ORIGINAL RESEARCH article

Front. Aquac., 09 July 2026

Sec. Production Biology

Volume 5 - 2026 | https://doi.org/10.3389/faquc.2026.1815299

Virtual screening and mechanistic elucidation of myricetin as a quorum sensing inhibitor targeting AhyI in Aeromonas hydrophila

  • BL

    Bingxin Li 1,2

  • QG

    Qiyu Gu 1,2

  • BW

    Boqiang Wei 1,2

  • HG

    Hui Geng 1,2

  • LX

    Li Xiong 1,2,3*

  • 1. Key Laboratory of Pesticide and Chemical Biology of Ministry of Education, School of Life Sciences, Central China Normal University, Wuhan, China

  • 2. Hubei Key Laboratory of Genetic Regulation and Integrative Biology, School of Life Sciences, Central China Normal University, Wuhan, China

  • 3. Key Laboratory of Biological Resources and Ecology of Pamirs Plateau in Xinjiang Uygur Autonomous Region, College of Life and Geographic Sciences, Kashi University, Kashi, China

Abstract

Introduction:

The rise of antibiotic-resistant Aeromonas hydrophila threatens global aquaculture, necessitating the development of anti-virulence strategies such as quorum sensing (QS) inhibition. This study aimed to identify natural quorum sensing inhibitors targeting the AHL synthase AhyI, building upon ongoing research that has demonstrated the importance of such inhibitors in controlling bacterial communication and potential applications in treating bacterial infections.

Methods:

We utilized computer-aided drug design techniques, employing AlphaFold2 to model the structure of AhyI, followed by Through virtual screening of 6,079 natural compounds using molecular docking with Schrödinger Glide and AutoDock,

Results:

The flavonoid myricetin was identified as a top candidate and validated in vitro. At sub-inhibitory concentrations, myricetin significantly suppressed key virulence phenotypes in A. hydrophila AH72, including motility, extracellular enzyme secretion, hemolysis, and biofilm formation. Target validation using a heterologous expression system and UPLC-MS/MS confirmed that myricetin directly inhibits AhyI activity, reducing the production of multiple AHL signaling molecules. Transcriptomic analysis revealed a concentration-dependent mechanism: lower concentrations disrupted iron transport, while higher concentrations imposed a broad metabolic burden by downregulating central energy and amino acid pathways.

Discussion:

Recent studies have shown that myricetin functions as a multi-targeted anti-virulence agent, effectively disrupting quorum sensing, metabolic pathways, and stress response mechanisms, thereby showcasing its significant potential. as a lead compound for developing sustainable disease management strategies in aquaculture.

1 Introduction

1.1 Hazards and control status of Aeromonas hydrophila

Aeromonas hydrophila (AH) is a Gram-negative facultative anaerobe that spreads via water pollution and the food chain (), infecting fish, amphibians, birds, and other organisms (; ). It can cause diseases such as fish gill rot, red skin disease (), and even affect humans food poisoning (; ). With the expansion of aquaculture in China, high-density farming systems have led to frequent outbreaks of AH-induced diseases. According to the 2021 National Fisheries Economic Statistics Bulletin, China’s aquaculture scale ranks first globally. However, alongside the expansion of aquaculture scale, disease issues have become increasingly prominent. The proportion of annual disease-affected areas According to the National Bureau of Statistics, the direct economic losses caused by natural disasters in 2024 exceeded 401.11 billion yuan, with yield losses approaching 30%, resulting in a significant impact on the national economy. Among traditional control methods, chemical drugs easily cause environmental residues and bioaccumulation (), while the misuse of antibiotics speeds up the emergence of multidrug-resistant strains (; ). Vaccine prevention encounters limitations in immune coverage and the necessity to optimize the efficacy of large-scale vaccine application (), necessitating the development of novel, environmentally friendly antimicrobial strategies.

1.2 Analysis of AHL-mediated quorum sensing mechanisms and inhibitory effects

Quorum sensing (QS) systems are intercellular communication mechanisms mediated by signaling molecules in bacteria, which regulate key pathogenic behaviors, including virulence factor secretion, biofilm formation, and motility (; ). In the QS systems of Gram-negative bacteria, signaling pathways mediated by N-acetyl-β-lactamoyl-β-D-glycine (AHL) play a dominant role role (). This system consists of two core functional components: LuxI family proteins, which are responsible for AHL synthesis, and LuxR family proteins, which act as signal receptors (). AHL synthases generate a range of signaling molecules that have varying acyl side-chain lengths. These molecules are able to freely diffuse and permeate through cell membranes. As the bacterial population density rises, the extracellular AHL concentrations gradually build up. Upon reaching a specific threshold, these signaling molecules enter the cells bind to AHL receptor proteins. These receptors, classified as transcription factors, undergo conformational changes when bound to AHL, thereby activating their DNA-binding ability and subsequently regulating the transcription of downstream genes ().

In Aeromonas hydrophila, the quorum sensing system is well-characterized by the AhyI/AhyR pair. The AhyI protein, a member of the LuxI family, synthesizes various acyl-homoserine lactone (AHL) signaling molecules, including C4-HSL, C6-HSL, and C8-HSL, which are crucial for coordinating gene expression and cellular activities. distinct regulatory functions (). The AhyR protein belongs to the LuxR family of receptors; its N-terminus binds to AHL ligands, while its C-terminus contains a DNA-binding domain. When bound to AHLs, AhyR dimerizes and binds to specific promoter sequences, thereby regulating gene expression either positively or negatively (Figure 1) (). In contrast to traditional bactericidal drugs, inhibitors targeting the QS system reduce bacterial virulence by disrupting bacterial communication, thus making them less prone to inducing resistance () and providing a new direction for the development of antimicrobial drugs.

Figure 1

).

1.3 Application of computer-aided drug design in inhibitor screening

Computer-aided drug design (CADD) has emerged as a core tool in drug development owing to its high efficiency and precision (). Molecular docking () and virtual screening () technologies facilitate the rapid prediction of binding modes and affinities between small molecules and target proteins, substantially reducing Experimental screening incurs costs (). Given that different molecular docking software utilizes diverse algorithms and scoring functions, the resulting docking outcomes may exhibit variations (). Hence, this study combines homology modeling with multi-software cross-validation techniques to screen natural compounds targeting the AhyI synthase, with the objective of identifying potent and safe quorum sensing inhibitors and offering novel drug candidates for controlling Aeromonas hydrophila infections.

2 Materials and methods

2.1 Strains, plasmids, reagents, and culture conditions

The Aeromonas hydrophila strain AH72–0722 was cultured in medium supplemented with 50 μg/mL ampicillin at 28 °C with shaking at 180 rpm. Chromobacterium violaceum CV026, a mini-Tn5 mutant of C. violaceum ATCC 31532, which does not secrete AHLs but produces violacein in response to exogenous short-chain AHLs (C4 - C8-HSL), was used as a biological reporter strain (). It was cultured in LB medium supplemented with 50 μg/mL kanamycin at 30 °C with shaking at 180 rpm. Escherichia coli DH5α and BL21(DE3) were respectively employed as host strains for molecular cloning and protein expression. The cloning vector pMD18-T and the expression vector pET-28a were utilized for gene cloning and expression.

Candidate inhibitors, namely myricetin, mangiferin, gastrodin, andrographolide, palmatine hydrochloride, piperine, sophoricoside, chrysin, and hesperetin (with purities ranging from 95.0% to 99.9%), were dissolved in 1% dimethyl sulfoxide (DMSO) to prepare a 102.4 mg/mL stock solution, which was diluted before use.

2.2 Construction and validation of the AhyI protein model

Utilizing the amino acid sequence of AhyI synthetase (GenBank ID: OOD36466.1), a three-dimensional structural model was generated through the AlphaFold2 platform (). The model’s stereochemical integrity and structural feasibility were subsequently assessed using the SAVES suite, Dali Server, and Molprobity, tools that are integral to validating the accuracy of molecular models in stereochemistry.

2.3 Molecular docking and virtual screening

A library of 6,079 natural compounds was prepared and Utilizing Open Babel software, the data was consolidated into a single SDF file. Batch molecular docking operations were carried out using Schrödinger Suites 2021-3. The AhyI protein model underwent preprocessing, and a docking box was subsequently generated for the first predicted binding pocket. Based on binding energy, the top nine compounds were chosen for subsequent semi-flexible docking with AutoDock4, and the final complexes were visualized utilizing PyMOL.

2.4 In vitro phenotypic assays for virulence inhibition

The Minimum Inhibitory Concentration (MIC) was determined by a two-fold dilution method (final concentrations: 0.004-0.512 mg/mL), with the MIC defined as the lowest concentration without bacterial growth after 24 h incubation at 28 °C. The growth of bacterial cultures was tracked by regularly measuring the optical density at 600 nm (OD600) every two hours post-inoculation into nutrient broth (NB) medium supplemented with varying concentrations of antibiotics.

Swarming and swimming motilities were assessed using semi-solid media (5% and 3%) according to the methodological system described by Fohad et al (). agar, respectively). The diameter of cell migration was quantified following a 48-hour incubation period in the Transwell assay. Lipase activity was determined by the method of Gao et al (), expressed as the ratio of precipitation zone diameter to colony diameter on agar containing 1% Tween 80. The activity of extracellular protease was measured using an improved azocasein assay method developed by Swift et al (). The hemolytic activity was determined using the method detailed by Zhang et al (), which involves the incubation of erythrocytes with specific antibodies and complement, followed by the calculation of the hemolysis rate based on the release of hemoglobin. OD540 values. Biofilm formation was assessed using a modified microplate method (), which involves the use of crystal violet staining and subsequent quantification by measuring the optical density ratio of OD570/OD600 after 72 hours of incubation.

2.5 Prokaryotic expression and purification of AhyI protein

The ahyI gene was amplified via PCR from the genomic DNA of A. hydrophila AH72 and subsequently cloned into the pMD18-T vector. The primers used for PCR are shown in Table 1. After sequence verification, the gene was subcloned into the pET-28a expression vector and transformed into E. coli BL21(DE3).

Table 1

PrimersPrimer sequences (5’→3’)
ahy I-FCGGAATTCATGCTTGTTTTCAAAGGAAAATTAA
ahy I-RCCCAAGCTTTTATTCGGTGACCAGTTCGC

PCR amplification primer sequences of ahyI gene.

Bold letters indicate restriction enzyme recognition sites: 1 EcoRI (GAATTC) and 2 HindIII (AAGCTT).

Protein expression was induced using IPTG, and the His-tagged AhyI protein thus produced was predominantly found in inclusion bodies. The inclusion bodies were solubilized, following which the protein was purified via nickel ion affinity chromatography under denaturing conditions. Subsequently, the purified protein was refolded by employing a stepwise dialysis method with a decreasing urea gradient (6 M → 0 M).

2.6 Quorum sensing signal (AHL) detection

The effect of myricetin on AHL production was assessed in A. hydrophila AH72 and the recombinant PET-28a-ahyI/BL21 strain. For qualitative detection, supernatants were introduced into wells in LB double-layer agar plates containing the CV026 biosensor, and the diameters of the purple circles were measured post-incubation.

The method for UPLC-MS/MS quantification of AHLs quorum-sensing signaling molecules was referenced from Yan C et al (), which utilizes a biological approach based on spectrophotometry and a standard curve of concentration versus absorbance. Chromatography: HE SP ODS-A column. (150×4.6 mm, 5 μm), mobile phase (methanol → 0.1% formic acid + 2 mmol ammonium acetate in water) with gradient elution (Table 2), flow rate 0.4 mL/min, column temperature 40 °C, injection volume 5 μL.​ Mass spectrometry was conducted in ESI+ mode, and AHLs were quantified using standard curves (R²≥0.99) with C7-HSL as an internal standard.

Table 2

Time (min)A%B%
06040
181000
201000
216040
256040

Chromatographic elution program parameters.

2.7 Transcriptome sequencing and bioinformatics analysis

A. hydrophila AH72 was treated with myricetin concentrations of 128 μg/mL and 512 μg/mL for one compound, 128 μg/mL for sophoricoside, or a 1% DMSO control. After 24 h of culture, bacterial pellets were collected for total RNA extraction. RNA quality control requires a minimum of 2 μg total RNA with a concentration greater than 100 ng/μL, an OD260/OD280 ratio between 1.8 and 2.2, and a RIN value indicating high integrity.

RNA libraries were constructed using the TruSeq Stranded Total RNA Library Prep Kit. The process included rRNA depletion, mRNA fragmentation, first- and second-strand cDNA synthesis (where dUTP replaced dTTP), end repair, and adapter ligation, and degradation occurred in the second strand. Sequencing was carried out on NovaSeqXPlus and DNBSEQ - T7 platforms. Clean data were aligned to the A. hydrophila ZYAH72 reference genome, and gene expression levels were quantified as TPM values using RSEM. Differentially expressed genes (DEGs) were identified using DESeq2, with the screening criteria set as Fold Change ≥ 2 and an adjusted p - value < 0.05.

2.8 Statistical analysis

All experimental data were presented as the mean ± standard deviation (SD), derived from at least three independent replicates (n ≥ 3). Statistical significance was assessed via an independent sample t-test, with p-values ≤ 0.05 and ≤ 0.01 deemed statistically significant.

3 Results

3.1 AhyI protein model construction and validation results

The three-dimensional simulated structure of the AhyI synthase from Aeromonas hydrophila, designated AH2, was predicted with high accuracy using AlphaFold2, a deep learning-based protein structure prediction model developed by DeepMind. This structure, comprising 207 amino acids, was made available for further research and analysis. Almost 200 amino acids attained pLDDT scores surpassing 90%. The three-dimensional structure features typical α-helices, β-folds, and random coils (Figure 1).

SAVES validation showed that the Ramachandran Plot indicated 86.6% of amino acid residues in the model were located within the optimal region. The ERRAT Overall Quality Factor was 86.15, and the VERIFY 3D results indicated a pass (Figure 2). The Dali Server analysis indicates an RMSD value of 1.7 Å between AH2 and the homologous protein 1ro5-A; Molprobity validation shows that 98.85% of side chains are in favorable conformations with zero Cβ deviation (Table 3). All metrics meet high-quality model standards, enabling their use in subsequent docking experiments.

Figure 2

Table 3

GroupTypesPercentGoal
All-Atom
Contacts
Clashscore,
all atoms:
21.7228thpercentile*(N = 1784, all resolutions)
Protein
Geometry
Poor rotamers00.00%Goal: <0.3%
Preferred rotamers17298.85%Goal: >98%
Ramachandran outliers31.46%Goal: <0.05%
Ramachandran favored19595.12%Goal: >98%
Rama distribution Z-score0.16 ± 0.60Goal: absolute Z-score < 2
MolProbity score^2.1766thpercentile*(N = 27675, 0Å - 99Å)
Cβ deviations >0.25Å00.00%Goal: 0
Bad bonds:31/17011.82%Goal: 0%
Bad angles:5/23020.22%Target: <0.1%
Peptide OmegasCis Prolines:0/100.00%Expected: ≤1 per chain, or ≤5%
Low-resolution CriteriaCaBLAM outliers21.0%Goal: <1.0%
CA Geometry outliers00.00%Goal: <0.5%
Additional validationsChiral volume outliers0/248
Waters with clashes0/00.00%See UnDowser table for details

Stereochemical parameter statistics table of AH2 after Molprobity operation.

3.2 Molecular docking screening results

This study employed molecular docking technology to screen a library comprising 6,079 compounds for potential inhibitors of AhyI synthase (AH2 model). Initially, batch molecular docking was carried out between the library of 6,079 compounds and the AH2 model at pH 7.4, utilizing the Glide module of Schrödinger Suite 2021-3. Based on docking binding energy scores and drug accessibility, the top nine candidate small molecules were preliminarily selected: gastrodin, hesperidin, myricetin, morin, pamatin hydrochloride, sophocarpin, piperine, mangiferin, and andrographolide. 2D force analysis diagrams depicting the interactions between the ligands and AH2 were generated (Figure 3). Among these, gastrodin exhibited the highest docking binding energy of -8.33 kJ/mol, while andrographolide showed the lowest at -4.35 kJ/mol. Using the 2D Sketcher module in Schrödinger software, hydrogen bond interactions The π-π bond interactions between the AH2 protein and the nine compound ligands are visualized in Table 4. Further analysis using molecular dynamics simulations and an unsupervised deep learning framework revealed that these ligands predominantly interact with critical residues within the AH2 active pocket, such as Asp35, Phe82, Val143, Leu170, and Ala172. Despite the differences in their specific interaction networks, these interactions are key to understanding the ligand’s affinity and the AH2 active pocket’s functionality. This preliminary finding reveals the dual polar and hydrophobic characteristics of the AH2 binding site.

Figure 3

Table 4

Candidate compoundsCAS No.ΔG (kJ/mol)Number of hydrogen bondsNumber of
π-π bonds
Gastrodin62499-27-8-8.3360
Hesperidin422513-13-1-8.0651
Myricetin529-44-2-7.8552
Populin480-40-0-7.0112
Bamaprezole Hydrochloride10605-02-4-6.9513
Sophocarpin152-95-4-6.7731
Piperine94-62-2-6.4821
Mangiferin4773-96-0-6.3723
Andrographolide5508-58-7-4.3510

presents the outcomes of molecular docking simulations conducted with the Schrödinger software, where AH2 was docked with nine distinct small molecule ligands.

In order to assess the reliability of the batch screening results, we subsequently performed independent semi-flexible docking validation on the nine candidate compounds using AutoDock 4 software. Table 5 presents the molecular docking binding energy data for the nine small-molecule ligands, which is crucial for understanding their interaction with the target protein and predicting their potential as therapeutic agents. These docking results generally align with the Glide screening trends: In a molecular docking study using AutoDock 4, myricetin demonstrated the highest binding affinity with a binding energy of -8.34 kJ/mol, whereas andrographolide exhibited the lowest at -4.77 kJ/mol. The three-dimensional visualization and hydrogen bond analysis of the docked complexes were carried out using PyMOL software. The binding patterns of the nine ligands The interactions with the AH2 protein are presented in Figure 4, which reveals distinct binding modes formed between different ligands and AH2. For example, sophocarpin formed up to eight hydrogen bonds with residues Asp35, Leu170, Ala172, and Val173, demonstrating the strongest potential for polar interactions; in contrast, piperine formed only one hydrogen bond with Ala172. A comprehensive analysis underscores the frequent presence of residues Leu170, Ala172, and Asp35 in multiple ligand-receptor complexes, suggesting they may represent conserved key functional sites within the AH2 protein binding pocket.

Table 5

Candidate compoundsCAS No.ΔG (kJ/mol)Number of hydrogen bonds
Myricetin529-44-2-8.345
Gastrodin62499-27-8-8.196
Bamatide hydrochloride10605-02-4-7.221
Hesperidin422513-13-1-7.205
Mangiferin4773-96-0-7.106
Populin480-40-0-6.654
Sophocarpin152-95-4-6.478
Piperine94-62-2-6.451
Andrographolide5508-58-7-4.775

The data obtained by docking AH2 with nine different small molecule ligands using AutoDock technology, as detailed in the AutoDock molecular docking tutorial.

Figure 4

Integrating docking results from two distinct algorithm platforms—Schrödinger’s Glide module and AutoDock 4—have been utilized to draw the following conclusions. The interaction network, composed of polar and hydrophobic residues Asp35, Leu170, and Ala172, establishes critical anchoring forces that facilitate ligand binding. Second, π-π stacking interactions, as evidenced by studies on ternary mixed complexes (Reference 3), significantly enhance the binding affinity and selectivity of ligands containing aromatic rings (e.g., naringin, pamatin hydrochloride) through the stabilization provided by aromatic residues such as Phe82 and Trp34. Results from the two The application of multiple independent docking methods, such as AutoDock, Schrödinger’s Glide, and ESSENCE-Dock, has been shown to corroborate each other, thereby increasing the confidence in the outcomes of virtual screening.

Finally, the binding energies calculated by Schrödinger software and AutoDock 4 were ranked in ascending order (Table 6). Based on this ranking, the priority order of compounds selected for subsequent in vitro enzyme activity inhibition experiments is: gastrodin, myricetin, naringin, bamatin hydrochloride, morin, mangiferin, sophorcarpin, piperine, and andrographolide. Through systematic computational modeling, this study offers theoretical foundations and lead compound clues for the development of novel inhibitors targeting AhyI synthase.

Table 6

Candidate compoundsCAS No.ΔG (kJ/mol)
Gastrodin62499-27-8-8.19
Myricetin529-44-2-8.34
Hesperidin422513-13-1-7.20
Bamatriptan hydrochloride10605-02-4-7.22
Populin480-40-0-6.65
Mangiferin4773-96-0-7.10
Sophocarpin152-95-4-6.47
Piperine94-62-2-6.45
Andrographolide5508-58-7-4.77

Average binding energies of AH2 after molecular docking with nine small-molecule ligands.

3.3 In vitro virulence inhibition phenotypic analysis results

The minimum inhibitory concentration (MIC) test results for the Aeromonas hydrophila AH72 strain indicated that, aside from myricetin and sophoricoside, the other seven candidate inhibitors exhibited no significant inhibitory impact on the strain, with the MIC values of both myricetin and sophoricoside against AH72 measured at 512 µg/mL. Analysis of the bacterial growth curve demonstrated that, in the absence of inhibitors, applying myricetin at a concentration of 128 µg/mL significantly hindered the growth of the AH72 strain (Figure 5). This indicates that myricetin exerts a direct suppressive influence on fundamental bacterial proliferation at sub-MIC levels.

Figure 5

Quorum sensing (QS) is a communication mechanism among bacteria that regulates the swarming and swimming motility of Aeromonas hydrophila through the production of autoinducer molecules known as N-acylhomoserine lactones (AHLs). This signaling system promotes the expression of flagellar genes, enhances the production of virulence factors, and coordinates these motility behaviors with pathogenic processes such as host colonization, invasion, and biofilm formation. Consequently, this part of the experiment assessed the inhibitory effects of myricetin and sophoricoside on the virulence phenotypes of the AH72 strain.

The evaluation of motility phenotypes revealed potent inhibitory effects. For swarming motility, both myricetin and sophoricoside, at a concentration of 128 µg/mL, significantly reduced the colony migration diameter compared to the control. Myricetin’s effect was notably concentration-dependent (Figures 6A, B). In swimming motility assays, myricetin, at concentrations of 256 µg/mL and 512 µg/mL, effectively decreased the colony diameter in a concentration-dependent manner. Similarly, sophoricoside at high concentrations (256 µg/mL and 512 µg/mL) also reduced migration, indicating its broad inhibitory capability against bacterial motility mechanisms essential for colonization (Figures 6C, D).

Figure 6

The impact on virulence factor secretion was distinct between the two compounds. Lipase activity was significantly inhibited by myricetin at 128 µg/mL and 512 µg/mL, as evidenced by a decreased precipitation zone to colony diameter ratio. In contrast, sophoricoside treatment showed no significant alteration in lipase activity compared to the control (Figures 6E, F). This divergence suggests a potential difference in their primary molecular targets within the virulence regulatory network.

Both compounds were found to effectively suppress extracellular protease activity. Myricetin exhibited a concentration-dependent reduction in OD400 values, with a concentration of 512 µg/mL resulting in a decrease from an average of 0.48 to 0.16, as observed in the study. Sophoricoside also exhibited inhibitory effects, and at a concentration of 128 µg/mL, it produced a significant decrease in activity (Figure 7A). Hemolytic activity, which serves as a critical marker for tissue invasion and iron acquisition, was also attenuated. Myricetin at 128 µg/mL and 512 µg/mL showed good inhibitory effects, while all three tested concentrations of sophoricoside reduced hemolysis, with 128 µg/mL being particularly effective (Figure 7B).

Figure 7

Ultimately, both inhibitors interfered with the development of biofilms, a critical factor in the emergence of antibiotic resistance and the persistence of infections. At a concentration of 512 µg/mL, myricetin effectively reduced biofilm production in AH72. Sophoricoside demonstrated a strong overall inhibitory profile across all tested concentrations, with 128 µg/mL causing a significant reduction in biofilm biomass (Figure 7C). The collective inhibition of these diverse virulence phenotypes—motility, exoenzyme secretion, hemolysis, and biofilm formation—strongly supports the hypothesis that myricetin and sophoricoside function as anti-virulence agents by interfering with the quorum sensing (QS) system, which coordinately regulates these pathogenicity traits in A. hydrophila.

3.4 Purification of aeromonas hydrophila AhyI protein

After the prokaryotic expression vector PET-28a-ahyI was constructed and transformed into E. coli BL21(DE3) for protein expression, it was found that the expressed protein predominantly resided in inclusion bodies regardless of induction was carried out at 16 °C or 28 °C. Notably, only when the induction was performed at 16 °C for 24 hours was a small amount of protein detected in the supernatant. Consequently, the final induction condition was set to 0.5 mM IPTG at 28 °C for 6 hours. After that, the cells were disrupted, the inclusion bodies were washed, and the protein was denatured using a denaturing buffer containing a high concentration of urea. Subsequently, purification was carried out via nickel ion affinity chromatography (low-concentration imidazole for impurity removal, high-concentration imidazole for target elution). Purification results (Figure 8A) indicated that the eluates containing 200 mM and 300 mM imidazole yielded high-purity target protein. The protein was subsequently combined and refolded through a gradient urea reduction process (6→0 M, over 48 hours), achieving a refolding rate of 68%. The refolded protein was successfully solubilized, exhibiting a molecular weight consistent with the expected 28 kDa, as confirmed by SDS-PAGE analysis. The protein was subsequently concentrated using PEG8000 and stored at -80 °C to maintain its stability. The final concentration of the purified AhyI protein was determined to be 1.53 mg/mL, as evidenced by the SDS-PAGE analysis (Figure 8B).

Figure 8

3.5 Detection of AHLs signal molecules

When myricetin (1/2, 1/4, 1/8 MIC) was added to Aeromonas hydrophila AH72 at OD600 = 0.3, all groups entered the exponential growth phase post-addition to 6.0 h (with reduced growth compared to the drug-free control) and maintained stable OD600 values during 8.0~24.0 h. For pET-28a-ahyI/BL21, myricetin was added at an OD600 of 0.3, and 0.5 mM IPTG was added at an OD600 of 0.6; the strain entered the exponential phase 6.0 h after induction and then the stationary phase During the time period from 8.0 to 18.0 h, 32 μg/mL myricetin (1/8 MIC) had a minimal effect on the growth of both strains, whereas concentrations of 64 μg/mL and above significantly inhibited the growth of pET-28a-ahyI/BL21 in a concentration-dependent manner (Figure 9).

Figure 9

The diameters of the purple circles (indicating the levels of short-chain AHLs, as shown in Figures 10, 11) revealed that 64 μg/mL and 128 μg/mL myricetin (1/4, 1/2 MIC) strongly inhibited violacein production in CV026 (concentration-dependent), while 32 μg/mL had mild, non-significant inhibition. Since high concentrations affected bacterial growth, 32 μg/mL myricetin (1/8 MIC) was selected for subsequent experiments to minimize growth interference, with 18 h culture to stationary phase.

Figure 10

Figure 11

UPLC-MS/MS analysis (mobile phase: methanol/water with 0.1% formic acid + 2 mmol/L ammonium acetate) achieved good separation of 6 AHL standards (C4~C14-HSL), all showing characteristic fragments m/z 102.0555 and 74.0607 (Figures 12, 13). Mass spectra and ion chromatogram comparison with standards confirmed that both Aeromonas hydrophila AH72 and pET-28a-ahyI/BL21 produced six AHL components (Figures 14, 15): C4-HSL, C6-HSL, C8-HSL, C10-HSL, C12-HSL, and C14-HSL, matching standards in precursor ion mass, retention time, and tandem mass spectral characteristic product ions.

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16 displays the relative percentage content of AHLs in both the AH72 strain and the pET-28a-ahyI/BL21 strain. The results indicate that six signal molecules could be identified in both strains, with C4-HSL being the predominant AHL in each. In Aeromonas hydrophila, C6-HSL was the second most abundant signal molecule. Other medium- and long-chain AHLs (C8 - C12-HSL) were present in relatively small yet detectable quantities. Owing to differences in the intracellular environments of the two strains, including variations in the types and proportions of acyl-ACPs, the relative percentage content of AHLs in the pET-28a-ahyI/BL21 strain showed distinct characteristics compared to the AH72 strain. In the recombinant strain, apart from C4-HSL, C12-HSL and C8-HSL ranked as the second and third most abundant signal molecules, respectively, and the levels of the remaining AHLs were also relatively low.

Figure 16

Both A. hydrophila AH72 and pET-28a-ahyI/BL21 strains were treated with 32 μg/mL myricetin (1/8 MIC). A comparative analysis of the ion chromatograms for the six AHLs produced by the two strains (Figures 17, 18) showed that myricetin significantly inhibited all six AHLs, with the strongest inhibitory effects on C4-HSL and C14-HSL, followed by C10/C12-HSL, and weaker inhibition on C6/C8-HSL. In the recombinant E. coli pET-28a-ahyI/BL21 strain, myricetin inhibited 5 AHLs (C4-HSL, C8~C14-HSL), strongly suppressing C4-HSL (most abundant) and C8-HSL, but slightly promoting C6-HSL (least abundant). This promotion may result from low-dose myricetin activating E. coli stress responses (e.g., cAMP-CRP) to enhance AhyI expression, with minimal competition for C6-ACP substrate.

Figure 17

Figure 18

In conclusion, the ahyI gene from AH72 encodes an AHL synthase that produces short/medium/long-chain AHLs in E. coli BL21(DE3). At 32 μg/mL, myricetin targets AhyI exhibits the ability to inhibit all six AHLs in AH72, with the most pronounced inhibitory effect observed on C4-HSL.

3.6 Transcriptomic analysis of myricetin and sophoricoside against A. hydrophila

Four comparison groups were set: Y1-D (128 μg/mL myricetin vs. 1% DMSO), Y2-D (512 μg/mL myricetin vs. 1% DMSO), H-D (128 μg/mL sophoricoside vs. 1% DMSO), and Y1-Y2 (128 vs. 512 μg/mL myricetin). The control group expressed 2958 genes, 128 μg/mL myricetin group 2494, 512 μg/mL myricetin group 3344, and 128 μg/mL sophoricoside group 2495, with 2367 common genes across all groups.

DEG screening (volcano plots, Figure 19) revealed: Y1-D contained 54 differentially expressed genes (DEGs), with 47 upregulated and 7 downregulated; Y2-D had 253 DEGs, including 84 upregulated and 169 downregulated; H-D exhibited 128 DEGs, of which 108 were upregulated and 20 were downregulated. High-concentration myricetin at a dose of 512 μg/mL induced a greater number of downregulated differentially expressed genes (DEGs) in a concentration-dependent manner, whereas sophoricoside at 128 μg/mL resulted in a slightly higher number of DEGs compared to myricetin at the same concentration of 128 μg/mL.

Figure 19

The gene expression profile of Aeromonas hydrophila strain AH72 was significantly altered following treatment with myricetin, as revealed by Gene Ontology (GO) enrichment analysis. The observed changes provide molecular insights into the anti-virulence mechanisms of this compound, particularly in the context of quorum sensing (QS) disruption.

In the low-concentration myricetin group (Y1 vs. DMSO control), a notable enrichment was observed in biological processes and molecular functions associated with iron homeostasis (Figure 20). Key terms encompassed iron ion transport, siderophore transport, ferrous iron transmembrane transporter activity, as well as iron-sulfur cluster binding. This pattern strongly indicates that at a lower concentration, myricetin mainly disrupts the bacterial iron acquisition machinery. Given that iron is a crucial cofactor for numerous virulence determinants, including hemolysins and certain extracellular enzymes, this disruption offers a plausible explanation for the reduced hemolytic activity and potentially other iron - dependent toxicities observed in phenotypic assays. The simultaneous enrichment of general protein transport and localization terms may suggest a broader, secondary effect on cellular trafficking.

Figure 20

Treatment with a high concentration of myricetin (Y2 vs. DMSO control) elicited a more extensive transcriptional response, which reflects broader metabolic stress (Figure 21). Notably, the term “biofilm” exhibited significant enrichment in the cellular component category, directly aligning with the inhibition of biofilm formation observed in vitro. The molecular function profile shifted towards transport activities involving diverse substrates, such as organic acids, C4-dicarboxylates, and amino acids, which are transported via ABC transporters. Furthermore, biological processes involving glycerol and alditol metabolic processes were significantly affected. This comprehensive disturbance in nutrient transport and central carbon metabolism likely starves the QS system of critical precursors and energy, thereby dampening the expression of a wide array of QS-regulated virulence phenotypes, including biofilm formation, motility, and exoenzyme production.

Figure 21

A direct comparison between the two myricetin concentrations (Y1 vs. Y2) highlighted concentration-dependent effects (Figure 22). The higher concentration specifically enriched terms related to nitrogen group transferase activity, NAD binding, and pyrimidine/nucleobase metabolic processes. Escalating the myricetin dose intensifies its interference with core metabolic pathways, particularly nucleotide metabolism, a fundamental process for bacterial growth and the rapid gene expression changes necessary for a robust QS response.

Figure 22

The classification of QS and metabolism-related genes enriched by GO is listed in Table 7. Overall, the GO enrichment results demonstrate that myricetin exerts a multi-faceted effect on A. hydrophila. At a lower concentration, it specifically targets the vulnerability of iron acquisition. At a higher concentration, it triggers a state of widespread metabolic disruption, impacting biofilm integrity, substrate transport, and energy metabolism. These transcriptional perturbations collectively impair the bacterial cell’s ability to maintain functional QS signaling and carry out the coordinated expression of virulence factors. This analysis corroborates the phenotypic findings and positions myricetin as a compound that disrupts QS not by a single target inhibition, but by applying metabolic pressure at multiple nodes within the virulence regulation network.

Table 7

GOGene symbolGene functionInter-group comparison
Y1-DY2-D
GO:0016020 (Biomembrane transport activity)BFW97_21515hemolysin D/5.63
BFW97_22910energy transducer TonB/-1.41
BFW97_21520EmrB/QacA family drug resistance transporter/4.50
BFW97_01560DoxX family protein/2.11
BFW97_02765phage shock protein G/2.84
BFW97_07290efflux transporter periplasmic adaptor subunit/1.03
BFW97_07295multidrug efflux RND transporter permease/1.58
BFW97_10685xanthine permease XanP/1.29
BFW97_10695permease/1.96
BFW97_22220amino acid permease/-1.36
BFW97_10720hypothetical protein/-1.84
BFW97_09745TonB-dependent receptor/1.84
BFW97_13190hypothetical protein/-1.37
BFW97_13860arsenical-resistance protein/1.35
GO:0005215
(Transport activity)
BFW97_16885MATE family efflux transporter-1.33-1.57
BFW97_21520EmrB/QacA family drug resistance transporter2.834.50
BFW97_00080potassium-transporting ATPase subunit B/-2.94
BFW97_00085potassium-transporting ATPase subunit A/-2.88
BFW97_18930multidrug resistance protein MdtH/-1.99
BFW97_22900biopolymer transporter ExbD2.44/
BFW97_19930arginine ABC transporter substrate-binding protein/1.66
BFW97_06005dipeptide/tripeptide permease/2.03
BFW97_13480MFS transporter/-1.36
GO:0005342 (Organic acid transmembrane transporter activity)BFW97_18920C4-dicarboxylate ABC transporter/1.40
BFW97_12910anaerobic C4-dicarboxylate transporter DcuC/1.23
BFW97_09240lactate permease/3.88
BFW97_01710hypothetical protein/2.12
GO:0008514 (Organic anion transmembrane transport activity)BFW97_19935arginine ABC transporter ATP-binding protein ArtP/1.74
GO:0015031 (Transport activity)BFW97_22905biopolymer transporter ExbB2.77/
GO:0022857 (Protein transport transmembrane transporter activity)BFW97_21520EmrB/QacA family drug resistance transporter/4.50
GO:0071949 (FAD binding)BFW97_092604Fe-4S ferredoxin/1.45
BFW97_10675molybdopterin-dependent oxidoreductase FAD-binding subunit/1.61
BFW97_10705xanthine dehydrogenase FAD-binding subunit XdhB/2.35
GO:0050660 (FAD binding)BFW97_092604Fe-4S ferredoxin/1.45
BFW97_13835Alkyl hydroperoxide reductase subunit F/1.11
BFW97_05630fumarate reductase (quinol) flavoprotein subunit/1.33
GO:0051536 (Iron-sulfur cluster binding)BFW97_09250iron-sulfur cluster-binding protein1.58
BFW97_092604Fe-4S ferredoxin1.29
BFW97_09805putative heme utilization radical SAM enzyme HutW2.73
BFW97_09455hydrogenase 2 small subunit-1.57
GO:0015424 (ABC-type amino acid transporter activity)BFW97_14145histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein/1.16
BFW97_19935arginine ABC transporter ATP-binding protein ArtP/1.74
GO:0015556 (C4-dicarboxylate transmembrane transporter activity)BFW97_12910anaerobic C4-dicarboxylate transporter DcuC/1.23
BFW97_18920C4-dicarboxylate ABC transporter/1.40
GO:0047324 (Carbamoyl phosphate synthase activity)BFW97_01410dihydroxyacetone kinase subunit L/-1.15
BFW97_01415dihydroxyacetone kinase/-1.21
GO:0004088 (Carbamoyl phosphate synthase activity)BFW97_08375carbamoyl phosphate synthase small subunit/1.77
BFW97_08380carbamoyl phosphate synthase large subunit/1.59
GO:0051540 (Metal cluster binding)BFW97_092604Fe-4S ferredoxin1.29/
GO:0046915 (Transition metal ion transmembrane transporter activity)BFW97_08290ferrous iron transport protein B2.03/
GO:0051538 (3iron-4sulfur cluster binding)BFW97_09455hydrogenase 2 small subunit-1.57/
GO:0008892 (Guanine deaminase)BFW97_10690guanine deaminase/1.95
GO:0006526 (Arginine biosynthesis)BFW97_08375carbamoyl phosphate synthase small subunit/1.77
GO:0009084 (Glutamine family amino acid biosynthetic process)BFW97_20250N-acetyl-gamma-glutamyl-phosphate reductase/2.03
GO:0004617 (Phosphoglycerate dehydrogenase activity)BFW97_08350D-3-phosphoglycerate dehydrogenase/1.03
GO:0070039 (rRNA methyltransferase activity)BFW97_1969023S rRNA (guanosine (2251)-2’-O)-methyltransferase RlmB/-1.44

GO-enriched quorum sensing and metabolism-related genes of Aeromonas hydrophila AH72.

The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis encompassed three comparison groups (Y1-D, Y2-D, Y1-Y2), with bubble plots utilized to visually represent the results. The top 20 KEGG pathways with the smallest significant q values were identified through KEGG enrichment analysis. These bubble plots illustrate pathways with higher enrichment significance, while classification plots show the upregulation and downregulation of KEGG pathways in Aeromonas hydrophila under the influence of different drug concentrations.

KEGG pathway enrichment analysis revealed that myricetin exhibits concentration-dependent inhibitory effects on the quorum sensing (QS) system of Aeromonas hydrophila, with these molecular changes is closely linked to the reduction of virulence phenotypes. Within the low-concentration treatment group (Y1, 128 μg/mL), myricetin mainly influenced pathways associated with environmental adaptation and cellular communication (Figure 23). The notable enrichment of the nitrotoluene degradation pathway indicated a bacterial stress response to xenobiotic compounds, and the simultaneous upregulation of the two-component system and ABC transporter pathways implied direct interference with the QS signal perception and transport. Notably, when subjected to low-concentration treatment, the pathways involved in carbohydrate metabolism and xenobiotic degradation were generally suppressed. This suggests that bacteria may initiate metabolic reprogramming under mild QS disturbance to reallocate resources for stress adaptation.

Figure 23

When the myricetin concentration was raised to 512 μg/mL (Y2), more extensive metabolic remodeling was observed, which was characterized by the co-enrichment of glycerolipid metabolism and ABC transporter pathways (Figure 24). This suggested a targeted disruption of the synthesis and secretion axis for QS signal precursors. Concurrently, significant alterations in virulence-related pathways, such as Pseudomonas aeruginosa biofilm formation and Staphylococcus aureus infection, directly correlated with the inhibition of biofilm formation and reduction in extracellular enzyme activity observed in phenotypic assays. Despite the overall suppression of carbohydrate metabolism, core energy pathways like the citrate cycle and pyruvate metabolism remained active, suggesting that under severe inhibitory conditions, bacteria may redistribute metabolic resources to direct energy toward lipid synthesis and stress responses, thereby maintaining compensatory QS-related functions.

Figure 24

Comparative analysis of differential expression profiles between the two concentration groups (Y1 and Y2) revealed that high-concentration myricetin further intensified perturbations in energy metabolism and biosynthetic pathways (Figure 24). The sustained activity of the citrate cycle, which is central to cellular energy production, may provide essential precursors such as acetyl-CoA for the synthesis of autoinducers, thereby supporting bacterial adaptive responses under stress conditions. Notably, ABC transporters and biofilm formation pathways remained significantly enriched at both concentrations, highlighting the pivotal role of these functional modules in bacterial adaptation to QS inhibition. Collectively, as myricetin concentration increases, A. hydrophila appears to retain basic metabolic and transport functions while gradually losing the ability to coordinate QS-mediated group behaviors.

The enrichment analysis of quorum sensing and metabolism-related pathways, as determined by KEGG, is presented in Table 8 for the two experimental groups and the control group. From the viewpoint of the overall regulatory network, the KEGG enrichment findings suggest that myricetin disrupts the QS system of A. hydrophila through phased metabolic and signaling interference. At low concentrations, it mainly triggers stress responses and causes early-stage disruptions in signal transduction. In contrast, high-concentration treatment induces extensive metabolic reprogramming, specifically impairing the synthesis, transport, and functional output of QS signals. These molecular-level findings closely align with the attenuation of virulence phenotypes, such as motility and extracellular enzyme activity, hemolysis, and biofilm formation. This further confirms that myricetin functions as a multi-target QS inhibitor that disrupts bacterial social behaviors through integrated metabolic and transcriptional regulation. The study provides new insights into the anti-virulence mechanism of myricetin and establishes a theoretical foundation for developing QS inhibitors based on metabolic interference.

Table 8

KEGGGene symbolGene functionInter-group comparison
Y1-DY2-D
Bacterial secretion systemBFW97_01420glycerol dehydrogenase/-1.18
BFW97_01415dihydroxyacetone kinase/-1.21
BFW97_01405dihydroxyacetone kinase subunit DhaK/-1.17
BFW97_01410dihydroxyacetone kinase subunit L/-1.15
BFW97_13365hypothetical protein//
ABC transportersBFW97_06300ABC transporter ATP-binding protein/1.76
BFW97_04820glycine betaine ABC transporter substrate-binding protein/-1.07
BFW97_19930arginine ABC transporter substrate-binding protein/1.66
BFW97_19935arginine ABC transporter ATP-binding protein ArtP/1.74
BFW97_14145histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein/1.16
BFW97_19395macrolide ABC transporter permease/ATP-binding protein MacB/5.50
BFW97_04810glycine betaine/L-proline ABC transporter ATP-binding protein/-1.24
BFW97_06310tungsten ABC transporter substrate-binding protein/2.47
BFW97_06305ABC transporter permease/2.00
BFW97_19960iron ABC transporter substrate-binding1.08/
BFW97_19925ABC transporter1.24/
BFW97_09720ABC transporter substrate-binding protein2.08/
Biofilm formation-Pseudomonas aeruginosaBFW97_13365hypothetical protein/-1.62
BFW97_17270hypothetical protein/-1.55
Drug metabolism -other enzymesBFW97_10635dihydropyrimidinase/1.97
BFW97_09905thiopurine S-methyltransferase/-1.04
Citrate cycle (TCA cycle)BFW97_05630fumarate reductase (quinol) flavoprotein subunit/1.33
BFW97_20395phosphoenolpyruvate carboxykinase (ATP)/1.09
Glycolysis/GluconeogenesisBFW97_12020Histidine phosphatase/-1.09
BFW97_20395phosphoenolpyruvate carboxykinase (ATP)/1.09
BFW97_16645aldehyde dehydrogenase-1.51/
BFW97_16645aldehyde dehydrogenase-1.51/
BFW97_092604Fe-4S ferredoxin1.291.45
Pyruvate metabolismBFW97_03790acetate kinase/1.51
BFW97_05630fumarate reductase (quinol) flavoprotein subunit/1.33
BFW97_20395phosphoenolpyruvate carboxykinase (ATP)/1.09
Two-component systemBFW97_00080potassium-transporting ATPase subunit B/-2.94
BFW97_00085potassium-transporting ATPase subunit A/-2.88
BFW97_05630fumarate reductase (quinol) flavoprotein subunit/1.33
BFW97_17825chemotaxis response regulator protein-glutamate methylesterase/1.09
BFW97_15090chemotaxis protein/-1.39
BFW97_00075ATPase/-2.34
BFW97_09715peptide synthetase2.93/
BFW97_09455hydrogenase 2 small subunit-1.57/
BFW97_09470hydrogenase 2 large subunit-1.28/
BFW97_10690guanine deaminase/1.95
BFW97_10705xanthine dehydrogenase FAD-binding subunit XdhB/2.35
Fatty acid degradationBFW97_16085acyl-CoA dehydrogenase/-1.54
Oxidative phosphorylationBFW97_05630fumarate reductase (quinol) flavoprotein subunit/1.33
Flagellar assemblyBFW97_15985flagellar motor switch protein FliG/-1.05
Pantothenate and CoA biosynthesis(BFW97_10635dihydropyrimidinase/1.97
Quorum sensingBFW97_142953-deoxy-7-phosphoheptulonate synthase/2.09

KEGG-enriched quorum sensing and metabolism-related pathways of Aeromonas hydrophila AH72.

4 Discussion

The proliferation of antibiotic-resistant pathogens in aquaculture, as evidenced by a 50% resistance rate in some studies, severely threatens the sustainability of global aquaculture and poses significant risks to public health. Targeting bacterial quorum sensing (QS) systems, which regulate virulence rather than growth, presents a promising avenue for therapeutic intervention. promising anti-virulence strategy to combat infections while minimizing selective pressure for resistance (). In this study, we identified the natural flavonoid myricetin as a potent QS inhibitor (QSI) targeting the AHL synthase AhyI in Aeromonas hydrophila, a significant aquatic pathogen. Our integrated approach, which combines computational prediction, extensive in vitro validation, and transcriptomic analysis, provides a comprehensive mechanistic elucidation of myricetin’s multi-target anti-virulence action.

The initial virtual screening of a natural compound library targeting the AlphaFold2-predicted AhyI (AH2) model was a crucial first step. The robustness of our CADD pipeline was bolstered by the rigorous structural validation of the AH2 model, aligning with the standards set by advanced protein structure prediction models like AlphaFold2. and the cross-verification of docking results using two independent software platforms (Schrodinger Glide and AutoDock). The consistent identification of myricetin as a top-ranking candidate, with strong predicted binding The affinity involving key residues such as Asp35, Phe82, and Leu170 provided a solid theoretical basis for subsequent experimental research. The interaction with Phe82, likely through π-π stacking, is particularly noteworthy as aromatic residues frequently play key roles in ligand recognition (). This interaction is crucial in maintaining the stability of protein structures and facilitating the recognition of ligands, as evidenced by studies on the stabilization of phenolic compounds through π-π stacking interactions with proteins (). This robust in silico prediction was strongly corroborated by our in vitro findings, where myricetin exhibited significant efficacy against A. hydrophila, as supported by previous studies on plant extracts and myricetin’s known properties.

A pivotal finding of this work is that Myricetin effectively inhibits a broad spectrum of QS-controlled virulence phenotypes in A. hydrophila at concentrations well below the MIC (sub-MIC). Specifically, myricetin impaired bacterial motility, including swarming and swimming, the secretion of extracellular enzymes such as lipase and protease, hemolytic activity, and biofilm formation in the tested strain AH72. This broad-spectrum inhibition of pathogenicity, without imposing lethal pressure, perfectly matches the desired profile of a QSI (). The fact The observation that these effects were seen at sub-MIC concentrations is significant, as it implies that the anti-virulence activity is separate from general growth inhibition, thereby decreasing the potential for swift resistance emergence.

In order to unequivocally show that the target of myricetin is the AhyI synthase, we utilized a heterologous expression system. The successful expression of AhyI in E. coli BL21(DE3) resulted in the production of a profile of AHLs (C4-HSL to C14-HSL), confirming the functional broad-spectrum activity of the AH72 AhyI enzyme. The CV026 biosensor assay clearly demonstrated that myricetin treatment significantly decreased the production of short-chain AHLs in both the wild-type AH72 and the recombinant strain. The suppression of all six detected AHLs in AH72 and five in the recombinant system upon myricetin treatment was quantified using UPLC-MS/MS analysis, as verified by the conclusive results. The specific and strong inhibition of C4-HSL, the most abundant AHL in the recombinant strain provides compelling evidence that myricetin directly disrupts AhyI enzymatic activity. The slight enhancement of C6-HSL in the recombinant strain presents an intriguing observation, potentially suggesting a nuanced substrate-level competition or feedback mechanism within the heterologous system, which merits further exploration.

The transcriptomic analysis provided a comprehensive understanding of the antibacterial mechanisms of myricetin. The distinct gene expression profiles induced by different concentrations of myricetin exhibit a sophisticated, concentration-dependent regulatory effect. At a lower concentration (128 μg/mL), myricetin mainly affected genes related to iron transport and oxidoreductase activity, indicating an initial disturbance in redox homeostasis and iron acquisition, processes intricately associated with virulence regulation (). In contrast, the higher concentration (512 μg/mL) led to a more extensive reprogramming, significantly downregulating pathways central to energy metabolism (e.g., citrate cycle, pyruvate metabolism), amino acid transport (ABC transporters), and biofilm formation. This suggests that at high concentrations, myricetin imposes a broader metabolic burden, impairing the bacterial ability to maintain QS-dependent communal behaviors.

Our findings gain heightened significance when viewed in the context of the burgeoning field of marine natural product research and the therapeutic applications within aquaculture, as highlighted by recent advancements in marine biotechnology. Several studies have reported the discovery and application of specific compounds with quorum sensing (QS) inhibitory activity, which can be utilized in the development of antibacterial agents. activity from marine-derived compounds (; ). Myricetin, though not exclusively marine, is a widely distributed flavonoid that can be sourced from marine plants or derived through sustainable means. Its identification as a specific AhyI inhibitor introduces a valuable molecule into the toolkit for controlling A. hydrophila. The multi-target nature of its action, as revealed by the transcriptome data, which simultaneously affects AHL synthesis, metabolic pathways, and stress responses, suggests a “polypharmacology” phenomenon, which makes it difficult for bacteria to develop resistance through a single mutation. Notably, this multi-pronged mechanism constitutes a key strength of myricetin as a lead compound.

In conclusion, this study successfully demonstrates that myricetin is an effective QSI against A. hydrophila by directly targeting the AhyI synthase, thereby inhibiting AHL production and subsequent virulence expression. The combination of CADD, in vitro assays, chemical quantification, and transcriptomic analyses provides a robust and multi-faceted validation of its mechanism of action. Our research identifies a promising anti-virulence agent for application in aquaculture, demonstrating its effectiveness in combating viral diseases as evidenced by successful case studies and detailed molecular interactions. Future research should concentrate on in vivo efficacy testing in fish infection models, detailed structural characterization of the AhyI-myricetin complex, and exploring synergistic effects with conventional antibiotics to further enhance treatment outcomes. Leverage the antibacterial properties of dihydromyricetin (DMY) to advance the development of sustainable aquaculture disease management strategies.

Statements

Data availability statement

The data presented in the study are deposited in the CNSA (China National Genomics Data Center) repository, accession number CNP0009591 (https://db.cngb.org/data_resources/project/CNP0009591).

Ethics statement

The manuscript presents research on animals that do not require ethical approval for their study.

Author contributions

LX: Conceptualization, Writing – review & editing, Writing – original draft, Methodology. BL: Conceptualization, Validation, Methodology, Investigation, Writing – review & editing, Writing – original draft. QG: Writing – original draft, Validation, Investigation, Writing – review & editing. BW: Writing – review & editing, Writing – original draft, Formal analysis, Data curation. HG: Formal analysis, Writing – review & editing, Writing – original draft, Data curation.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This work was supported by the National Natural Science Foundation of China (32360926).

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Generative AI statement

The author(s) declared that generative AI was not used in the creation of this manuscript.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

Summary

Keywords

Aeromonas hydrophila, AhyI, myricetin, quorum sensing, transcriptomic

Citation

Li B, Gu Q, Wei B, Geng H and Xiong L (2026) Virtual screening and mechanistic elucidation of myricetin as a quorum sensing inhibitor targeting AhyI in Aeromonas hydrophila. Front. Aquac. 5:1815299. doi: 10.3389/faquc.2026.1815299

Received

22 February 2026

Revised

22 February 2026

Accepted

03 April 2026

Published

09 July 2026

Volume

5 - 2026

Edited by

D. K. Meena, Central Inland Fisheries Research Institute (ICAR), India

Reviewed by

Muhammed Duman, Bursa Uludağ University, Türkiye

Konda Mani Saravanan, B Aatral Biosciences Private Limited, India

Updates

Copyright

*Correspondence: Li Xiong,

†These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics