaldehyde (Histolab, Sweden). The brains were then dissected out and were stored in 4% formaldehyde overnight before they were frozen in CryMold and stored at −80°C until sectioning.
Mice exposed to AAP (30 + 30 mg/kg, 4 h apart;
Mice exposed to AAP (30 + 30 mg/kg, 4 h apart;
In breif, a circular container with a diameter of 103 cm was filled with water to a depth of 15 cm from the brim (water temperature 21°C). External visual cues were positioned on the north, south, east and west walls; the relative positions of the observer and the Morris maze pool were the same throughout the course of the swim maze test. In the middle of the northwest quadrant a metal mesh platform with a diameter of 12 cm was submerged 1 cm below the water surface. The behavioural test was performed on five consecutive days to test the mouse’s spatial learning ability to locate the platform on the first 4 days (five trials/day). On the fifth day, the platform was re-located to the northeast quadrant and the mice were tested for their re-learning ability (five trials), otherwise the procedure was identical. During the first 4 days of aquisituion, the latancy to find the platform was used to assess spatial learning performance. Following re-location of the platform, the latency to find the platform’s new position was used to assess cognitive flexibility.
Each mouse was placed on the platform for 20 s and then released, head toward the wall of the container, in different squadrants on a rotating schedule (southwest → southeast → northeast → southwest), starting as follows: southwest quadrant on day 1; southeast squadrant on day 2; northeast squadrant on day 3; southwest sqadrant on day 4. The mice had 30 s to locate the submerged platform, and between each trial the mouse rested on the platform for 20 s. The time taken to reach the platform was measured by the observer.
Relative expression levels of mRNAs were measured by quantitative real-time PCR. Hippocampus was homogenized in PureZOL isolation agent (BioRad, Stockholm, Sweden). The total RNA was isolated using Aurum Total RNA extraction columns (Bio-Rad, Stockholm, Sweden) and treated with DNAse to remove possible genomic DNA contamination, according to the manufacturer’s instructions and stored at −80°C. Reverse transcription to cDNA was done using iSCRIPT (BioRad, Stockholm, Sweden). Gene transcription of
Gene-Specific Primer Sequences Used for qPCR.
Target name | Accession No. | Forward primer (5′–3′) | Reverse primer (5′–3′) |
---|---|---|---|
Gapdh | NM_008084.3 | GGGCTCCCTAGGCCCCTCCTCTTAT | CACCCCAGCAAGGACACTGAGCAAG |
|
NM_008828.3 | CTCCGCTTTCATGTAGAGGAAG | GACATCTCCTAGTTTGGACAGTG |
|
NM_010902.4 | GCCCACATTCCCAAACAAGAT | CCAGAGAGCTATTGAGGGACTG |
|
NM_016679.4 | TGCCCCTGTGGTCAAAGTG | GGTTCGGTTACCGTCCTGC |
A phosphatase and protease inhibitor tablet (A32959, ThermoScintific) was dissolved into 10 ml ice cold 1xPBS solution and it was used with a ratio of 1 ml/100 mg tissue for each sample. Glass beads were then added to the samples with a ratio of 1:1. A bullet blender was then used for sample homogenization. In order to eliminate the cell membranes, −80°C freeze and thaw cycles were executed twice. The homogenate was centrifuged for a duration of 5 min at 5,000 rpm at 4 c and stored at −20°C.
The protein concentration in the samples were then determined with BCA technique. Standard solutions (BSA) and a working reagent (BCA) were prepared. Duplicates of 10 ul/sample and 10 ul/standard solution were added in wells in a microplate. Afterwards, the working reagent was added to each well. The sample incubated at 37°C for 20 min. The absorbance was measured at 562 nm.
Western blot was used to analyze the proteins of interest: GAP43 and GLUR1. The western blot procedure was done two times for each marker, the first time with three different protein concentration for optimization, and then a second time was performed on the most optimal protein concentration. For sample protein separation, the supernatants were used in three different concentration (undiluted, 1:5 diluted and 1:10 diluted) for optimization or the most optimal concentration. A sample buffer was prepared, containing beta-mercaptoethanol (Sigma-Aldrich) and laemmli sample buffer (Bio-Rad). This was mixed with the supernatants with 1:1 ratio and incubated at 97°C for 8 min. The samples were then cooled at room-temperature. These and a prestained protein ladder (ThermoScintific) were loaded on the wells of a Mini-PROTEAN (R) TGX Stain-Free ™ 6–16 gel (456–8,106, Bio-Rad). Then the electrophoresis was running at 120 V for 1 h. For total protein measurment, the gel was removed and imaged using a Gel DocTM imager (Bio-Rad). The proteins in the gel were transferred to a Trans-Blot TurboTM Mini PVDF membrane (1,704,156 BioRad) using a Trans Blot ® TurboTM (BioRad). Then the membrane was incubated on strong agitation at RT for 1 h in a blocking buffer consist of TweenⓇ 20 (Sigma-Aldrich) 1xTBS buffer pH 8 (0.1 M TrizmaⓇbase (Sigma-Aldrich) 1.5 M NaCl (Sigma-Aldrich) and dH2O) and 5% Blotting Grade Blocker nonfat dry milk (BioRad). Primary antibody for the protein of interest was diluted in the blocking buffer and used for membrane overnight incubation at 4°C with gentle agitation. The experiment was continued the next day with membrane rinsing followed by a washing step in 1xTTBS 3 × 10 min with strong agitation. Afterwards a HRP-conjugated secondary antibody was diluted 1:10,000 with the blocking buffer and used for 1 h membrane incubation with gentle agitation at RT. A 1:1 mixture of Luminol/enhancer and peroxidase buffer solution (Immuno star HRP BioRad) was prepared and used for membrane incubation at RT for 3 min without agitation. Membrane imaging was performed using a CCD camera (Chemidoc MP BioRad and image Lab 5.5 system) for chemiluminescence.
In this experiment, the frozen brains were cut in coronal sections (10 μm) using a CryoStar™ NX70 Cryostat (Thermo Scientific™) at −20 ± 1°C, thaw-mounted on SuperFrost® Plus slides (Menzel-Gläser, Germany) and stored at −20°C until examination by an immunohistochemical method.
Sections from the hippocampus region (bregma −1.94) were boiled in 0.01 M citric acid for 5 min. After boiling, the sections were marked by “Pap pen” and then washed 3 × 5 min in phosphate-buffered saline (PBS). The sections were then covered by primary antibodies diluted in Supermix (200 ml TBS, 0.5 g gelatin, 1 ml Triton X-100) and placed in a humidity chamber at 4°C overnight. The optimal concentration for synapotophysin (SYP) primary antibody was identified (1:100) through optimization. The next day the sections were washed 3 × 10 min in PBS and were incubated for 2 hours at room temperature in a humidity chamber in the dark with secondary antibody diluted in Supermix. The secondary antibodies used were anti-mouse diluted in 1:400 Supermix. The sections were then washed 3 × 5 min in PBS and each section was then mounted with 50 μL of ProLong Gold antifade reagent with DAPI and kept in the fridge until microscope analysis. The quality of the sections and autofluorescence was controlled to make sure and identify that it was the antibody that gave the signal.
Images for SYP were taken using a Zeiss AxioImager M2 (Zeiss, Germany) at the BioVis platform, Uppsala University. Fluorescent signals were collected at 488 nM for SYP with an fixed exposure time of 2.62 s. Immunofluorescence intensity per area unit (A.U.) was blindly quantified using ImageJ. For each individual five to six measurements were used to establish a mean value. The mean value for each individual was then considered the statistical unit.
Normality of residuals and homogeneity of variances were checked using QQ-plots and homoscedasticity-plots, respectively; if needed, data were log-transformed to meet the assumptions of parametric statistics. In the analysis of behavior, a 2-way RM ANOVA was used to investigate if there was 1) an effect of the within-subject factor (i.e., time), 2) an effect of the between-subject factor (i.e., treatment), and 3) if there was interaction-effect between the within-subjects factor and between-subjects factor (i.e., treatment × time) on the dependent variable. In the analysis of MWM data, the total time over the five consecutive trails/day was compared between conditions. Following ANOVAs, Šidák’s multiple comparisons test was used. When two means were compared, a student’s t-test was used. Effect sizes for ANOVAs and t-tests were calculated for using partial eta-squared (η
There were no signs of toxic symptoms in any of the mice during the experiments. Body weights were measured on PND 10 and at sacrifice (for both mice euthanized within the first 24 h after exposures and mice raised until adulthood). There were no significant effects of exposures on body weights in either neonates (
A significant interaction between treatment and time was shown on the dependent variable distance, F (2, 32) = 3.575,
Behavioral assessments in adulthood following neonatal exposure to AAP.
A significant interaction between treatment and time was indicated on the latency to find the submerged platform, F (3, 60) = 3.552,
A significant increase in the
Transcript level ratios of the genes
No effects were observed on neither GAP-43,
Protein levels, presented as relative intensity of total protien levels, of
Immunohistochemical evaluation did not reveal any differences in synaptophysin levels of the CA3 region,
Immunofluorescence staining of SYP in
This study reports of developmentally induced neurotoxic effects following exposure to relevant doses of AAP in mice. Mice neonatally exposed to AAP displayed impaired habituation capability, reduced memory and learning ability, and decreased cognitive flexibility in adulthood. These behavioral effects were observed in the adult mice following a single day exposure. These effects could potentially depend on increased hippocampal oxidative stress, as indicated by the observed increase in
We administered AAP (30 + 30 mg/kg, 4 h apart) into ten-day-old mice pups. This dose, which is corresponding to a clinically relevant dose in humans (HED: 4.9 mg/kg), has previously been demonstrated to lead to adverse behavioral effects in adulthood (
The spontaneous behavior test, when mice are introduced to a new home cage, explores the animal’s ability to habituate to a new environment. The mice have to integrate a sensory input into motor output, but as the stimulus (e.g., the new environment) becomes more familiar, the response (explorative activity; here as distance travelled) gradually decreases. Control animals reached base-line activity following 90 min in the new home cage. Mice that neonatally were exposed to AAP displayed an increased activity during the last 30 min of recording compared to these controls. Habituation is considered a non-associative form of learning, hence is considered a cognitive function (
To further investigate effects on memory, learning and cognition, the MWM was used. During the 4-day acquisition period, control animals reduced the time needed to locate the submerged platform. This test showed that mice exposed to AAP on PND 10 displayed a significant increase in latency to reach the platform compared to control animals during day 3 and 4 of the acquisition phase. As this indicates an impact on memory and learning, it also confirms previous findings that have shown that AAP exposure during brain development affects cognition (
As there are several suggestions to possible mechanisms of action in the developmental effects observed following exposure to AAP (
The antioxidant response element (ARE) are involved in trascription of numerous genes involved in detoxification and cytoprotection (
Synaptic organisation is crusial during brain development. For example, GAP-43 is vital for axonal growth and is constantly used as a biomarker for axonal outgrowth. The expression of GAP-43 is reaching a peak during brain development, indicating its fundamental role during brain development (
As previously mentioned, other experimental studies that investigated the effect of AAP on rodent brain development have shown the effect on many neurotransmitter systems (
The long term neurodevelopmental effects of AAP have been studied in an increasing amount of epidemiological studies, where AAP exposure during pregnancy have shown associations with ADHD, ASD, lower IQ and language delay (
The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.
The animal study was reviewed and approved by the Experiments were conducted in accordance with the Directive of European Parliament and of the Council of 22 September 2010 (2010/63/EU), after approval from the local ethical committee (Uppsala University and Agricultural Research Council).
GP, conceptualization and design of the work; acquisition, analysis, interpretation of data; writing the original draft; editing of intellectual content. KH, interpretation of data, work on Western blot and immunohistochemistry. YM, work on qPCR and interpretation of these data, AY, work on immunohistochemistry and interpretation of these data. MH, work on Western blot and interpretation of these data. SB, study design; work on animal behavior and interpretation of these data. RF, editing of intellectual content; resources and funding acquisition.
This work was supported and funded by the Department of Environmental Toxicology and the Department of Molecular Neuropharmacology, both at Uppsala University, Sweden.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
We would like to thank Per Eriksson and Henrik Viberg for their important work on different periods of increased vulnerability during brain development and all the important discussions that led to this study. Without their work and without these discussions, this study would not have been done.
The Supplementary Material for this article can be found online at: