FVSKG2 (Accession number: OP161172), a local IBDV isolate, was used in the study. Four mutagens viz.; ribavirin, 5-fluorouracil, 5-azacytidine, and amiloride (Sigma, St. Louis, Missouri, United States) were used in this study. Each mutagen was dissolved separately in Dulbecco’s modified Eagle media (DMEM, Sigma, St. Louis, Missouri, United States) at stock concentrations of 15 mM (Ribavirin), 20 mM (5-fluorouracil, amiloride) and 5 mM (5-azacytidine) which were further sterile-filtered using a 0.22-μm syringe filter (Millex-GV Filter, 0.22 μm Millipore Sigma, Burlington; Massachusetts; United States). The filtrate was aliquoted and stored at −20°C until use, as described in previous studies (35, 36).

The chicken embryo fibroblasts (CEFs) were isolated from 9 days old embryonated chicken eggs and maintained in growth media containing DMEM, 5% Fetal Bovine Serum (Fetal Bovine Serum, Sigma, St. Louis, Missouri, United States) and 1% Penicillin–Streptomycin Solution with 10,000 U penicillin and 10,000 μg streptomycin/mL (Pen Strep, Gibco Waltham, Massachusetts, United States), at 37°C and 5% CO2 in a humidified chamber as described in our previous studies (37, 38).

The cytotoxic effect of mutagens on CEFs was determined using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Thiazolyl Blue Tetrazolium Bromide, Sigma, St. Louis, Missouri, United States). Confluent CEFs were prepared in 96-well plates (Tissue culture plate, 96-well Falcon, Flowery Branch, Georgia, United States). Cells were rinsed and replenished with 100 μL growth medium containing one of the four concentrations of mutagens (0, 0.5, 1.0, and 1.5 mM) in three replicates. To determine cell viability at specific time point, cells were incubated at 37°C and 5% CO2, as described in the previous study (35, 39). At 24 hpt and 48 hpt the growth medium of the cells was replaced with 100 μL of DMEM containing MTT at a concentration of 0.5 mg/mL and incubated for 4 h at 37°C. After the MTT treatment, 100 μL of the solubilizing solution containing 10% SDS in 0.01 M HCL was added and the cells were incubated overnight. Absorbance was read at 570 nm using a multimode microplate reader (Biotek, Cytation^™ 3, Winooski, VT, United States) (40, 41). Control wells (cells with 0.0 mM mutagen) and blank wells (without cells) were utilized for calculating the cell viability by using the following formula as described in our earlier studies (37, 38).

CEFs were cultured in 25 cm² flasks prior to virus inoculation. At the time of virus inoculation, cell number was determined and multiplicity of infection (MOI) of 0.1 was used. The anti-IBDV activity of ribavirin was evaluated against IBDV isolate FVSKG2. Confluent cultures of CEFs were infected with FVSKG2 and incubated for 2 h in a humidified incubator at 37°C and 5% CO2 following which the virus inoculum was discarded, and the cells were replenished with 5 mL maintenance media, each containing a specific concentration of mutagens. Different sub-cytotoxic concentrations of mutagens, ribavirin, 5-Azacytidine, and Amiloride at 0.0, 0.05, 0.1, 0.2, and 0.3 mM, 5-Florouracil at 0.0, 0.1, 0.2, 0.3, and 0.5 mM were tested against FVSKG2 based on previous studies (31, 35, 42, 43). The virus-inoculated cells, each treated with a specific concentration of mutagens, were then incubated for four more days under the same culture conditions as described above, during which time 500 μL of cell culture medium was collected and replaced with fresh media from each flask every 24 h. The collected media was centrifuged and the supernatant was stored at −80°C until further analysis.

Confluent CEFs in 96-well plates (Tissue culture plate, 96 well, Falcon, Flowery Branch, Georgia, United States) were used to evaluate the titer of FVSKG2 samples. Eight-fold serial dilution (10^–1 to 10^–8) of viruses in DMEM were prepared and inoculated in triplicates with 100 μL media per well and incubated for 2 h under cultural conditions. After incubation, the inoculum was discarded and cells were replenished with growth media. The cells were then incubated for 96 h and monitored for cytopathic effects (CPE). The wells were scored for CPE after 96 h. Virus titer was expressed as 50% tissue culture infective dose (TCID50/mL) and calculated using the method of Reed and Muench (44).

FVSKG2 was serially passaged in CEFs in different concentrations of mutagens, Ribavirin and Amiloride at 0.0, 0.05, 0.1, 0.2, and 0.3 mM, and 5-Fluorouracil at 0.0, 0.1, 0.2, 0.3, and 0.5 mM for 11 passages. Confluent monolayers of CEFs, prepared in 6-well plates, were pre-treated with mutagens at given concentrations 4hrs prior to inoculation of a virus at 0.01 MOI. After 2 h post incubation, virus inoculum was removed, and cells were replenished with a growth medium containing the same concentrations of mutagens as used in the pre-treatment stage in each well. The infection was then allowed to proceed for 24 h, following which the plates were freeze-thawed thrice. Cell culture fluid was collected from each well and centrifuged at 2,500 rpm for 5 min, and the supernatant was stored at −80°C for virus titration. 200 μL of supernatant from each passage was used as virus inoculum for the next passage. This procedure was repeated for each serial passage of the virus. In addition, the FVSKG2 was serially passaged in the presence of 0.025 mM ribavirin to evaluate for the presence of mutations compared to the control (0 mM Ribavirin).

According to the manufacturer’s instructions (Virus RNA isolation kit, GeneAll, South Korea), 300 μL of the supernatant of the stock virus of FVSKG2 was used to isolate the RNA, with the following changes. The VL buffer was used for 30 min of incubation with the viral sample. The Takara one-step RT-PCR kit was used to perform the one-step RT-PCR (Primescript One-step RT-PCR kit, Takara, Japan). Amplification was performed according to the manufacturer’s instructions, following some modifications suited for amplifying a dsRNA virus. In a 1:4 ratio, DMSO (Sigma Aldrich, ST. Louis, United States) was added to the RNA template with 0.5 μL RNAse inhibitor (rRNasin, Promega, Wisconsin, United States) and incubated at 99°C for 3 min and snap-chilled on ice following which primers, forward A_124F:CGCAGCGATGACAAACCT; reverse A_1100R: GATCCCCCGCCTGACCACCACTT for 976 bp region of segment A and forward B_1080F: CTGAAAGGTACGACAAAAGCACAT; reverse B_2002R: TACCAACCTCAACGCCTCATACCT for 922 bp region in segment B were added separately. Then 12.5 μL of 2X RT-PCR buffer and 1 μL enzyme mix were added to set up a 25 μL reaction in thermo-cycler (Biometra T Advanced, Analytika Jena, Jena, Germany). PCR products of size 976 bp and 922 bp, respectively, were amplified by using the following thermal cycling conditions 50°C for 30 min, 95°C for 2 min, followed by 35 cycles at 95°C for 30 s, 62°C and 61°C, respectively, for 1.5 min, 72°C for 1.5 min, and final extension of 72°C for 5 min. PCR products were purified by DNA purification kit (Wizard^® SV Gel and PCR Clean-Up System, Promega Madison, Wisconsin, United States) and sent for sequencing to Macrogen (Seoul, South Korea).

To evaluate whether the addition of guanosine may compete with ribavirin and rescue viral replication, FVSKG2 was added at MOI of 0.01 in CEFs. Ribavirin and guanosine combinations were then added to achieve final concentrations of 0, 0.05, 0.05 mM and 0, 0, 0.025 mM, respectively. Culture supernatants were harvested at 48 Hours Post Inoculation (HPI) to determine viral titers as described in previous studies (35, 45).

Confluent CEFs in 6-well plates were pre-treated with ribavirin at the concentration of 0, 10 and 40 μM in the presence or absence of a fixed concentration of 40 μM guanosine. Separately, confluent CEFs in 6-well plates were pre-treated with mycophenolic acid at 0, 1, 5, and 10 μM in the presence or absence of fixed concentration of 40 μM guanosine. FVSKG2 at MOI of 0.01 was added to the cells and incubated for 2 h. Inoculum was then removed and the cells were replenished with the same concentrations of the ribavirin, guanosine and mycophenolic acid as in pre-treatment, incubated at 37°C and 5% CO2. The viral titer was determined every 48 h post-infection.

Ribavirin was added at 0, 0.05 and 0.1 mM concentrations in CEFs cultured in 24-well plates. RNA was isolated from the ribavirin-treated CEFs 24-h post-treatment using an RNA isolation kit (GeneAll Hybrid-RTM kit, GeneAll Biotechnology, Seoul, South Korea) following the manufacturer instructions. RNA was reverse-transcribed into complementary DNA (cDNA) using a high-capacity cDNA reverse transcription kit (Thermofisher Scientific, Maasachusetts, United States) as per the following conditions: 25°C for 10 min, 37°C for 120 min and 85°C for 5 min and holding at 4°C. Real-time PCR was performed on Analytik Jena, qRT-PCR (Jena, Germany) system using various cytokine-specific primers (Table 1), following the manufacturer’s instructions. The qPCR reaction was set up using 10 μL of GoTaq qPCR Master Mix(2X), 0.5 μL of Forward Primer (20X), 0.5 μL of Reverse Primer(20X), 7 μL of Nuclease-Free Water, 2 μL of cDNA template (or water for the no-template control reactions) The cycling conditions for performing the qPCR were as follows: GoTaq® Hot Start Polymerase activation for 1 cycle at 95°C for 2 min, denaturation at 95°C for 15 sec, annealing and data collection (40 cycles) at temperature 60°C for 30 sec. The relative quantities of cytokine mRNA in ribavirin-treated and non-treated CEFs were normalized to GAPDH mRNA, and the amounts were determined using the 2-ΔΔCt method (46).

Two proteins, RdRp (Uniprot ID: Q9Q6Q5) and IMPDH2 (Uniprot ID: Q5F4A4), and two ligands ribavirin (PubChem ID:37542) and mycophenolic acid (Pubchem ID: 446541) were used in this study. The Crystal Structure of RdRp (PDB ID: 2PGG) (17) was retrieved and used for docking and simulation studies. For IMPDH2, the protein sequence of gallus gallus of 514 residues was obtained from UniProtKB¹ database. The sequence shared 95% similarity with Human IMPDH2 (PDB ID: P12268), and to generate the three-dimensional structure of IMPDH2 of gallus gallus, the structure representing the IMPDH2 with mycophenolic acid (PDB ID: 1JR1) (47) was used as a template for homology modeling. The modeling was carried out using the SWISS-MODEL server² (48). The generated model was subjected to energy minimization and refinement procedures via the ModRefiner server³ (49). The energy-minimized structure was named IMPDH2_GG and was used throughout the study.

AutoDock Tool (50) was used to perform highly extensive molecular docking. Ribavarin was docked into the crystal structure of RdRp (2PGG), and two separate dockings were performed on two different sites. Site 1 represented the vital amino acids viz. ASN402, ASP403, and ASN416 in the catalytic palm of RdRp. Site 2 was built around SER166, a self-guanylation site present in RdRp. For IMPDH2_GG, the potential binding sites were identified based on the structural comparison with human IMPDH2. The crystal structure of IMPDH2 with mycophenolic acid (1JR1) was used as the template to define the binding pocket for IMPDH_GG. Ribavirin and mycophenolic acid were docked into this binding pocket. All the complexes generated were subjected to the molecular dynamics simulation run for further analysis.

GROMACS 2021 series version-2 (51) molecular dynamics package was used to carry out an all-atom molecular dynamics simulation of the four complexes generated from molecular docking. The CHARMM36 (52) force field was used to define the complex of protein, water, and ions in the TIP3P water model. The ligands used, viz. ribavirin, and mycophenolic acid were processed in the CHARMM General Force Field (CGenFF) program⁴ (53). Energy Minimization and conjugate gradient algorithms of GROMACS were employed for optimizing the final protein-ligand complexes. The protein, ligand, water, and ions systems were equilibrated in NVT and NPT ensembles for 100 ps. Using the Parrinello–Rahman barostat, these ensembles maintained the system at 310 K temperature and 1 bar of pressure. Each production run included three replicas of 100 ns. Trajectories were saved every 2 ps/frame for further analysis.

The effect of mutagens on CEFs was analysed by Mann–Whitney U test while the effect of mutagen on FVSKG2 replication, serial passages and multi-step growth curve was analyzed by Repeated measures analysis of variance (ANOVA) followed by Dunnet’s post-test using GraphPad Prism 8 (DNASTAR (Inc., Madison, WI, United States). Nucleotide sequences were aligned and analyzed using DNASTAR (Inc., Madison, WI, United States). Cytokine expression was analyzed by the Mann–Whitney U test (SPSS Version 20) (35, 54). This study performed the primary docking using AutoDock Vina (The Scripps Research Institute, United States) and molecular dynamics simulation using the GROMACS-2021. Discovery Studio Biovia 2021 (Dassault Systèmes, USA) and PyMOL (Schrödinger, LLC) were employed for visualizations.

The cytotoxicity of the four mutagens was evaluated and is summarized in the Figure 1. No significant cytotoxicity was observed after 48 h post-treatment at concentration of 0.25 mM and 0.5 mM, but at 1.0 and 1.5 mM, ribavirin was found to be significantly cytotoxic. 5-fluorouracil, 5-azacytidine and amiloride showed significant cytotoxicity at 0.5 mM concentration and above.

The antiviral effect of ribavirin, 5- fluorouracil, 5-azacytidine and amiloride on replication of FVSKG2 in CEFs was evaluated using a multi-step growth curve. This was done by determining the titer (TCID50/mL) of mutagen-treated viral populations at indicated concentrations relative to the control concentration (0 mM) of mutagens, summarized in Figure 2. The replication of FVSKG2 decreased significantly at 0.05, 0.1, 0.2, and 0.3 mM of ribavirin in a dose-dependent manner (p < 0.0001). When FVSKG2 was treated with 0.3 mM ribavirin, there was about a 3.5-log₁₀ reduction in virus titer at 72 h post treatment, followed by a 4.5-log₁₀ reduction at 120 hpt. Although similar activity was observed with 0.2 mM ribavirin, a 4-log₁₀ reduction and 2.5-log₁₀ reduction were observed in the presence of 0.1 mM or 0.05 mM ribavirin, respectively. Significant suppression of FVSKG2 replication was observed at 0.5 mM of 5-fluorouracil with 2-log₁₀ reduction in virus titer (p < 0.0001). However, no significant antiviral activity was observed with 0.1, 0.2, and 0.3 mM 5-fluorouracil. Treatment with 0.2 and 0.3 mM 5-azacytidine significantly achieved up to 2-log₁₀ reduction in FVSKG2 replication (p = 0.0019). Similarly, high concentrations (1 and 2 mM) of amiloride also caused significant suppression of FVSKG2 replication with up to 2.5-log₁₀ reduction in virus titer (p = 0.0266). Further, no significant antiviral activity was measured at low concentrations of 5-azacytidine (<0.1 mM) and amiloride (<0.05 mM).

Based on the cytotoxicity and antiviral activity of the selected antiviral mutagens, serial passages of FVSKG2 in CEF cells were carried out in the presence of an indicated concentration of each mutagen (Figure 3). We observed that among the mutagens, ribavirin was active against FVSKG2, reducing the viral titer in a concentration-dependent manner. When passaged in the presence of 0.05 mM ribavirin, virus titers dropped for the first two passages causing a significant 4-log₁₀ reduction at p1 and p2. However, the virus disappeared in the third passage and did not emerge until the eleventh passage. Furthermore, FVSKG2 replication was completely suppressed at higher ribavirin concentrations (>0.1 mM). The virus appeared to be less sensitive to 5-fluorouracil and amiloride at indicated concentrations, with no significant change in the virus titer across the 11 passages relative to the control (0 mM). The only exception was the 0.1 mM 5-fluorouracil, which exhibited significant fluctuations in virus titers (p < 0.05). In the presence of 5-fluorouracil at a concentration of 0.1 mM, the virus initially experienced a 1-log₁₀ reduction in titer at passage 2, reaching an equilibrium from passage 4 to passage 6 with 10^5.5 TCID50/mL virus titer. By passage 8, the virus titer increased again to 10^5.5 TCID50/mL and reached a new equilibrium by passage 9 with a 1.5 log₁₀ reduction in virus titer. The virus titer persisted at 10⁵ TCID50/mL from passage 9 to passage 11.

FVSKG2 replication was inhibited to an undetectable level at 0.05 mM of ribavirin in CEFs. However, at 0.025 mM ribavirin, FVSKG2 was replicated at a low titer. No mutation was observed in 1,898 nucleotide bases in FVSKG2 passaged five times in the presence of 0.025 mM ribavirin in CEFs when compared to FVSKG2 passaged for the same number of times in the absence of ribavirin.

At 48 h after treatment, ribavirin inhibited the replication of FVSKG2, resulting in a viral titer of 10² TCID50/mL and a 5.5-log₁₀ reduction in viral titer compared to 0 mM ribavirin. However, when 0.025 mM guanosine was added in addition to ribavirin, the viral titer increased to 10⁶ TCID50/mL at 48 h. Therefore, Ribavirin inhibited FVSKG2 replication, while adding guanosine to the culture revived the virus replication (Figure 4).

The replication of FVSKG2 in CEFs was investigated at indicated concentrations of ribavirin and mycophenolic acid in the presence or absence of 40 mM guanosine. In the non-guanosine treated control, low titers of FVSKG2 have measured at 10 uM ribavirin, reaching a peak titer of almost 10^3.5 TCID50/mL at 48 h post-infection. However, no virus was detected at 40 μm ribavirin in cell-free supernatant. Guanosine addition increased the titers significantly, with titers reaching >10^3.5 TCID50/mL at 48 h post-infection. At 10 μm ribavirin, guanosine addition caused a 1-log₁₀ increase in virus titer and completely rescued the virus at 40 μm ribavirin with titer reaching 10^4.5 TCID50/mL. Consistent with this, similar findings were observed in case of mycophenolic acid, wherein guanosine supplementation repressed the antiviral effect of the mycophenolic acid. Intriguingly, mycophenolic acid inhibited the FVSKG2 replication at the indicated concentration (>1 μM). The addition of guanosine resulted in a 4.5 log₁₀ increase in virus titer at 1 μM mycophenolic acid, which persisted to higher concentrations of mycophenolic acid. The virus achieved a 3.5-log₁₀ increase in titer at 10 μM mycophenolic acid, reaching about 10^3.5 TCID50/mL at 48 h post-infection compared to non-guanosine treated mycophenolic acid control (Figure 5A).

Molecular docking of ribavirin and mycophenolic Acid with IMPDH was performed using Autodock vina. As a potent IMPDH inhibitor, mycophenolic acid was chosen as the standard reference molecule. Analysis of the molecular interactions summarized in Table 2 showed negative binding energy for both molecules within the IMPDH binding pocket. While Mycophenolic Acid (MPA) exhibited a binding energy of −5.9 Kcal/mol, ribavirin with IMPDH exhibited a binding energy of −8.1 Kcal/mol. The molecular interactions revealed the presence of Van der wall interactions as well as hydrogen bonding, indicating efficient ligand binding (Figure 5D). Overall, these studies suggested stable binding of ribavirin compared to the reference molecule within the IMPDH binding pocket (S1 Movie). Ribavirin can thereby prevent viral replication by acting as a potent inhibitor of IMPDH.

The docked complexes were subjected to molecular dynamics simulation and MMPBSA analysis using GROMACS and gmx_MMPBSA, respectively. The residual decomposition energy of the interacting residues was calculated at an interval of 20 ps, representing 500 frames over the 100 ns trajectories. The per residue energy decomposition plot showed stable and persistent binding of ribavirin to IMPDH compared to mycophenolic acid (Supplementary Figure S1). In addition, the energy2bfac tool used to map the binding energy contribution of interacting residues illustrated the involvement of a larger number of residues in the binding of ribavirin within the IMPDH binding pocket (Figure 5B). The Free Energy Landscape (FEL) values of Rib-IMPDH and MPA-IMPDH were constructed and plotted (Figure 5C). A comparison of the FEL values for the complexes revealed that Rib-IMPDH FEL spanned significantly larger areas of PC1 and PC2 with more free energy wells in the region of the global free energy minimum region. These findings indicate greater flexibility and conformational diversity of Rib-IMPDH compared to the MPA-IMPDH complex.

Real-time PCR was used to assess the cytokine levels in CEFs following a 24-h treatment with 0.05 or 0.1 mM ribavirin. As compared to mock-treated CEFs, the expression of IFN-α (Figure 6A), TNF-α (Figure 6B), IL-2, IL-12 (Figure 6C), and IL-10 (Figure 6D) was significantly higher in CEFs treated either with 0.05 or 0.1 mM ribavirin. However, there was no significant difference in the expression of IFN-β between mock-treated and ribavirin-treated CEFs. Further, the expression of IL-6 in CEFs treated with 0.05 or 0.1 mM of ribavirin was significantly lower than in the mock-treated CEFs (Figure 6B).

Ribavirin shows a brief interaction with the two active sites of RdRp (S2 Movie). While site-1, formed of ASP 402, ASN 403, and ASP 416, constitutes the conserved catalytic active site, site-2, formed by SER 166, constitutes the RdRp self-guanylation site (Figure 7A). Ribavirin shows decent binding energy within both target sites. The analysis of the docking results revealed binding energy of −4.39 kcal/mol at site 2 and − 5.51 kcal/mol at site-1 (Figure 7B). The presence of Van der wall interactions and hydrogen bonding indicate efficient binding of ribavirin at both the target sites (Figure 7C).