ORIGINAL RESEARCH article

Front. Aquac., 30 June 2026

Sec. Disease and Health Management

Volume 5 - 2026 | https://doi.org/10.3389/faquc.2026.1825395

Edwardsiella ictaluri infection in wild streaked prochilod (Prochilodus lineatus, Valenciennes) in Brazil

  • Department of Preventive Veterinary Medicine, School of Veterinary Medicine, Federal University of Minas Gerais - UFMG, Belo Horizonte, MG, Brazil

Abstract

Edwardsiella ictaluri has emerged as a significant pathogen in farmed siluriform species worldwide; however, reports of disease caused by this pathogen in free-living fish are rare. This study aimed to identify the etiological agent responsible for a mortality event in wild streaked prochilod (Prochilodus lineatus) in the São Francisco River basin, state of Minas Gerais, Brazil. Additionally, the genetic profile and antimicrobial resistance of the isolates were evaluated using REP-PCR fingerprinting and disk diffusion assays. Diseased fish were sampled (n = 18) at two distinct points along the river and subjected to bacteriological examination. All obtained isolates were identified as E. ictaluri via qPCR and dnaJ gene sequencing. Pathogenicity was confirmed through experimental infection fulfilling Koch’s postulates, resulting in 100% mortality within 51 hours in the high-dose group and within up to nine days in the low-dose group. Macroscopic and histopathological analyses revealed granulomas in the kidney and liver. Regardless of the sampling point, all selected isolates exhibited the same genetic profile based on phylogenetic and REP-PCR analyses. The isolates were susceptible to florfenicol and oxytetracycline. To our knowledge, this is the first report of a natural outbreak of E. ictaluri in wild streaked prochilod in Brazil.

1 Introduction

Infectious diseases constitute one of the mains constraints in aquaculture, causing economic losses that vary in magnitude depending on the causative agent and management conditions (). Bacterial diseases represent a major cause of mortality, lesions, and behavioral changes in both farmed and wild fish (). In this context, the genus Edwardsiella has recognized pathogenic potential in fish (), and was traditionally composed of three species: E. ictaluri, E. tarda and E hoshinae (). However, advances in genomic analyses since 2013 have led to the reclassification of E. tarda, resulting in the description of two new species: E. piscicida () e E. anguillarum ().

Edwardsiella ictaluri is a Gram-negative, rod-shaped, facultative anaerobic, and facultative intracellular bacterium, recognized for possessing highly virulent strains (; ; ). Initially isolated from Ictalurus punctatus in the United States, it is the etiological agent of Enteric Septicemia of Catfish (ESC), one of the most impactful bacterial diseases in the intensive production of ictalurids (, ; ; ; ). Edwardsiella ictaluri is not a bacterium that lives naturally in aquatic environments, as it requires a fish host to survive. It is must be introduced into an environment with a susceptible fish population for the disease to develop. This pathogen can be introduced via contaminated nets, seines, or equipment, through carrier fish, or via bird feces. The bacterium is shed in the feces of infected animals, facilitating fecal-oral transmission. Furthermore, transmission can also occur through the cannibalism of infected fish or by feeding on infected carcasses (). In recent decades, E. ictaluri has been recognized as a disease-causing bacterium in other catfish species worldwide, including Pseudoplatystoma corruscans in Brazil (), Clarias batrachus in Thailand (), Pangasius hypophthalmus in Vietnam (), Plecoglossus altivelis in Japan (), and Pelteobagrus fulvidraco in China (). More recently, the pathogen has gained relevance in Asian aquaculture, causing significant losses in the production of Pangasianodon hypophthalmus as the etiological agent of Bacillary Necrosis of Pangasius (BNP) (; ). In addition to siluriforms, E. ictaluri has also been isolated from species of the genera Hemigrammus spp., Devario spp., Pethia spp (; ), as well as Oreochromis niloticus () and Danio rerio (). Despite its ability to persist in both fresh and brackish water under diverse environmental conditions and to infect a wide range of hosts (; ), there are no documented reports in the literature regarding the occurrence of this bacterium in other native fish species in Brazil, other than those belonging to the genus Pseudoplatystoma, especially those with a wide distribution in the Neotropical ichthyofauna, such as the streaked prochilod (Prochilodus lineatus).

Prochilodus lineatus (Valenciennes, 1837), commonly known as curimbatá or curimba, is a medium-size migratory species of the order Characiformes (family Prochilodontidae) characterized by total spawning, external fertilization, and lack of parental care (; ; ; ). This species is endemic to the Paraná, Paraguay, São Francisco, Paraíba do Sul, and Amazon river basins (; Viveiros and Godinho, 2009). As a rheophilic and iliophagous fish, it plays a crucial ecological role in lotic ecosystems, contributing to nutrient cycling and sediment load control (; ). Due to its commercial value and ecological importance, the streaked prochilod is widely utilized in restocking programs and juvenile production in aquaculture facilities (; Viveiros and Godinho, 2009).

Although Edwardsiella ictaluri infection is well characterized in farmed species, its occurrence in free-living fish remains poorly explored, particularly within the context of South American native ichthyofauna. The absence of records in species such as the streaked prochilod, combined with the scarcity of data on antimicrobial resistance and genetic profiles of isolates from natural environments, constitutes a significant gap in understanding the epidemiology of this pathogen in aquatic ecosystems. Therefore, this study aimed to characterize a mortality outbreak in wild streaked prochilod sampled from the São Francisco River basin, in the state of Minas Gerais, Brazil, focusing on the identification of the etiological agent, assessment of experimental pathogenicity, analysis of antimicrobial susceptibility, and genetic characterization of the bacterial isolates.

2 Materials and methods

2.1 Fish sampling and bacteriological examination

In June 2022, mortality was observed in wild streaked prochilods in the Abaeté River (Point 1; Geographic coordinates: 18°10’50.3” S, 45°37’15.7” W) and in the spillway and dissipation basin of the Três Marias Hydroelectric Power Plant (Point 2; Geographic coordinates: 18°12’39.0” S, 45°15’54.0” W), in the state of Minas Gerais, Brazil. Eighteen moribund fish (mean weight: 139.00 ± 59.74 g, n = 6 for Point 1; and 239.55 ± 74.05 g, n = 12 for Point 2) were sampled, transported in a Styrofoam box with ice, and sent to the laboratory for analysis.

For bacteriological examination, brain and kidney samples were aseptically collected and streaked onto tryptic soy agar (Kasvi, Italy) supplemented with 5% defibrinated sheep blood (TSAB), then incubated under aerobic conditions at 28°C for 48h. Bacterial isolates were identified by MALDI-TOF MS using a MicroFlex LT mass spectrometer (Bruker Daltonics, Germany). Mass range detection parameters and identification score criteria followed the manufacturer’s recommendations.

2.2 Edwardsiella ictaluri identification

The E. ictaluri isolates were confirmed at the species level by multiplex-qPCR (m-qPCR), as described by . For this purpose, isolates were thawed, reactivated on TSAB agar, and incubated at 28 °C for 48 h. Genomic DNA was extracted from pure colonies using the Wizard® Genomic DNA Purification Kit (Promega, USA), according to the manufacturer’s instructions. DNA quality and concentration were assessed using a NanoDrop® spectrophotometer (Thermo Fisher Scientific, USA). The extracted DNA was stored at -20 °C until use.

The m-qPCR was performed using the GoTaq® Probe qPCR mastermix kit (Promega, USA) in a final reaction volume of 20 µL. The reaction mixture consisted of 1× mastermix, 0.6 µM of each primer (Table 1), 0.3 µM of probe (Table 1), and 2 µL of DNA template. Thermal cycling conditions were as follows: initial denaturation at 95 °C for 15 min, followed by 40 cycles of 95 °C for 15s, and 60 °C for 60s. Amplification was carried out in a ViiA 7 Real-Time PCR System (Life Technologies, USA), Data acquisition and analysis were performed using the ViiA 7 Software v.1.2.3. (Life Technologies, USA).

Table 1

PCRPrimerSpeciesSequence (5’ → 3’)Reference
m-qPCREI481FE. ictaluriACTTATCGCCCTCGCAACTC
EI658RCCTCTGATAAGTGGTTCTCG
EI561PCCTCACATATTGCTTCAGCGTCGAC
ET3518FE. tardaCAGTGATAAAAAGGGGTGGA
ET3632RCTACACAGCAACGACAACG
ET3559PAGACAACAGAGGACGGATGTGGC
EA1583FE. anguillarumGATCGGGTACGCTGTCAT
EA1708RAATTGCTCTATACGCACGC
EA1611PCCCGTGGCTAAATAGGACGCG
EP14529FE. piscicidaCTTTGATCATGGTTGCGGAA
EP14659RCGGCGTTTTCTTTTCTCG
EP14615PCCGACTCCGCGCAGATAACG
dnaJ sequencingDN1-1FGATYTRCGHTAYAACATGGA
DN1-2RTTCACRCCRTYDAAGAARC
REP-PCRGTG5GTGGTGGTGGTGGTGVersalovic et al. (1998)

Oligonucleotides used in m-PCR and dnaJ gene sequencing for species identification within the genus Edwardsiella and for genetic diversity analysis.

For phylogenetic analysis, dnaJ sequencing was conducted for four selected isolates (n = 2 from Point 1 and n = 2 from Point 2), as described by . Reactions were performed using the HotStarTaq DNA Polymerase Kit (Qiagen, USA) in a final volume of 25 μL containing 1×PCR buffer, 0.2 mM dNTPs, 2 mM MgCl2, 0.25 μM of each primer (Table 1), 1.5 U Taq DNA polymerase, and 2 µL of DNA template. Thermal cycling conditions were as follows: initial denaturation at 94 °C for 15 min, followed by 40 cycles of 94 °C for 45s, 51 °C for 45s, and 72 °C for 60s, with a final elongation step at 72 °C for 5 min. Amplification was carried out in a Veriti 96-well thermal cycler (Life Technologies).

Next, PCR amplicons were purified using Agencourt AMPure XP (Beckman Coulter, USA), following the manufacturer’s recommendations. Sequencing reactions were performed using the BigDye Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems, USA) with the same primers used in the dnaJ amplification protocol, and products were analyzed on an ABI 3500 Genetic Analyzer (Life Technologies, USA). Forward and reverse sequences were used to generate contigs using the Geneious Prime v. 2022.2.2 (Dotmatics, USA). Then, the contigs were compared against the National Center for Biotechnology Information (NCBI) database using the BLAST web server (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

The obtained dnaJ sequences were aligned using Clustal W method () in BioEdit software v.7.2.5 (Ibis Biosciences, USA), alongside other Edwardsiella spp. sequences (Table 2) and Serratia marcescens strain ELP1.10 (GenBank accession no. CP127881), which served as the outgroup. Phylogenetics relationships were inferred using the Neighbor-Joining method () based on the Kimura 2-parameter model (). Branch support was assessed using 1,000 bootstrap replicates to evaluate node reliability (). Evolutionary analyses were conducted in MEGA11 v.11.0.13 ().

Table 2

Accession no.Scientific nameStrainHost/sourceYearCountry
CP169062E. ictaluri93-146Ictalurus punctatus1993USA
CP092065E. ictaluriS15-163Hybrid catfish2015USA
CP053781E. ictaluri2234Oreochromis niloticus2016Vietnam
AP028102E. ictaluriKB20921Plecoglossus altivelis2020Japan
CP054060E. ictaluriT1-1Pangasianodon hypophthalmus2014Thailand
CP106852E. ictaluriE9-302Pelteobagrus fulvidraco2021China
CP092014E. ictaluri13 TAL-140 K3Danio rerio2013USA
CP152217E. ictaluriEi-71Pangasianodon hypophthalmus2021Vietnam
CP127881E. ictaluriEILOClarias batrachus1985Thailand
CP180750E. ictaluri30IA NewJerseyNoturus gyrinus2002USA
CP168652E. ictaluriNaF-IIUMPangasianodon hypophthalmus2024Malaysia
CP090968E. piscicida18EpOKYJParalichthys olivaceus2018South Korea
CP082939E. tardaFDAARGOS_1473UnknownUnknownGermany
CP006664E. anguillarumET080813Anguilla japonica2008China
CP065626E. hoshinaeFDAARGOS_940UnknownUnknownUnknown
CP127881Serratia marcescensELP1.10Soil2022Hong Kong

Edwardsiella spp. strains used for dnaJ gene phylogenetic evaluation.

2.3 Repetitive extragenic palindromic-PCR

Genetic diversity analysis of the selected E. ictaluri isolates (n = 2 from Point 1 and n = 2 from Point 2) was conducted using the REP-PCR technique (Versalovic et al., 1998), following the protocol described by . This approach was employed to determine the existence of genetic differences among isolates from different fish sampling points. PCR was performed using the HotStarTaq polymerase kit (Qiagen) in a final reaction volume of 25 μL. The reaction mixture consisted of 1× PCR buffer, 0.2 μM dNTPs, 3.0 mM MgCl2, 0.5 μM GTG5 primer (Table 1), 0.1 U Taq DNA polymerase, and 6 μL of template DNA. Thermal cycling conditions included an initial denaturation at 95 °C for 5 min, followed by 30 cycles of 95 °C for 30 s, 45 °C for 1 min, and 72 °C for 4 min, with a final extension step at 72 °C for 16 min. Amplification was carried out in a 96-well Veriti thermocycler (Life Technologies).

PCR products were separated by electrophoresis on a 1.5% agarose gel and stained with ethidium bromide (0.5 μg/mL) for 40 min. A 1-kb molecular weight marker (Promega) was used as a size standard. Gel was visualized under UV transillumination, and image was captured using an L-Pix EX digital system (Loccus Biotechnology). Image analysis was performed using BioNumerics software version 6.6 (Applied Maths). The Dice coefficient was used to calculate similarity between banding patterns (), and a dendrogram was constructed using the UPGMA method. The discriminatory power of the technique was calculated using Simpson’s diversity index ().

2.4 Antimicrobial susceptibility

Disk diffusion assays were conducted following the guidelines of CLSI document VET03 (). The study utilized commercially available disks (Oxoid, UK) for florfenicol (30 μg) and oxytetracycline (30 μg), which were selected as they are currently the sole antimicrobials authorized for aquaculture use in Brazil.

Selected E. ictaluri isolates were thawed and cultured on MacConkey agar (HiMedia) at 28 °C for 24 h. Colonies were suspended in sterile saline to achieve an optical density of 0.08-0.13 at 625 nm using a spectrophotometer (Spectrum, China). Bacterial suspensions were inoculated onto Muller-Hinton agar plates using sterile swabs. Antimicrobial disks were applied to the agar surface, and plates were incubated at 28 °C for 24 h. All assays were performed in triplicate. Escherichia coli ATCC 25922 was used as a quality control strain under identical experimental conditions. Inhibition zone diameters were measured, and the mean value of the triplicates was calculated. In the absence of CLSI clinical breakpoints for E. ictaluri from fish, isolates were considered susceptible if inhibition zones exceeded 40 mm for florfenicol and 30 mm for oxytetracycline, based on results obtained by .

2.5 Fish and challenge assay

The pathogenicity of the E. ictaluri strain to streaked prochilod was evaluated through an experimental infection trial. Forty juvenile fish (mean weight: 30.63 ± 5.84 g) were obtained from a supplier located in the Zona da Mata region, Minas Gerais, Brazil. The use of fish in this study was approved by the Ethics Committee on Animal Use of the Federal University of Minas Gerais (protocol no. 169/2025). Upon arrival at the Laboratory of Aquatic Animal Diseases (AQUAVET), School of Veterinary Medicine, UFMG, in Belo Horizonte, MG, Brazil, the fish underwent a 30-day acclimation period. During this period, the animals were maintained in a 120-L glass aquarium with flow-through freshwater, controlled temperature of 28 °C, and continuous aeration provided by an air stone. Fish were fed twice daily with a commercial diet containing 42% protein (Acqua Linea, Supra).

To ensure the absence of bacterial infections in the experimental batch, six individuals were euthanized by overdose of tricaine methanesulfonate (MS-222; 300 mg/L). Brain and kidney samples were aseptically collected and streaked onto BHI agar (Brain Heart Infusion), CHAH (Cystine Heart Agar supplemented with 2% hemoglobin), and MRS (Man, Rogosa & Sharpe agar) for bacteriological analysis, followed by bacterial identification using MALDI-TOF MS. The absence of bacterial growth after incubation at 28 °C for 5 days confirmed that the batch was free of infection.

Growth curves of the E. ictaluri isolate ED101–22 were established to allow collection of the bacterial suspension at two distinct time points, corresponding to approximate concentrations of 107 CFU/mL (high-dose group) and 104 CFU/mL (low-dose group). The bacterial strain was thawed and plated on TSAB agar and incubated at 28 °C. After growth, a single bacterial colony was inoculated into BHI broth and incubated at 28 °C under low agitation (100 rpm) until an optical density of 0.05 was reached. To determine viable counts (CFU/mL), serial dilutions (1:9, v/v) were prepared in sterile PBS, plated onto TSAB agar, and incubated at 28 °C for 48h.

The study consisted of three experimental groups, each containing ten streaked prochilods. Fish were kept in 60-L aquaria with flow-through freshwater and continuous aeration throughout the experiment. The experimental infection lasted 10 days, beginning on the day of inoculation. Immediately before the procedure, fish were sedated with tricaine methanesulfonate (80 mg/L) to minimize stress and discomfort. For infection, group G1 was intraperitoneally injected with 0.2 mL of BHI broth containing 2.36 × 106 CFU/fish, and group G2 with 2.36 × 10³ CFU/fish. The control group received 0.2 mL of sterile BHI broth via the same route. Clinical signs and mortality were monitored and recorded throughout the trial. Fish that died during the challenge period were subjected to bacteriological and histopathological analyses for lesion characterization. At the end of the experiment, surviving fish were euthanized with tricaine methanesulfonate (300 mg/L), necropsied, and processed for bacteriological and histopathological examinations.

2.6 Bacteriological and histopathological analysis of infected fish

Brain and kidney samples were aseptically collected, streaked onto TSAB, and incubated at 28°C for 48h. Bacterial isolates were identified using MALDI-TOF MS.

Liver, kidney, spleen, intestine, stomach, and brain samples were collected from each fish from the experimental groups and fixed in 10% buffered formalin for 24 h. Tissues were dehydrated in an ascending ethanol series (70-100%), cleared in xylene, and embedded in paraffin. Histological sections of 4 μm thickness were cut using a Leica RM2245 semi-automated rotary microtome (Leica Biosystems, Germany) and stained with hematoxylin and eosin (H&E) (). Slides were examined using a Leica DM4000 B microscope (Leica Biosystems), and images were captured with a Leica DFC 500 digital camera (Leica Biosystems).

3 Results

3.1 Clinical signs, necropsy, and bacterial identification

Clinical signs observed in fish collected at sampling points 1 and 2 included hemorrhages, cutaneous hyperemia, fin erosion, edema, and scale loss. Necropsy revealed multifocal white spots in kidney suggestive of granulomas. Regarding bacteriological analysis (MALDI-TOF), all animals from Point 1 tested positive for E. ictaluri, three of which were coinfected with Aeromonas hydrophila. Conversely, at Point 2, ten fish tested positive for E. ictaluri (two coinfected with A. hydrophila), while two were negative for any bacterial agent.

All E. ictaluri isolates were confirmed at the species level using qPCR assays. BLASTn analysis of the partial dnaJ sequences (~730 bp) revealed that isolates ED101-22, ED103-22, ED107-22, and ED110–22 shared 99.32% to 99.86% nucleotide identity with E. ictaluri strain Ei-59 (GenBank accession no. CP152189), thus confirming their identification at the species level.

3.2 Phylogenetic analysis

Phylogenetic analysis based on partial dnaJ sequences (688 bp) of the Edwardsiella spp. isolates resulted in the neighbor-joining tree shown in Figure 1. The sequences of the Brazilian E. ictaluri isolates obtained from Points 1 and 2 clustered tightly in the same clade as the Asian and North American strains, supported by a bootstrap value of 100%, confirming their genetic identity as E. ictaluri. Despite this similarity, all evaluated streaked prochilod isolates presented a single nucleotide polymorphism (SNP) at position 208 of the partial dnaJ gene sequence, in which a cytosine (C) was replaced by a thymine (T). The E. ictaluri cluster was clearly separated from the other Edwardsiella species evaluated.

Figure 1

3.3 Genetic diversity analysis

Genetic diversity analysis performed by REP-PCR on the four selected E. ictaluri isolates revealed an amplification pattern comprising eight bands, with fragment sizes ranging from 800 to 4,500 bp. All isolates exhibited identical genetic profiles (100% similarity), indicating the possible presence of a single bacterial clone associated with the outbreak (Figure 2). The Simpson’s diversity index was 1, further corroborating the clonal homogeneity among the analyzed samples.

Figure 2

3.4 Antimicrobial susceptibility test

The susceptibility profile of the reference strain Escherichia coli ATCC 25922 was within the range established by the CLSI (), thereby validating the obtained results. The inhibition zone diameters for the four selected E. ictaluri isolates are presented in Table 3. All isolates were classified as susceptible to oxytetracycline and florfenicol.

Table 3

IsolateOxytetracyclineFlorfenicol
Zone diameterConsidered*Zone diameterConsidered*
101-2238Susceptible53Susceptible
103-2237Susceptible54Susceptible
107-2238Susceptible55Susceptible
110-2235Susceptible52Susceptible

Inhibition zone diameters (mm) of oxytetracycline and florfenicol against E. ictaluri isolates determined using the standard disk diffusion susceptibility test.

*

Results interpretations based in .

3.5 Challenge assay and histopathological analysis

Experimental infection by intraperitoneal injection of E. ictaluri resulted in 100% mortality within 51 hours in the group challenged with 2.36 × 106 CFU/fish, and within 9 days in the group receiving 2.36 × 10³ CFU/fish (Figure 3). All infected fish exhibited behavioral alterations, including erratic swimming, lethargy, and hyporexia. In fish exposed to the higher dose, multifocal petechial hemorrhages were observed on the skin and fins, accompanied by anal, gastric, and cerebral congestion (Figure 4). In individuals challenged with the lower dose, alterations included multifocal petechial hemorrhages on the skin, mouth, and fins, hepatic and gastric congestion, and multifocal white nodules in the kidney and spleen (Figure 5).

Figure 3

Figure 4

Figure 5

Histopathological examination of fish from the 106 CFU/fish group revealed marked circulatory disturbances, including extensive areas of hyperemia and multifocal hemorrhages. Necrotic lesions were identified in multiple tissues, characterized by loss of cellular architecture and nuclear alterations consistent with karyorrhexis. Additionally, intense colonization of the gastric mucosa by numerous bacteria (myriads) associated with areas of necrosis was observed. Granulomatous inflammation of mild intensity, suggestive of an early stage of chronic inflammatory response, was detected in only one individual (Figure 6; Table 4).

Figure 6

Table 4

OrganExperimental groupPost-challenge timeHistopathological findingsOccurrence (n/N)*
Kidney106 CFU/fish51 hoursNecrosis3/10
Hyperemic vessels8/10
Granuloma1/10
103 CFU/fish3 daysHyperemic vessels7/7
Necrosis4/7
4 daysNecrosis1/1
5 daysHyperemic vessels1/1
Necrosis1/1
9 daysHyperemic vessels1/1
Liver106 CFU/fish51 hoursHyperemic vessels3/10
Necrosis1/10
103 CFU/fish3 daysNecrosis3/7
5 daysNecrosis1/1
Granuloma1/1
9 daysNecrosis1/1
Spleen103 CFU/fish3 daysNecrosis1/7
Brain106 CFU/fish51 hoursHemorrhage2/10
Stomach106 CFU/fish51 hoursBacterial myriads associated with necrosis2/10
103 CFU/fish3 daysBacterial myriads associated with necrosis6/7
4 daysBacterial myriads associated with necrosis1/1
9 daysBacterial myriads associated with necrosis1/1
Intestine106 CFU/fish51 hoursBacterial myriads associated with necrosis1/10
103 CFU/fish3 daysBacterial myriads associated with necrosis1/7
5 daysGranuloma1/1
9 daysGranuloma1/1

Main histopathological lesions observed in groups infected with E. ictaluri.

No lesions were observed in the control group.

*

The occurrence of histopathological alterations is expressed as n/N, where n is the number of animals exhibiting the alteration, and N is the total number of animals evaluated.

In fish from the 10³ CFU/fish group, the most frequently observed histopathological alterations were consistent with a chronic inflammatory process, characterized by multifocal granulomas. These structures exhibited an inflammatory infiltrate composed predominantly of macrophages, lymphocytes, and epithelioid macrophages arranged concentrically around necrotic centers, frequently delimited by a fibrous tissue. These alterations resulted in the loss and replacement of the parenchyma in several affected organs (Figure 7; Table 4).

Figure 7

Bacteriological analysis on TSAB was performed for all animals that died, and E. ictaluri was reisolated from the brain and kidney of all infected fish. Aeromonas sp. was also identified as a coinfection in 80% of the animals in the 106 CFU/fish group and 90% of those in the 10³ CFU/fish group. No mortality was observed in fish from the control group, and necropsies performed at the end of the experimental challenge revealed no bacterial infection in either bacteriological or histopathological analyses.

4 Discussion

This is the first report of a natural outbreak caused by E. ictaluri in wild streaked prochilod in Brazil. The bacterium was isolated from diseased fish collected from the wild, and its pathogenicity was confirmed through experimental infection. The reproduction of clinical signs and subsequent re-isolation of the agent fulfilled Koch’s postulates, confirming this fish species as a susceptible host to E. ictaluri.

Bacteriological assays using MALDI-TOF, combined with molecular confirmation, revealed the presence of E. ictaluri in sixteen of the eighteen fish analyzed. Although MALDI-TOF mass spectrometry enables rapid and reliable identification at the genus level, its discriminatory power at the species level may be limited, particularly among phylogenetically close species (). In this context, complementary molecular methods, such as m-qPCR and phylogenetic analysis based on dnaJ gene sequencing, proved essential for definitive identification. In the present study, both methodologies enabled the accurate identification of the isolates obtained from naturally diseased fish as E. ictaluri.

Unfortunately, our study is limited in its ability to hypothesize about the origin of the E. ictaluri outbreak or to determine whether other native fish in the region might be acting as asymptomatic carriers. This limitation arises because data on environmental parameters, pollution, and stress factors during the natural infection are lacking, and only moribund animals were submitted for laboratory analysis. The only relationship observed is that the Abaeté River is a major tributary of the São Francisco River, discharging near the Três Marias hydroelectric power plant (the region of Point 2). Because the water flows downstream from collection Point 1, it is possible that fish infected at Point 1 moved along the watercourse, subsequently manifesting clinical signs or dying upon reaching Point 2.

Phylogenetic analysis based on dnaJ gene sequences showed that E. ictaluri isolates from streaked prochilod share high genetic similarity with each other and with isolates from other host fish species (Clarias batrachus, Danio rerio, Ictalurus punctatus and hybrids, Oreochromis niloticus, Pangasianodon hypophthalmus, Pelteobagrus fulvidraco, Plecoglossus altivelis, and Noturus gyrinus) from Asia (China, Japan, Malaysia, Thailand, and Vietnam) and North America (the USA). These findings confirm the broad host range and widespread geographic distribution of E. ictaluri, as previously described (). Although the streaked prochilod strains had a SNP at position 208 of the partial dnaJ gene sequence, this did not result in a clear distinction between the isolates from our study and those previously available in the NCBI database. This corroborates a previous study demonstrating that dnaJ sequence analysis provides a better resolution of differences between enterobacterial species rather than assessing diversity within a single species (). Therefore, dnaJ gene sequencing is not an ideal method for genotyping E. ictaluri. Other techniques are necessary to determine the genetic diversity of the pathogen and to clarify potential clustering based on different hosts and geographic origins.

Molecular typing by repetitive extragenic palindromic sequence PCR (rep-PCR) is widely employed to estimate genetic similarity among bacterial isolates (Versalovic et al., 1991, Versalovic et al., 1998). Our rep-PCR analysis revealed identical banding profiles across all E. ictaluri isolates evaluated, with no evidence of intraspecific variation. This absence of genetic diversity indicates that possibly the strains belong to a single clone, regardless of the sampling location, suggesting clonal dissemination of the pathogen among the wild streaked prochilod population. This type of genotypic approach is fundamental for elucidating aspects of evolution, pathogenicity, and adaptive strategies, contributing to improved surveillance and disease control in both aquaculture and natural environments ().

The antimicrobial susceptibility profile of E. ictaluri isolates obtained from wild streaked prochilod along the São Francisco River basin demonstrated susceptibility to florfenicol and oxytetracycline, the only two antimicrobials currently authorized for aquaculture in Brazil. These results corroborate previous studies in different geographical contexts (; ; ), indicating that E. ictaluri maintains a relatively stable susceptibility profile regardless of origin. Preserving the efficacy of these drugs is of utmost importance for outbreak control, particularly given the global challenge of antimicrobial resistance.

Experimental infection in groups challenged with 106 and 10³ CFU/fish resulted in high mortality, accompanied by clinical signs consistent with Enteric Septicemia of Catfish (ESC). Behavioral alterations, such as erratic swimming, lethargy, and hyporexia, were observed in both groups, corroborating findings in the literature (; ; ).

In the group infected with 106 CFU/fish, which reached 100% mortality within 51 hours post-infection, an intense acute inflammatory response was observed. This was characterized by significant vascular disturbances, particularly in the gastrointestinal tract, liver, spleen, and brain. Additionally, one case of precursors of granulomatous formation was identified in the renal parenchyma, a pattern previously described by and . In the group exposed to 10³ CFU/fish, well-defined and prominent granulomas were evident from the fifth day post-infection. These appeared as white nodules diffusely distributed throughout the hepatic parenchyma and the tissue surrounding the pyloric ceca. These findings are consistent with those reported by in Nile tilapia (Oreochromis niloticus) challenged with 10³ CFU/mL, reinforcing the ability of E. ictaluri to induce granulomatous inflammatory responses in fish, a characteristic already documented for the genus Edwardsiella (; ).

demonstrated that E. ictaluri exhibits marked host specificity. They observed high susceptibility in Ictalurus punctatus, which reached 100% mortality within 10 days when challenged with 10³ CFU/fish, a pattern similar to that observed in our study. In contrast, while they reported no mortality in Nile tilapia challenged with the same dose, the isolate evaluated in the present study proved highly virulent to streaked prochilod, causing 100% mortality within 9 days post-infection at 10³ CFU/fish.

The clinical signs observed in fish infected with E. ictaluri include manifestations typical of acute bacterial septicemias, such as petechial hemorrhages on the skin and fins. This pattern resembles infections caused by Aeromonas spp (; ). In the present study, Aeromonas spp. were co-isolated from fish involved in the natural outbreak and from a significant proportion of the challenged fish, suggesting an opportunistic role facilitated by E. ictaluri-induced immunosuppression (; ). Previous research indicates that E. ictaluri infection compromises the predicted functions of the fish intestinal microbiota, negatively affecting immunity, metabolism (carbohydrate, lipid, and amino acid), digestion, absorption, and cellular regeneration. These disruptions likely create a favorable environment for secondary bacterial infections (; Yang et al., 2023), which can ultimately lead to host mortality.

Histopathological evaluation of fish challenged with both concentrations (106 and 10³ CFU/fish) revealed significant lesions, particularly in the spleen and kidney. As key components of the reticuloendothelial system rich in phagocytic cells, the severity of alterations in these organs suggests they are primary targets during E. ictaluri infection. Macrophages likely act as mediators of pathogen dissemination and persistence, as described by and . The gastrointestinal tract is recognized as a preferred portal of entry in acute infections (; Yang et al., 2023). In the present study, the gastric mucosa exhibited extensive necrosis associated with intense bacterial colonization as early as 51 hours post-infection in both groups. Regarding hepatic findings, reported extensive necrosis, hyperemia and nuclear alterations (pyknosis and karyorrhexis) in infected Pseudoplatystoma spp. after seven days. We observed similar hepatic in our study at both concentrations, but appearing as early as 51 hours post-infection. Furthermore, described cerebral vascular congestion in Nile tilapia, a finding mirrored in two streaked prochilod from our high-dose group.

5 Conclusions

In conclusion, this is the first report of edwardsiellosis outbreaks caused by E. ictaluri in wild streaked prochilods in Brazil. Genetic analysis suggested that the obtained isolates belong to the same clonal population, indicating the circulation of a single lineage in both outbreaks. The high virulence observed, with 100% mortality even at a low dose (10³ CFU/fish), highlights the potential impact of this pathogen on wild streaked prochilods, however, due to the restricted sample size and the lack of replicate aquaria, the experimental infection data presented are limited to our observations. The strains showed susceptibility to oxytetracycline and florfenicol, suggesting these agents should be further evaluated for in vivo treatment. Additional studies are essential to better understand the ecological and sanitary risks associated with the dissemination of E. ictaluri in natural environments. This requires analyzing the regional ichthyofauna, the conservation status of certain species, and the possible origin of the outbreaks.

Statements

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

The animal study was approved by Ethics Committee on Animal Use of the Federal University of Minas Gerais. The study was conducted in accordance with the local legislation and institutional requirements.

Author contributions

SC: Writing – review & editing, Investigation, Writing – original draft, Visualization, Formal analysis, Methodology. TS: Investigation, Writing – review & editing. JR Methodology, Visualization, Writing – review & editing. HF: Investigation, Resources, Writing – review & editing. CL: Writing – review & editing, Supervision, Investigation, Project administration, Methodology, Resources, Conceptualization. GT: Formal analysis, Supervision, Project administration, Writing – review & editing, Methodology, Visualization, Investigation, Funding acquisition, Conceptualization.

Funding

The author(s) declared that financial support was received for this work and/or its publication. This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brasil (CAPES), and Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG, grant number APQ-04526-25).

Conflict of interest

The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

The handling editor FP declared a past co-authorship with the authors HF, CL, GT.

Generative AI statement

The author(s) declared that generative AI was used in the creation of this manuscript. The English language of the manuscript was reviewed and polished using the AI Gemini 3 Pro (Google) to enhance clarity, grammar, and overall readability.

Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

References

  • 1

    AbaynehT.ColquhounD. J.SørumH. (2013). Edwardsiella piscicida sp. nov. a novel species pathogenic to fish. J. Appl. Microbiol.114, 644654. doi: 10.1111/jam.12080

  • 2

    AgostinhoA. A.HarumiL. C. G.SuzukiI.JílioH. F. (2003). “ Migratory Fishes of the Upper Paraná River Basin, Brazil,” in Migratory Fishes Of South America: Biology, Fisheries And Conservation Status. Ottawa: IDRC, 1998.

  • 3

    CastroR. M. C.VariR. P. (2004). Detritivores of the South American fish family Prochilodontidae (Teleostei: Ostariophysi:Characiformes): a phylogenetic and revisionary study. 622, 1–189.

  • 4

    ChenF.SunJ.HanZ.YangX.XianJ.LvA.et al (2019). Isolation, identification and characteristics of Aeromonas veronii from diseased crucian carp (Carassius auratus gibelio). Front. Microbiol.10. doi: 10.3389/fmicb.2019.02742

  • 5

    CLSI (2020). VET03: Methods for antimicrobial broth dilution and disk diffusion susceptibility testing of bacteria isolated from aquatic animals. CLSI (2020). VET03: Methods for antimicrobial broth dilution and disk diffusion susceptibility testing of bacteria isolated from aquatic animals.

  • 6

    CostaF. A. A.LealC. A. G.LeiteR. C.FigueiredoH. C. P. (2014). Genotyping of Streptococcus dysgalactiae strains isolated from Nile tilapia, Oreochromis niloticus (L.). J. Fish Dis.37, 463469. doi: 10.1111/jfd.12125

  • 7

    CrumlishM.DungT. T.TurnbullJ. F.NgocN. T. N.FergusonH. W. (2002). Identification of Edwardsiella ictaluri from diseased freshwater catfish, Pangasius hypophthalmus (Sauvage), cultured in the Mekong Delta, Vietnam. J. Fish Dis.25, 733736. doi: 10.1046/j.1365-2761.2002.00412.x

  • 8

    CunninghamF. L.JackS. W.HardinD.WillsR. W. (2014). Risk factors associated with Enteric Septicemia of Catfish on Mississippi commercial catfish farms. J. Aquat. Anim. Health26, 8490. doi: 10.1080/08997659.2014.886635

  • 9

    da CostaA. R.de AbreuD. C.Torres ChideroliR.Espirito SantoK.Dib GonçalvesD.Di SantisG. W.et al (2021). Interspecies transmission of Edwardsiella ictaluri in Brazilian catfish (Pseudoplatystoma corruscans) from exotic invasive fish species. Dis. Aquat. Organ. ( SRAC Publication). 145, 197208. doi: 10.3354/dao03610.

  • 10

    DiceL. R. (1945). Measures of the amount of ecologic association between species. Ecology26, 297302. doi: 10.2307/1932409

  • 11

    DubytskaL. P.KoiralaR.SanchezA.ThuneR. (2022). Edwardsiella ictaluri T3SS Effector EseN modulates expression of host genes involved in the immune response. Microorganisms10, 1334. doi: 10.3390/microorganisms10071334

  • 12

    EwingW. H.McwhorterA. C.EscobarM. R.LubinA. H. (1965). Edwardsiella, a new genus of Enterobacteriaceae based on a new species, E. tarda. Int. J. Syst. Evol. Microbiol.15, 3338. doi: 10.1099/00207713-15-1-33

  • 13

    FelsensteinJ. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evol. (N. Y)39, 783791. doi: 10.1111/j.1558-5646.1985.tb00420.x

  • 14

    FergusonH. W. (2006). Systemic pathology of fish (London: Scotian Press).

  • 15

    Fernández-BravoA.FiguerasM. J. (2020). An update on the genus Aeromonas: taxonomy, epidemiology, and pathogenicity. Microorganisms8, 129. doi: 10.3390/microorganisms8010129

  • 16

    HawkeJ. P. (2015). Enteric Septicemia Of Catfish. SRAC Publication. Available online at: https://srac.msstate.edu/pdfs/FactSheets/477EntericSepticemiaofCatfish.pdf (Accessed February 16, 2026).

  • 17

    HawkeJ. P. (1979). A bacterium associated with disease of pond cultured channel catfish, Ictalurus punctatus. J. Fish. Res. Board Canada36, 15081512. doi: 10.1139/f79-219

  • 18

    HawkeJ. P.KentM.RoggeM.BaumgartnerW.WilesJ.ShelleyJ.et al (2013). Edwardsiellosis caused by Edwardsiella ictaluri in laboratory populations of zebrafish Danio rerio. J. Aquat. Anim. Health25, 171183. doi: 10.1080/08997659.2013.782226

  • 19

    HawkeJ. P.McwhorterA. C.SteigerwaltA. G.BrennerD. J. (1981). Edwardsiella ictaluri sp. nov. the causative agent of Enteric Septicemia of Catfish. Int. J. Syst. Evol. Microbiol.31, 396400. doi: 10.1099/00207713-31-4-396

  • 20

    HunterP. R.GastonM. A. (1988). Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J. Clin. Microbiol.26, 24652466. doi: 10.1128/jcm.26.11.2465-2466.1988

  • 21

    KasornchandraJ.RogersW. A.PlumbJ. A. (1987). Edwardsiella ictaluri from walking catfish, Clarias batrachus L. in Thailand. J. Fish Dis.10, 137138. doi: 10.1111/j.1365-2761.1987.tb00729.x

  • 22

    KimuraM. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol.16, 111120. doi: 10.1007/BF01731581

  • 23

    LeiraM. H.LagoA. D. A.NascimentoA.TadeuR.FreitasF. D. (2016). Principais infecções bacterianas na criação de peixes de água doce do Brasil - uma revisão. Rev. Ciec. Veterinária e Saúde Pública3, 4459. doi: 10.4025/revcivet.v3i1.32436

  • 24

    LiuJ. Y.LiA. H.ZhouD. R.WenZ. R.YeX. P. (2010). Isolation and characterization of Edwardsiella ictaluri strains as pathogens from diseased yellow catfish Pelteobagrus fulvidraco (Richardson) cultured in China. Aquac. Res.41, 18351844. doi: 10.1111/j.1365-2109.2010.02571.x

  • 25

    Lopera-BarreroN. M.RibeiroR. P.VargasL.PovhJ. A.GomesP. C.MangolinC. A.et al (2008). Caracterização genética de estoques de Prochilodus lineatus (Valenciennes 1836) (Characiformes: Prochilodontidae), utilizados em programas de repovoamento: importância para a conservação da ictiofauna e do ecossistema. Biosci. J.24, 8693.

  • 26

    LunaL. G. (1968). Manual of histologic staining methods of the Armed Forces Institute of Pathology (New York: Blakiston Division).

  • 27

    MachimbirikeV. I.CrumlishM.DongH. T.SantanderJ.KhunraeP.RattanarojpongT. (2022). Edwardsiella ictaluri: A systemic review and future perspectives on disease management. Rev. Aquac.14, 16131636. doi: 10.1111/raq.12665

  • 28

    MachimbirikeV. I.UthaipaisanwongP.KhunraeP.DongH. T.SenapinS.RattanarojpongT.et al (2021). Comparative genomics of Edwardsiella ictaluri revealed four distinct host-specific genotypes and thirteen potential vaccine candidates. Genomics113, 19761987. doi: 10.1016/j.ygeno.2021.04.016

  • 29

    MansorN. N.NordınA. S.RamlyR.SabutiA.Mohd IbrahimM. S. (2024). Prevalence of Edwardsiella ictaluri in cage cultured Pangasius spp in Pahang River and their risk factors. Int. J. Life. Sci. Bio/Technol.7, 3745. doi: 10.38001/ijlsb.1414371

  • 30

    McGinnisA.GauntP.SantucciT.SimmonsR.EndrisR. (2003). In vitro evaluation of the susceptibility of Edwardsiella ictaluri, etiological agent of enteric septicemia in channel catfish, Ictalurus Punctatus (Rafinesque), to florfenicol. J. Vet. Diagn. Investig.15, 576579. doi: 10.1177/104063870301500612

  • 31

    NagaiT.IwamotoE.SakaiT.ArimaT.TenshaK.IidaY.et al (2008). Characterization of Edwardsiella ictaluri Isolated from wild Ayu Plecoglossus altivelis in Japan. Fish. Pathol.43, 158163. doi: 10.3147/jsfp.43.158

  • 32

    NhungP. H.OhkusuK.MishimaN.NodaM.ShahM. M.SunX.et al (2007). Phylogeny and species identification of the family Enterobacteriaceae based on dnaJ sequences. Diagn. Microbiol. Infect. Dis.58, 153161. doi: 10.1016/j.diagmicrobio.2006.12.019

  • 33

    NovakowskiG. C.HahnN. S.FugiR. (2008). Diet seasonality and food overlap of the fish assemblage in a pantanal pond. Neotrop. Ichthyol.6, 567–576. doi: 10.1590/s1679-62252008000400004

  • 34

    PhuocN. N.RichardsR.CrumlishM. (2020). Environmental conditions influence susceptibility of striped catfish Pangasianodon hypophthalmus (Sauvage) to Edwardsiella ictaluri. Aquaculture523, 735226. doi: 10.1016/j.aquaculture.2020.735226

  • 35

    PlumbJ. A.QuinlanE. E. (1986). Survival of Edwardsiella ictaluri in pond water and bottom mud. Progress. Fish-Culturist48, 212214. doi: 10.1577/1548-8640(1986)48<212:SOEIIP>2.0.CO;2

  • 36

    PlumbJ. A.SanchezD. J. (1983). Susceptibility of five species of fish to Edwardsiella ictaluri. J. Fish Dis.6, 261266. doi: 10.1111/j.1365-2761.1983.tb00075.x

  • 37

    PurwaningsihU.SukendaS.LusiastutiA. M.AlimuddinA.WidanarniW.NuryatiS. (2022). The phenotypic, genotypic and pathogenicity comparison of Edwardsiella ictaluri Indonesian local isolates causing enteric septicemia of catfish. Aquac. Res.53, 36083625. doi: 10.1111/are.15865

  • 38

    ReichleyS. R.WareC.SteadmanJ.GauntP. S.GarcíaJ. C.LaFrentzB. R.et al (2017). Comparative phenotypic and genotypic analysis of Edwardsiella isolates from different hosts and geographic origins, with emphasis on isolates formerly classified as E. tarda, and evaluation of diagnostic methods. J. Clin. Microbiol.55, 34663491. doi: 10.1128/jcm.00970-17

  • 39

    RoggeM. L.DubytskaL.JungT. S.WilesJ.ElkamelA. A.RennhoffA.et al (2013). Comparison of Vietnamese and US isolates of Edwardsiella ictaluri. Dis. Aquat. Organ.106, 1729. doi: 10.3354/dao02620

  • 40

    SahooP. K.PaulA.MishraM. (2025). “ Bacterial Diseases In Freshwater Fish,” in Aquatic Animal Health Management. Eds. Kooloth ValappilR.KarunasagarI.KarunasagarI. ( Springer Nature Singapore, Singapore), 330. doi: 10.1007/978-981-96-7987-4_1

  • 41

    SaitouN.NeiM. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol.4, 406425. doi: 10.1093/oxfordjournals.molbev.a040454

  • 42

    SantanderJ.KilbourneJ.ParkJ.-Y.MartinT.LohA.DiazI.et al (2014). Inflammatory effects of Edwardsiella ictaluri lipopolysaccharide modifications in catfish gut. Infect. Immun.82, 33943404. doi: 10.1128/iai.01697-14

  • 43

    ShaoS.LaiQ.LiuQ.WuH.XiaoJ.ShaoZ.et al (2015). Phylogenomics characterization of a highly virulent Edwardsiella strain ET080813T encoding two distinct T3SS and three T6SS gene clusters: Propose a novel species as Edwardsiella Anguillarum sp. nov. Syst. Appl. Microbiol.38, 3647. doi: 10.1016/j.syapm.2014.10.008

  • 44

    SilvaL. L. M.MirandaJ. F. C. T.MartinsE. S. L.OliveiraL. S. T.JuvenalR. F. S.SilvaS. M.et al (2025). Contribution to the knowledge of the biology of Prochilodus lineatus (Valenciennes 1837) in a neotropical river basin. Bol. do Inst. Pesca51, e888. doi: 10.20950/1678-2305/bip.2024.51.e888

  • 45

    SotoE.GriffinM.ArauzM.RiofrioA.MartinezA.CabrejosM. E. (2012). Edwardsiella ictaluri as the causative agent of mortality in cultured Nile tilapia. J. Aquat. Anim. Health24, 8190. doi: 10.1080/08997659.2012.675931

  • 46

    SotoE.IllanesO.RevanF.GriffinM.RiofrioA. (2013). Bacterial distribution and tissue targets following experimental Edwardsiella ictaluri infection in Nile tilapia Oreochromis niloticus. Dis. Aquat. Organ.104, 105112. doi: 10.3354/dao02593

  • 47

    TamuraK.StecherG.KumarS. (2021). MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol.38, 30223027. doi: 10.1093/molbev/msab120

  • 48

    ThompsonJ. D.HigginsD. G.GibsonT. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res.22, 46734680. doi: 10.1093/nar/22.22.4673

  • 49

    VersalovicJ.de BruijnF. J.LupskiJ. R. (1998). “ Repetitive Sequence-based PCR (Rep-PCR) DNA Fingerprinting Of Bacterial Genomes,” in Bacterial Genomes: Physical Structure And Analysis. Eds. de BruijnF. J.LupskiJ. R.WeinstockG. M. ( Springer US, Boston, MA), 437454. doi: 10.1007/978-1-4615-6369-3_34

  • 50

    VersalovicJ.KoeuthT.LupskiR. (1991). Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial enomes. Nucleic Acids Res.19, 68236831. doi: 10.1093/nar/19.24.6823

  • 51

    ViveirosA. T. M.GodinhoH. P. (2009). Sperm quality and cryopreservation of Brazilian freshwater fish species: a review. Fish Physiol. Biochem.35, 137150. doi: 10.1007/s10695-008-9240-3

  • 52

    YangJ.LinY.WeiZ.WuZ.ZhangQ.HaoJ.et al (2023). Edwardsiella ictaluri almost completely occupies the gut microbiota of fish suffering from Enteric Septicemia of Catfish (Esc). Fishes8, 30. doi: 10.3390/fishes8010030

Summary

Keywords

antimicrobial susceptibility, edwardsiellosis, genetic diversity, native fish, pathogenicity

Citation

Carneiro SP, Silva TMF, Rosa JCC, Figueiredo HCP, Leal CAG and Tavares GC (2026) Edwardsiella ictaluri infection in wild streaked prochilod (Prochilodus lineatus, Valenciennes) in Brazil. Front. Aquac. 5:1825395. doi: 10.3389/faquc.2026.1825395

Received

07 March 2026

Revised

02 May 2026

Accepted

19 May 2026

Published

30 June 2026

Volume

5 - 2026

Edited by

Fabiana Pilarski, São Paulo State University, Brazil

Reviewed by

Enric Gisbert, Institute of Agrifood Research and Technology (IRTA), Spain

Anuj Tyagi, Rani Lakshmi Bai Central Agricultural University, India

Updates

Copyright

*Correspondence: Guilherme Campos Tavares,

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics