Abstract
Biosurfactants are amphiphilic biomolecules that are produced by microorganisms and have important industrial, environmental, and biomedical applications because of their biodegradability, low toxicity, and high surface activity. In the present study, the potential of biosurfactant production by a Lactobacillus helveticus indigenous strain (MTCC 5463) was investigated using integrated in silico, molecular, biochemical, and analytical approaches focused on the conserved non-ribosomal peptide synthetase (NRPS) adenylation domain. Comparative sequence and domain analysis of the Bacillus velezensis FZB42 reference identified domains for adenylation, condensation, and peptidyl carrier proteins (PCP) that are shared by biosurfactant biosynthetic genes. The AMP-binding domain was amplified, and then the resulting fragment was directionally cloned into the pET-28a expression vector and expressed in Escherichia coli BL21(DE3). A recombinant 14-kDa AMP-binding protein, which was associated with the production of a biosurfactant-like compound, was produced. The recombinant biosurfactant was extracted using chloroform:methanol solvent systems and found to have significant emulsification activity against petrol, diesel, mustard oil, and refined oil, and also its E24 value was found to be stable for 1 week. Thin-layer chromatography confirmed the presence of lipidic and glycolipid components, while FTIR analysis indicated the presence of hydroxyl, amide, aliphatic, and carbohydrate-associated functional groups, which are characteristics of a glycolipopeptide structure. The hydrophobic lipid architecture of the biosurfactant was supported by GC–MS profiling, which identified the presence of significant amounts of C16/C18 long-chain fatty acid derivatives and amides. Moreover, ¹H NMR and ¹³C NMR analyses indicated the presence of peptide bonds, glycerol/carbohydrate groups, and long hydrocarbon chains, giving further confirmation of the amphiphilic glycolipopeptide nature of the recombinant biosurfactant. In conclusion, the study shows that conserved NRPS adenylation domains can be utilized to produce biosurfactants in probiotic lactic acid bacteria and suggests that the recombinant glycolipopeptide biosurfactants produced by L. helveticus MTCC 5463 have potential for use in the industry.
1 Introduction
Biosurfactants are useful eco-friendly biomolecules having interesting physicochemical properties with important applications in industry and biomedicine (; ). Biosurfactants are amphiphilic, surface-active substances synthesized by microorganisms like bacteria, fungi, and yeasts, which decrease the surface and interfacial tension between immiscible liquids (; ). They have a special structure comprising hydrophilic and hydrophobic parts with good emulsification, wetting, foaming, and dispersion properties (; ). In the last few years, many indigenous microbial strains have come under the spotlight for being strong candidates for producing biosurfactants due to their environmental adaptability and metabolic potentials (). Because of the abovementioned properties, biosurfactants are being increasingly studied and also utilized in various applications such as environmental remediation and petroleum recovery, making them significant both scientifically and industrially (; ).
Lipopeptides and glycolipids have been the most studied and commercialized biosurfactants because of their excellent surface activity and biological properties, and surfactin (lipopeptide) and rhamnolipid (glycolipid) have good surface tension reduction along with antimicrobial, antiviral, and antiphage activities (). The growing need for environmentally and human-friendly surfactants has triggered the identification of novel sources of microbes that can produce biosurfactants. Although the production of lipopeptide and glycolipid biosurfactants by the species that belong to the genera Bacillus and Pseudomonas is well-known, recent studies have also deemed lactic acid bacteria (LAB) as potential biosurfactant-producing organisms (). Among LAB, Lactobacillus species are of particular interest since they are commonly considered to be safe (GRAS), extensively employed in the fermentation of foods, and can generate bioactive metabolites with antimicrobial and surface-active activities (). Biosurfactants from Lactobacillus species have shown a lot of potential in food preservation, pathogen inhibition, probiotic preparations, and biomedical uses. The synthesis of these molecules is usually done by non-ribosomal peptide synthetase (NRPS) systems, which construct the peptide structures without the involvement of the ribosomal translation machine (). Biosurfactant biosynthesis in these organisms is linked to multidomain NRPS systems that share conserved catalytic domains including adenylation (A), condensation (C), peptidyl carrier protein (PCP), and AMP-binding domains, which are responsible for substrate recognition, activation, and peptide elongation. All of these species retain the adenylation and AMP-binding domains, indicating their crucial role in the biosynthesis of biosurfactants and in the synthesis of structurally diverse peptide-based surface-active molecules. The adenylation domain is one of the active components of the non-ribosomal peptide synthetase systems and is one that identifies, activates, and inserts individual amino acid substrates into the assembly of peptides (). Thus, in the host-adaptation process, genome streamlining in Lactobacillus species results in reduced NRPS modular complexity () while retaining functionally essential catalytic domains. Among the 31 genera of the Lactobacillaceae family, several NRPS-associated domains, such as the amino acid adenylation (AMP) domain, AMP-dependent synthetase/ligase domain, AMP-binding C-terminal domain, and phosphopantetheine (PCP) binding domain, have been reported (). The most prominent of these are the AMP adenylation, the AMP-binding, and the PCP domains. Interestingly, many species within the family Lactobacillaceae only contain the AMP domain, suggesting the possibility that the AMP domain alone contributes to biosurfactant production. Thus, in the present study, an indigenous strain Lactobacillus helveticus MTCC 5463 containing both AMP and PCP domains was selected, and only the AMP domain was engineered to assess the role and potential of the AMP domain for biosurfactant production. For this, we have chosen Bacillus velezensis FZB42, which is a well-established biosurfactant-producing bacterium that has been widely studied for its industrial and biotechnological applications ().
Bacillus velezensis FZB42 is a well-characterized commercial biosurfactant producer with very well-studied NRPS domains, and it was chosen as the query sequence for comparative domain analysis. The present study focused on the biosynthetic potential of this indigenous strain of L. helveticus MTCC 5463 by a targeted search of the conserved adenylation (AMP) domain involved in biosurfactant production. This study aimed to isolate and express this catalytic domain to test whether the AMP domain alone is a functional contributor to the biosurfactant synthesis, as it would offer a new way for screening biosurfactant-producing microorganisms on a domain basis.
2 Materials and methods
2.1 Sequence retrieval of NRPS from Bacillus velezensis FZB42
The protein sequence of NRPS of B. velezensis FZB42 was accessed from the NCBI database (https://www.ncbi.nlm.nih.gov/). NRPS-encoding genes (NCBI Taxonomy ID 947827) that were annotated were downloaded, and amino acid sequences were obtained in the FASTA format to be further analyzed.
The NRPS sequence that was retrieved served as a query in BLASTp analysis of the NCBI non-redundant protein database. The default parameters were used with an E-value cutoff of ≤1e−5.
2.2 Pairwise alignment between Bacillus velezensis FZB42 and Lactococcus lactis subsp. lactis KF147
The NRPS protein sequences of B. velezensis FZB42 and L. lactis subsp. lactis KF147 were aligned using the Clustal W (https://www.genome.jp/tools-bin/clustalw) algorithm with default parameters. Amino acid residues that were conserved and functional motifs were used to measure sequence similarity and divergence ().
2.3 Identification of NRPS domains
The InterProScan tool was used to analyze the domain architecture of NRPS proteins of B. velezensis FZB42 and L. lactis subsp. lactis KF147. The amino acid sequences were provided to the InterProScan to provide a search of conserved NRPS domains within the provided databases of integrated signature scans, such as Pfam, SMART, PROSITE, and TIGRFAMs. To determine domain organization and conservation, functional domains—condensation (C), adenylation (A), and thiolation (T)—were annotated and compared between the two species ().
2.4 BLASTp analysis of Lactococcus lactis NRPS and domain characterization
The protein sequence of the NRPS protein of L. lactis subsp. lactis KF147 was then taken as a query sequence to perform the BLASTp () analysis of the NCBI non-redundant protein database. Based on the large amount of sequence similarity (E-value 0e−5), homologous sequences of the Lactobacillus species were found. The NRPS homologs were further analyzed through InterProScan to determine the domains of NRPS that were conserved, which included adenylation, condensation, and thiolation domains, to determine the conservation of the functions of NRPS between Lactococcus and Lactobacillus species.
2.5 Chemicals, vectors, and bacterial strains
The chemicals in the current study were all purchased from Merck Life Science Pvt. Ltd., Bengaluru, India. The adenylation domain gene was isolated from L. helveticus MTCC 5463. Cloning, sequencing, and expression were performed using Escherichia coli DH5a (plasmid pET-28a) and E. coli BL21 DE3.
2.6 Amplification and cloning of the AMP gene
The gene-specific primers were used to amplify a gene, and then the gene was ligated in the pET-28a expression vector. The product with ligation was introduced into an E. coli DH5α host cell. To authenticate the gene insert, restriction digestion was done using XhoI and EcoRI ().
Genomic DNA extraction of L. helveticus MTCC 5463 was done using the bacterial DNA extraction kit (HiMedia Laboratories Pvt. Ltd., Mumbai, India). Qualitative investigation of DNA was performed using agarose gel electrophoresis with a specific concentration of agarose at 60 V for 45 min (). The amplification of the PCR region was repeated with extracted genomic DNA by applying AMP F (5′ CTCGAGCGCAGCCAGAATACTCCT 3′) and AMP R (3′ GAATTCAATTCCACACGGATTCCG 5′). The original PCR conditions included an initial denaturation 95 °C for 5 min and the target DNA was amplified after 35 cycles (; ). Each cycle consisted of denaturation at 95 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 50 s. The final elongation was performed at 72 °C for 7 min, followed by a holding temperature of 16 °C. The dominant amplified adenylation product was run at 60 V for 30 min at 1% agarose concentration. Sanger sequencing was employed for adenylation domain sequencing using the adenylation domain primer, which was performed at Barcode Pvt Ltd., Bangalore, India.
Sequencing of the cloned insert was done after restriction digestion. Additionally, the limited insert was further subcloned into the pET-28a bacterial expression plasmid; in this operation, XhoI and EcoRI having CTCGAG and GAATTC restriction sites were used. The pET-28a cloning vector was created to express recombinant peptide sequences on a high level. To check the expression, the plasmid construct (100 ng/μL) was transferred into E. coli BL21 DE3 chemical competent cells with the help of the heat shock. The positive transformants were cultured in the Luria–Bertani (LB) media and assessed for protein expression ().
2.7 Expression of the adenylation/AMP domain
A fresh colony was chosen and transformed using the pET-28a vector and grown on an LB agar plate. Inoculation of the culture in an LB medium with kanamycin (50 μg/mL) was done to prepare the starter culture. The medium was left to incubate at 37 °C ± 2 °C (200 rpm) after 16 h (). The LB broth with the kanamycin antibiotic was inoculated with a secondary culture and left to incubate at 37 °C with shaking until the culture reached the mid-log stage (OD 0.4–0.6). The induction of protein expression was carried out through the addition of isopropyl 2-D-1-thiogalactopyranoside (IPTG) at various concentrations (0.2 to 1.0 mM). An uninduced culture was maintained as the control.
In the time-course analysis, the samples were collected at various times (1–7 h) after induction. Cells were centrifuged, suspended in lysis buffer (sample buffer), and then heat-denatured in SDS sample loading buffer. Similar contents of proteins in each sample were separated using a 12%–15% SDS polyacrylamide gel with a prestained molecular weight protein marker. After electrophoresis, Coomassie Brilliant Blue R-250 was used to stain the gel, and visualization of the protein was performed to determine the expression of the recombinant protein.
The induced cell culture was centrifuged at 4,000 rpm at 4 °C, and the pellet was extracted and kept at −80 °C until further use. To purify biosurfactants, ice-cold lysis buffer (1 M of Tris, 5 M of NaCl, 500 mM of EDTA, and 10 mg/mL of lysozyme) was added to the cell pellet. Sonication of the solution was performed for 1 min at an amplitude of 60, and the process was repeated six times ().
2.8 Purification of the recombinant biosurfactant
The sonicated supernatant was centrifuged at 6,000 rpm for 20 min 4 °C. The supernatant obtained was centrifuged again at 11,000 rpm over 20 min at 4 °C to get rid of any precipitate or suspended substance in the supernatant. The transparent supernatant was further extracted to obtain the biosurfactant.
The cell-free supernatant was corrected to pH 2.0 with the use of 6 N HCl and incubated at 4 °C overnight to enable the precipitation of the glycolipid biosurfactant ().
The biosurfactant was precipitated by acid and extracted using an organic solvent system, usually chloroform:methanol (2:1, v/v). The mixture was vigorously mixed and left to settle into organic and aqueous layers. The organic phase containing the glycolipid biosurfactant was collected and dried by removing the solvent.
2.9 Evaluation of biosurfactant activity of the extracted recombinant biosurfactant
The emulsification assay was the indirect screening technique applied in the screening of biosurfactant production. The test tube was filled with an equal volume (3 mL) of cell-free supernatant and oil (). The mixture that was formed was vigorously vortexed for 3 min and allowed to stand overnight. The stable emulsion index (E24) was calculated as the percentage of height of the emulsified layer (cm)/height of the entire column of the liquid (cm) after 24 h. Surfactin and rhamnolipid of approximately 1% (w/v) was used as positive control, and water was used as negative control (). The tests were run three times.
2.9.1 Empty vector control experiment
To exclude the possibility that the observed emulsification activity originated from endogenous E. coli membrane lipids extracted during the chloroform:methanol procedure, an E. coli BL21(DE3) strain harboring the empty pET-28a vector was processed in parallel under identical experimental conditions. The empty vector control culture was induced with IPTG, harvested, lysed by sonication, extracted using the same chloroform:methanol (2:1, v/v) protocol, and analyzed using the emulsification index (E24) assay and thin-layer chromatography (TLC).
2.10 Analytical characterization of the extracted recombinant biosurfactant
2.10.1 Thin-layer chromatography analysis
Thin-layer chromatography is one technique of separating compounds in a mixture using Rf value as basis. It is a convenient method of identifying the existence of a kind of compound. In short, the solvent system of chloroform/methanol/water (65:25:4; v/v) was adopted in the mobile phase, and 5 µL of the extracted recombinant biosurfactant was dried on a TLC plate (SDFCL, Silica gel 60/UV 254 0.5 ×20 cm, thickness 0.2 mm), which was analyzed. A TLC plate with dried recombinant biosurfactant was subsequently transferred into the TLC chamber where the solvent system was, and the developed TLC plate was moved and dried in the air. Anisaldehydes were used by uniformly applying them with distilled water on the TLC plate and viewing the plate under iodine vapor ().
Rf = Distance traveled by the solute from the origin (in cm)/Distance traveled by the solvent from the origin (in cm).
2.10.2 FTIR analysis of the extracted recombinant biosurfactant
FTIR analysis of the biosurfactant produced was performed to identify the functional groups with a scanning range of 400–4,000 cm−1 at a resolution of 4 cm−1 and then the spectra were analyzed using the IRPal (Version 2.0) software. The surface compositions and the identification of various types of chemical bonds (functional groups) were analyzed using FTIR spectroscopy, thus aiding in the elucidation of certain components of an unknown mixture ().
These infrared absorption bands determine certain molecular components and structure.
2.10.3 Molecular weight determination and molecular profiling through GC–MS
The fatty acid profiling of the produced biosurfactant was carried out by GC–MS analysis. Fatty acids present in the biosurfactant were converted into fatty acid methyl esters (FAMEs) as per the standard method. Approximately 5–10 mg of compound was hydrolyzed with HCl (2 mol/L) at a ratio of 1:10 (w/v) at 100 °C for 2 h in a sealed tube followed by recovery and methylation of free fatty acids in 5 mL of n-hexane and 14% boron fluoride-methanol (CH4BF3O) reagent, respectively (). Helium was used as carrier gas at a suitable flow rate and column pressure. Electron spectra were generated and analyzed using the standard library of chemical compounds [National Institute of Standards and Technology (NIST)] database.
2.10.4 Nuclear magnetic resonance
In order to further describe and validate the composition of extracted samples of the biosurfactant, purified by extraction, 1H and 13C NMR were conducted on a Bruker Avance NEO spectrometer. In the case of 1H NMR, 2 mg of extracted biosurfactant was dissolved in 1 mL of CDCl3, and in 13C, 6 mg of sample was dissolved in 1 mL of CDCl3. It was measured at 298.7K and at 400 MHz ().
3 Results
3.1 Sequence retrieval of NRPS from Bacillus velezensis FZB42
To find homologous genes of NRPS that were associated with biosurfactants, the query sequence was analyzed through the BLASTp tool against the NCBI non-redundant protein database, with B. velezensis FZB42 NRPS used as a query sequence. The most significant hit was a non-ribosomal peptide synthetase of L. lactis, with a query coverage of 99%, the largest score of 1,052, and an E-value of 0.0, that is, the alignment is highly significant. Even though the percentage identity was intermediate (~26%), the high query coverage and very low E-value are strong indications of functional relatedness to NRPS systems.
Other important matches have been made with hybrid NRPS polyketide synthase (PKS) proteins and other NRPS-related proteins of L. lactis, showing a query coverage of 94%–42% and E-values of 2e−123 and once again demonstrating the existence of conserved NRPS domains. Some hits were also marked as adenylate-forming enzymes, AMP-binding proteins, and CoA ligases, which are typical products of the NRPS biosynthetic machine.
3.2 Pairwise alignment between Bacillus velezensis FZB42 and Lactococcus lactis subsp. lactis KF147
To determine sequence conservation and relatedness in function, sequence alignment that was done in pairs was conducted using NRPS of B. velezensis FZB42 (ABS74181.1) as the reference control and hybrid non-ribosomal peptide synthetase/polyketide synthase of L. lactis subsp. lactis KF147 (ADA64919.1). The alignment (Figure 1) showed that several conserved regions existed in the aligned regions as shown by continuous stretches of identical (): and conservatively substituted amino acid residues.
Figure 1
It is worth noting that some of the motifs of the NRPS adenylation domains were conserved between the control and Lactococcus sequence, which indicates that some of the core catalytic functions were retained in spite of the taxonomic separation. Despite the presence of insertions, deletions, and variable regions especially near the C-terminal end of the L. lactis sequence, the general alignment showed structural preservation in the functionally relevant regions.
3.3 Domain analysis
The domain architecture analysis of query protein sequences with NRPS-related queries showed that several conserved functional domains that are typical of NRPS and PKS are present. Annotation of the InterProScan (Figure 2) showed the presence of major domains, such as the NRPS domain (IPR010060), the PCP domain (IPR009081), and the PKS domain (IPR020806), which proves the hybrid modular characteristic of the studied sequences.
Figure 2
The condensation (C) domain (IPR001242) localized in many different positions, suggesting that the peptide bond formation was active between activated amino acid substrates. The adenylation AMP-binding domain (IPR000873) and the amino acid adenylation domain (IPR010071) were highly conserved in the protein architecture, and this indicates that the protein can recognize its substrate and activate it. Moreover, the AMP-binding C-terminal domain (IPR025110) was also found, and it enabled appropriate catalytic activity and structural stability of the adenylation modules.
The number and composition of the conserved biosynthetic domains and their organization were found to be significantly different between the analyzed probiotic strains (Table 1). Lactobacillus helveticus MTCC 5463 and L. helveticus DPC 4571 shared two conserved domains each, which corresponds to a fairly simple modular biosynthetic organization. The catalytic organization of L. brevis was moderate, with four domains, whereas three domains were found for Lactobacillus iners. Lactococcus lactis subsp. lactis KF147 had the largest number of conserved domains (seven), indicating a more complex biosynthetic architecture and potentially higher catalytic and metabolite-producing capacity. The number of domains found varied (Supplementary Table 1) in some strains (five and three domains in Lactiplantibacillus plantarum WCFS1).
Table 1
| S.No. | Strain | IPR00981 (Phosphopantetheine binding ACP domain) | IPR000873 (AMP dependent synthetase ligase domain) |
|---|---|---|---|
| 1. | Lactobacillus helveticus MTCC 5643 | 9 bp - 390 bp | 502 bp -857 bp |
| 2. | Lactiplantibacillus plantarum WCFS1 NRPS Nps A | 477 bp – 522 bp , 1465 bp – 1544 bp , 2420 bp – 2500 bp , 3401 bp – 3478 bp, 4804 bp – 4881 bp | 9 bp - 381 bp , 1001 bp - 1372 bp , 1968 bp -2333 bp, 2922 bp - 3307 bp, 4328 bp -4706 bp |
| 3. | Lactiplantibacillus plantarum WCFS1 NRPS Nps B | 476 bp – 553 bp | 15 bp – 105 bp, 121 bp – 374 bp, |
| 4. | Levilactobacillus brevis KB290 | 1019 bp -1094 bp | 535 bp – 922 bp |
| 5. | Lactobacillus helveticus DSM 20075 | 502 bp – 540 bp | 9 bp – 390 bp |
| 6. | Lactobacillus iners AB-1 | 493 bp – 556 bp | 15 bp – 393 bp |
| 7. | Lactobacillus psittaci DSM 15354 | 464 bp - 541 bp | 9 bp – 385 bp |
| 8. | Lactobacillus helveticus CIRM-BIA10 | 502 bp – 540 bp | 9 bp – 390 bp |
| 9. | Lapidilactobacillus concavus DSM 17758 | 184 bp – 262 bp | 13 bp – 77 bp |
| 10. | Lactobacillus iners LEAF 2052-A-d | 486 bp – 551 bp | 15 bp – 393 bp |
Identification and localization of conserved non-ribosomal peptide synthetase (NRPS) domains in selected Lactobacillus and related bacterial strains.
The AMP-binding domain was present in all the strains analyzed and was found to be highly conserved, suggesting that it is an important domain for binding to the substrates and activation in non-ribosomal peptide biosynthesis.
3.4 Amplification and cloning of the AMP gene
Colony growth in selective media and restriction digestion analysis were found satisfactory to prove successful transformation and cloning. No colony was present on the control plate, but there were several colonies well isolated on the recombinant plate, which is an indication of a successful transformation of competent cells with the recombinant plasmid construct.
The plasmid DNA was then isolated using selected colonies, and it was confirmed that it contained an insert by subjecting it to the double digestion technique using EcoRI and XhoI enzymes. Digestion patterns were clear as seen in agarose gel electrophoresis analysis. The molecular marker (M) ensured that size estimation was correct. Lanes 5 to 9 had different bands, which represented the anticipated size of the insert fragment of the target gene in the position, which is approximately 353 bp, indicating a successful cloning of the gene fragment into the vector (Figure 3).
Figure 3
There were undigested patterns or partial digestion patterns in some lanes (1–4) with undigested or undigested plasmid, and with positive clones, there were patterns that contained the release of the insert fragment of the cloning product (observed after restriction digestion).
3.5 Expression of the adenylation/AMP domain
The expression profile of the recombinant protein having the expected molecular weight of approximately 14 kDa was analyzed using SDS–PAGE. In the upper panel (concentration-based induction), lanes were molecular marker (M), uninduced control (UI), and inducer concentrations of increasing value (0.2–1.0 MM). A clear protein band that was of the size of approximately 14 kDa was seen in induced samples, whereas it was weak or non-existent in the uninduced control. The intensity of the 14-kDa band increased gradually along with the concentration of the inducer, reaching its highest level at higher concentrations (0.6–1.0). This is an indication of the success of induction and overexpression of the recombinant protein (Figure 4).
Figure 4
In the lower panel (time-course induction), the lanes indicate molecular marker (M), uninduced control (UI), and the sample taken between 1 and 7 h after induction. A significant 14-kDa band appeared following induction and increased over time. The greatest expression was obtained between 5 and 7 h after induction, confirming the time-dependent accumulation of the recombinant protein.
3.6 Purification of the recombinant biosurfactant
The product associated with the recombinant protein was extracted in chloroform:methanol (1:1 and 2:1 ratios) (; ), and samples were taken at various time intervals (1–7 h). With the system of chloroform:methanol (1:1), a progressive precipitation was noted as the extraction time increased. A slightly white precipitate was formed at the initial time points (1–3 h) and intensified at 4–6 h. Maximum visible accumulation was observed at 7 h, indicating time-dependent extraction efficiency.
The precipitation was more pronounced in the chloroform:methanol (2:1) system than in the 1:1 ratio. An apparent rise in turbidity and the development of a white precipitate were seen after 3 h. The largest amount was observed when the trial was performed at 5 h, and a thick white precipitate was evident, which indicated the best extraction state at this time (Figure 5). Precipitation could be seen beyond 5 h but did not increase significantly.
Figure 5
3.7 Evaluation of biosurfactant activity of the extracted recombinant biosurfactant
The extracted biosurfactant was evaluated for emulsification activity using petrol, mustard oil, refined oil, diesel oil with water (as a negative control), and rhamnolipid and surfactin (as positive controls). The measurement of emulsification index (E24%) was performed at 24 h, 48 h, 72 h, and 1 week.
The emulsification efficiency of the recombinant product (5-h sample) was the best (approximately 75%–82% during all the observation periods) as compared to rhamnolipid (52%–56%) and surfactin (65%–72%). The stability of the emulsion was evaluated: the emulsion was stable for 1 week with very less variation, showing good surface-active properties. The visual observations also showed that a stable and creamy emulsion layer was formed, which was also confirmed by the controls (Figures 6A, B).
Figure 6
Furthermore, mustard oil containing recombinant resulted in significantly higher emulsification efficiency (88%–95%), while rhamnolipid and surfactin showed lower emulsification activity of approximately 10%–12% and 30%–38%, respectively (Figures 6A,B). The emulsion was stable for 1 week, and a thick emulsion layer was seen, indicating better emulsifying potential of the recombinant product against vegetable oil.
There was an improvement in emulsification efficiency with an increase in the 5-h sample in the case of refined oil, with an efficiency of approximately 65%–75% at 24 h and a stable efficiency of ~65%–70% even after 1 week. By contrast, rhamnolipid did not have significant emulsification activity (~4%–6%) and surfactin had moderate activity (~46%–50%) (Figures 6C, D). A thick and stable emulsion layer was formed, further confirming the enhanced emulsification of the recombinant product in refined oil.
Similarly, the sample of diesel oil, produced by recombination, showed the best emulsification efficiency, approximately 75%–82% at 24 h and which was maintained after 1 week (~72%–78%). The emulsification values for rhamnolipid and surfactin were approximately 52%–56% and 63%–70%, respectively (Figures 6C, D). A visible and stable emulsion layer persisted as a result of the high hydrocarbon-emulsifying potential of the recombinant product.
The overall result indicates that the emulsification property of the recombinant biosurfactant is better and stable than that of the standard biosurfactants for various hydrocarbons/oils such as petrol, mustard oil, refined oil, and diesel oil.
3.7.1 Evaluation of biosurfactant activity in the empty vector
The emulsification activity was not derived from native E. coli membrane lipids extracted by the chloroform:methanol solvent system; an empty pET-28a BL21(DE3) control was subjected to the same induction, extraction, and analytical procedures. The extract obtained from the empty-vector control showed no measurable emulsification activity against petrol, diesel, mustard oil, or refined oil (Supplementary Figure 1). Furthermore, TLC analysis did not reveal bands (Supplementary Figure 1) corresponding to the recombinant biosurfactant. These findings indicated that the observed emulsification activity was associated with the recombinant construct rather than the host-derived lipid components.
3.8 Analytical characterization of the extracted recombinant biosurfactant
3.8.1 Thin-layer chromatography analysis
Analysis of the extracted compound was conducted using TLC, and the compound was identified using iodine vapor anisaldehyde reagent, which detects lipidic or glycolipid constituents.
Iodine staining allowed the appearance of a clear yellow-brown spot with an Rf value of 0.80, which means that the selected solvent system is highly mobile. The iodine stain usually reacts with non-polar or lipid compounds, which implies that hydrophobic components are found in the sample extract.
When the anisaldehyde reagent was sprayed, a clear colored spot was obtained with an Rf value of 0.75. Anisaldehyde is widely utilized in the detection of lipids as well as other secondary metabolites (Figure 7).
Figure 7
3.8.2 FTIR analysis of the purified recombinant biosurfactant
FTIR spectroscopy provided insights into the functional groups present in the biosurfactant (Figure 8). A strong band at 3,325 cm−1 was assigned to hydrogen-bonded O–H/N–H stretching, consistent with carbohydrate and protein moieties (; ; ). Aliphatic C–H stretching was observed at 2,916 cm−1, while C–H bending vibrations of CH2 and CH3 groups was noted at 1,432 cm−1, confirming the presence of long hydrocarbon chains (; ). A band at 1,649 cm−1 was assigned to C=O stretching (amide I) or C=C stretching (). Similar C=O stretching has been reported at 1,622 cm−1, which suggests ester or amide linkages, and at 1,651 cm−1, indicating ester linkages in Lactobacillus biosurfactants (; ). Additionally, C–O stretching at 1,021 cm−1 pointed toward the presence of carbohydrate or ester linkages (). This is consistent with O–C–O and C–O–C stretching vibrations in glycolipid/polysaccharides structures from Lactobacillus species (; ). Collectively, these findings identify the biosurfactant as a likely glycolipopeptide, characterized by strong hydrogen bonding, aliphatic chains (lipid), amide linkages (peptide), and carbohydrate/ester functionalities (glyco) ().
Figure 8
3.8.3 Molecular profiling through GC–MS
To examine the chemical composition and structural characteristics of the isolated biosurfactant, GC–MS analysis was performed (Figure 9). The resulting total ion chromatogram (TIC) (Supplementary Table 2) and peak integration profiles revealed a complex mixture, predominantly composed of long-chain fatty acids, aliphatic amides, and ester compounds. The most abundant compound identified was 9-octadecenamide, accounting for 20.50% of the total relative area. This was accompanied by significant amounts of fatty acid derivatives, including tricyclo[20.8.0.0(7,16)]triacontane, 1(22),7(16)-diepoxy- (10.99%), 9-octadecenoic acid (Z)-, 2,3-dihydroxypropyl ester (8.50%), and 9-octadecenoic acid methyl ester (E)- (8.32%). Minor constituents included aliphatic hydrocarbons such as dodecane, tetradecane, and hexadecane, as well as isopropyl myristate (1.41%) and hexadecanoic acid methyl ester (2.55%). The predominance of long-chain fatty acid derivatives and amides, particularly C16 and C18 compounds, confirms the lipid-rich and hydrophobic nature of the biosurfactant tail region. The structural profile suggests an amphiphilic architecture in which long hydrocarbon chains form the hydrophobic domain, likely linked to a polar head group containing polyol or amine residues (). Such hydrophobic moieties are structurally important for surface tension reduction, emulsification, and micelle formation in amphiphilic biomolecules ().
Figure 9
3.8.4 Nuclear magnetic resonance
¹H NMR analysis resolved the proton environments within the amphiphilic biosurfactant structure. The hydrophobic domain featured strong signals at δ 1.23–1.58 ppm, linked to methylene protons from long-chain fatty acyl groups, along with a broad signal at δ 3.46 ppm. The hydrophilic head group displayed glyceryl and/or carbohydrate-associated proton signals at δ 3.72 ppm and protons near heteroatoms (N or O) at δ 3.74 ppm. Signals in the δ 4.3–4.9 ppm range confirmed the presence of −O−CH− and sugar alcohol protons in the polar domain (; ). A broad singlet observed at δ 7.3 ppm was assigned to exchangeable amide N–H protons, providing spectroscopic evidence for peptide-associated functionalities in the glycolipopeptide structure. This chemical shift is characteristic of hydrogen-bonded or solvent-exposed amide protons in peptide linkages, supporting the presence of a proteinaceous component integrated within the biosurfactant matrix ().
The ¹³C NMR spectrum further complemented these findings by resolving the carbon framework of the biosurfactant (Figure 10). The aliphatic lipid skeleton consisted of methylene and methyl carbons in the upfield region. The signal at δ 18 ppm was assigned to terminal or branched methyl carbons, consistent with branched-chain fatty acids commonly observed in Lactobacillus-derived amphiphiles (; ). Resonances at δ 66 ppm and δ 76 ppm corresponded to O–CH2– and –CH–O– carbons associated with glycerol/carbohydrate moieties, confirming the polyol-rich nature of the hydrophilic head group. Furthermore, signals at δ 56 ppm and δ 58 ppm were attributed to α-methine carbons of amino acid residues within the peptide segment, corroborating the ¹H NMR evidence for amide functionalities. Moreover, olefinic carbons at δ 128–130 ppm and carbonyl carbons (δ 173–175 ppm) were found, suggesting the presence of unsaturated C18 acyl chains and amide/ester linkage, respectively (). The ¹H and ¹³C NMR data further support the presence of a multicomponent glycolipopeptide structure (Figure 11) without redundant interpretation of functional groups already established by complementary analytical techniques (; ; ; ; ).
Figure 10
Figure 11
4 Discussion
This paper combines the in silico NRPS domain study with experimental characterization to understand the potential of the chosen L. helveticus MTCC 5463 to produce biosurfactant. Recent reports of the genetic basis of biosurfactant biosynthesis based on the identification of NRPS domains support previous studies that NRPS-mediated pathways are central to the biosynthesis of lipopeptide and glycolipid biosurfactants in various bacterial taxa (; ).
BLAST analysis of the query sequence showed that it has high homology to well-characterized NRPS systems, specifically those reported in B. velezensis and L. lactis that are known to produce surface-active compounds, including surfactin and other lipopeptides. Functional activity of the biosynthetic machinery is indicated by the conservation of core domains of NRPS adenylation domain. It is particularly important that adenylation domains were found, and they specify substrate specificity, which affects the structural variety and activity of biosurfactants directly (; ).
The target gene was cloned at the molecular level by isolating pET28a plasmids that underwent the two-step digestion of EcoRI and XhoI that produced the target insert and size components of the vectors. The observed stable digestion patterns of different clones are evidence of proper ligation and stable support of the recombinant construct. This form of limitation-based validation is also a strong method of confirming recombinant plasmids before proceeding to expression experiments.
The analysis of heterologous expression of protein by SDS–PAGE showed a clear protein band with an approximate molecular weight of 14 kDa that was not detected in uninduced controls but increased gradually with the increase in IPTG induction. Experiments of optimization indicated that optimum protein accumulation was observed with a moderate concentration of IPTG and longer induction time. This finding may be corroborated with earlier reports that report that high levels of IPTG usually would not proportionally increase the yield of proteins and could actually lead to metabolic stress on host cells. The fact that the protein was not heavily aggregated or smeared also indicates that the recombinant protein was produced in a relatively stable form that can be used in downstream functional studies. Solution extraction with chloroform:methanol mixtures was effective in the recovery of the biosurfactant. Chloroform:methanol (2:1) was the best extraction mixture, demonstrating higher extraction efficiency (based on increased turbidity and observable accumulation of visible biosurfactant) under test conditions of 6 h of extraction duration (). This improved recovery is explained by the increased content of chloroform that increases the solubilization of lipid-rich amphiphilic molecules. Effective extraction of microbial biosurfactants and lipids has been reported in a variety of solvent systems. Strong surface activity of the extracted biosurfactant was confirmed using functional evaluation by emulsification evaluation. A high and consistent E24 was found in mustard oil and diesel oil with a minimal decrease in a span of 1 week. This is a characteristic property of good biosurfactants, which is required to be able to exist on an interface over long periods of time. The high level of emulsification of vegetable oil (mustard oil) indicates the high compatibility with triglyceride-rich substrates, whereas the high activity in diesel oil indicates the preference of the biosurfactant to work well with complex mixtures of hydrocarbons.
The high emulsification efficiency observed against petrol, diesel, and vegetable oils demonstrates the potential of the recombinant biosurfactant for hydrocarbon emulsification and environmentally sustainable bioprocesses. From a One Health perspective, biosurfactants offer eco-friendly alternatives to synthetic surfactants because they are biodegradable and exhibit lower toxicity. Their application in the remediation of petroleum-contaminated soils and aquatic environments may reduce environmental pollution and consequently decrease risks to ecosystem, animal, and human health.
To perform initial characterization of the extracted biosurfactant, TLC was used, in which iodine vapor and anisaldehyde were used as visualization reagents. The iodine-stained plate showed a bright yellow-brown spot with an Rf value of 0.80, showing the existence of the relatively non-polar compound and having a lot of hydrophobic properties, which is a characteristic of lipid-based biosurfactants (). Unsaturated and hydrophobic moieties react with iodine, thus making it easy to detect lipid components. Likewise, anisaldehyde staining yielded a visible brown-colored spot with an Rf value of 0.75, implying the occurrence of functional groups like carbohydrates, alcohols, or ester linkages, which are typical of glycolipid or lipopeptide biosurfactants (). The similarity of the values of Rf obtained using the two detection methods implies the presence of one major component and relatively high level of purity of the extracted biosurfactant, but the presence of faint spots close to the origin may reflect some minor impurities. The comparatively high Rf value also confirms the amphiphilicity and moderately non-polar character of the compound in accordance with the already documented TLC profiles of biosurfactants like rhamnolipids, sophorolipids, and surfactin (). On the whole, these results support the successful extraction and preliminary characterization of the biosurfactant, whereas Supplementary Methods of analysis like FTIR, GC–MS, or NMR are suggested to provide the final structural explanation and definition of its chemical identity.
The extracted biosurfactant contained functional groups, the nature of which was determined by FTIR that can give details on the chemical bond and molecular structure of biomolecules. The FTIR spectrum showed that it contains several typical absorption bands that would show the presence of both hydrophilic and hydrophobic groups that are also characteristic of biosurfactants.
A broad absorption band at 3,325 cm−1 is associated with OH and NH vibrations that are typical of hydroxyl and amide groups. This implies the presence of peptide bonds or hydroxyl groups, which means the biosurfactant has proteinaceous or peptide constituents. These bands are commonly observed in lipopeptide biosurfactants like surfactin in which the amphiphilicity structure is provided by the peptide moiety. The maximum at 2,916 cm−1 is related to C–H vibrations of aliphatic chains, which testifies to the existence of long hydrophobic fatty acid chains (). This proves the lipid part of the biosurfactant molecule, which plays a role in lowering surface tension and increasing emulsification characteristics. This situation has been found to be similar with glycolipid biosurfactants like rhamnolipid, in which the lipid chain plays a role in hydrophobic interactions. The absorption band at 1,649 cm−1 is associated with amide I (C=O stretching) vibrations, which are indicative of peptide bonds. This band indicates the existence of peptide or protein foldings within the biosurfactant molecule. This area frequently reflects lipopeptide structures synthesized by bacterial structures in microbial biosurfactants. The highest point in 1,432 cm−1 is the C–H bending vibrations and potential COO− symmetric vibrations, which are normally related to the aliphatic groups or carboxylate functional groups. These functional groups are significant in stabilizing the amphiphilic properties of biosurfactants as well as the interactions with hydrophobic substrates.
The other important peak at 1,021 cm−1 corresponds to C–O–C and C–O vibrations, which show the existence of carbohydrate or ester groups. This maximum is usually found in glycolipid biosurfactants in which the sugar moieties are conjugated to the lipid chain.
FTIR analysis reveals the occurrence of functional groups of hydroxyl, amide, aliphatic, and carbohydrate structures, which indicate that the resultant biosurfactant adopts an amphiphilic molecular structure with both lipid and peptide/carbohydrate structures. These functional groups cause the surface-active and emulsifying effects of biosurfactants. Despite the fact that FTIR is useful in giving information about the chemical bond and functional groups of the molecule, it cannot be used to identify the chemical elements of the molecule. Hence, additional characterization was performed using GC–MS to identify the exact organic compounds and fatty acid derivatives that occur in the biosurfactant extract. GC–MS analysis facilitates the separation and identification of volatile and semivolatile compounds according to retention time and fragmentation pattern in mass spectrals, thus giving a detailed content of the molecular structure of the biosurfactant ().
The chemical content of the biosurfactant was further determined by gas chromatography–mass spectrometry, which allows the determination of volatile and semivolatile organic compounds based on time retention and mass spectral characteristics. The TIC showed that there are various peaks that were spread around at the range of approximately 8–35 min, suggesting that there are several organic compounds present in the extracted biosurfactant.
In the chromatogram, a prominent peak was observed at 16.18 min, indicating the existence of dominant lipid-based compounds. Peaks in this retention region are frequently attributed to fatty acid derivatives, methyl ester, or long-chain hydrocarbons, which form the hydrophobic part of amphiphilic molecules. These lipid elements contribute to the reduction of surface and interfacial tension, which is a characteristic aspect of biosurfactants.
The structural profile suggests an amphiphilic architecture in which long hydrocarbon chains form the hydrophobic domain, likely linked to a polar head group containing polyol or amine residues (). Such hydrophobic moieties are structurally important for surface tension reduction, emulsification, and micelle formation in amphiphilic biomolecules ().
The structural description of the biosurfactant extracted was also done using nuclear magnetic resonance spectroscopy, which gives detailed information of the hydrogen and carbon environment within the molecule (). ¹H NMR and ¹³C NMR spectra were investigated to verify the presence of functional groups that were identified in the prior analyses of the FTIR and GC–MS.
The 1H NMR spectrum indicated signals primarily in the ranges of 3.1 to 3.8, 1.2 to 1.6, and 0.8 to 0.9 ppm. The high-intensity signal at 0.81 ppm signify terminal −CH32−O/−CH−O protons on a long aliphatic chain, thus demonstrating the existence of fatty acid molecules, which are common with lipid molecules. The signals identified in the range of 1.2–1.6 ppm are attributed to the presence of methylene (–CH2− groups in long chains of hydrocarbons), which additionally proves the existence of lipid moieties. These proton signals are those of fatty acid derivatives, which are typical of microbial biosurfactants (). Also, resonance at 3.1–3.8 ppm may be identified with α-methylene protons located near the carbonyl groups (–CH2CO–), indicating the existence of an ester or amide bond. The 3.5-ppm peaks could indicate protons attached to oxygenated carbons (–CHO or –CH2O) that frequently occur in the structure of carbohydrates or esters.
These structural aspects were also confirmed by the ¹³C NMR spectrum. The presence of carbon signals at 58–60 ppm assigned to C–O indicates alcohol, ester, or carbohydrate carbons. The presence at 14–22 ppm corresponds to terminal methyl carbon (). The presence of ester, alcohol, or glycosidic groups is suggested by the presence of oxygenated carbons as seen between 50 and 60 ppm. These oxygenated carbons help the biosurfactant molecule to be amphiphilic (; ).
Collectively, the NMR data support the conclusions made by the FTIR and GC–MS analyses, indicating that the resulting biosurfactant is made of long hydrocarbon chains as well as oxygenated functional groups, which make it amphiphilic and surface-active. The ¹H and ¹³C NMR data further support the presence of a multicomponent glycolipopeptide structure without redundant interpretation of functional groups already established by complementary analytical techniques (; ; ; ; ). The overall spectroscopic results consequently indicate that the biosurfactant has structural features similar to those of reported microbial biosurfactants, with lipid and oxygenated functional moieties.
Although the recombinant AMP-binding protein (~14 kDa) was associated with the production of a biosurfactant-like compound, the isolated adenylation domain alone is unlikely to catalyze complete glycolipopeptide biosynthesis because canonical NRPS assembly requires the coordinated activity of the adenylation (A), thiolation (T/PCP), and condensation (C) domains. Comparative genomic analysis of Lactobacillaceae revealed that numerous genomes encode orphan AMP-binding domain-containing proteins without complete NRPS modules, suggesting that these proteins may possess non-canonical biological functions. Furthermore, several recent studies have demonstrated that microbial secondary metabolism also involves non-canonical NRPS architectures (), where biosynthetic functions are carried out by split, minimal, or non-modular enzymes rather than classical multidomain NRPS assembly lines (; ). We therefore hypothesize that the recombinant AMP-binding domain indirectly influences biosurfactant production by interacting with endogenous metabolic pathways or adenylation-dependent enzymes present in the E. coli host rather than functioning as an independent biosynthetic system. The precise molecular mechanism underlying this interaction remains unknown. As a future direction, our research will focus on elucidating this mechanism using comparative transcriptomic (RNA-seq) analysis of recombinant and empty-vector E. coli strains, complemented by proteomic and metabolomic investigations. These integrated omics approaches will help identify differentially expressed genes, affected metabolic pathways, and regulatory networks associated with the observed biosurfactant phenotype.
5 Conclusion
The current experiment was able to show that an overall approach of in silico genomic, molecular cloning, heterologous expression, biochemical extraction, functional analysis, and high-level analytical characterization was able to explain the biosurfactant-producing potential of L. helveticus MTCC 5463. Computational analysis of NRPS domains showed the existence of conserved adenylation, condensation, and peptidyl carrier protein domains, which proved that the organism had the genetic potential to synthesize biosurfactants using NRPS-mediated pathways. The successful construction of the recombinant plasmid was experimentally validated using molecular cloning and restriction digestion, and a clear inducible protein band of approximately 14 kDa was observed after IPTG induction in heterologous expression analysis, which is a good indication that the target gene is well expressed. Optimization of the extraction of the biosurfactant was carried out through the use of chloroform:methanol solvent systems with a 2:1 ratio, giving maximum recovery of the amphiphilic molecules. The strong surface activity and emulsification stability of the prepared functional characterization was evidenced by emulsification tests using different hydrophobic substrates such as diesel oil and mustard oil. The elevated and constant values of E24 during the prolongation of incubation duration demonstrate the strength and possible industrial use of the resulting biosurfactant. Spectroscopic and chromatographic studies revealed in-depth information on the details of the molecular features of the extracted compound. The functional group analysis based on Fourier transform infrared spectroscopy showed the existence of hydroxyl, amide, aliphatic, and carbohydrate-related functional groups, which indicated an amphiphilic molecular structure. More chemical analysis based on gas chromatography–mass spectrometry demonstrated the presence of various lipid-based products such as fatty acid derivatives and long-chain hydrocarbons, commonly found in microbial biosurfactants. The combined results of FTIR spectroscopy, GC–MS, and NMR spectroscopy indicate that biosurfactants produced by microbial Lactobacillus possess a complex, multicomponent glycolipopeptide nature.
Statements
Data availability statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Author contributions
MK: Investigation, Software, Writing – original draft, Data curation, Visualization, Formal analysis, Methodology. KP: Writing – review & editing, Formal analysis, Software, Visualization, Methodology, Data curation, Investigation. SM: Data curation, Formal analysis, Supervision, Visualization, Writing – review & editing. BS: Funding acquisition, Validation, Writing – review & editing, Supervision, Formal analysis, Investigation, Data curation, Conceptualization, Resources, Visualization, Writing – original draft, Methodology.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This research was supported by the Council of Science and Technology, Uttar Pradesh, India (Grant number: CSTUP-BTBR/4/2024/D-2084).
Acknowledgments
The authors greatly acknowledge the support of Gautam Buddha University (Greater Noida) and G.B. Pant University, Pantnagar, in writing this manuscript. The authors acknowledge the support of the DST-FIST and UP-CST grants in writing this manuscript. The authors greatly acknowledge the support of Anand Agricultural University, Gujarat, for providing the Lactobacillus strains for the research purpose.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fbrio.2026.1895576/full#supplementary-material
Supplementary Figure 1Negative control analysis of the empty pET-28a vector expressed in Escherichia coli BL21. (A) Emulsification assay of the crude extract obtained from E. coli BL21 transformed with the empty pET-28a vector (without the gene of interest) against refined oil, mustard oil, petrol, and diesel, showing no significant emulsification activity. (B) Thin-layer chromatography (TLC) analysis of the extracted metabolites developed with anisaldehyde and iodine staining, showing the absence of detectable glycolipid or lipopeptide biosurfactant bands.
Supplementary Table 1Distribution of predicted NRPS-associated domains among selected Lactobacillus, Lactococcus, and related probiotic species.
Supplementary Table 2Major compounds identified in the total ion chromatogram (TIC) of the isolated biosurfactant by GC-MS analysis.
References
1
AliH.RiesM. I.LankhorstP. P.Van Der HoevenR. A. M.SchoutenO. L.NogaM.et al. (2014). A non-canonical NRPS is involved in the synthesis of fungisporin and related hydrophobic cyclic tetrapeptides in Penicillium chrysogenum. PloS One9, e98212. doi: 10.1371/journal.pone.0098212
2
AliakbariM.KarkhaneA. A. (2024). In vivo cloning of PCR product via site-specific recombination in Escherichia coli. Appl. Microbiol. Biotechnol.108, 400. doi: 10.1007/s00253-024-13239-7
3
ButlerL.AwanA. R.EllisT.AkramM. S. (2026). Engineering non-ribosomal peptide synthesis: tuning the antibiotics engine of the microbial world. Crit. Rev. Biotechnol.46, 501–521. doi: 10.1080/07388551.2026.2615819
4
ChenX.LuY.ShanM.ZhaoH.LuZ.LuY. (2022). A mini-review: mechanism of antimicrobial action and application of surfactin. World J. Microbiol. Biotechnol.38, 143. doi: 10.1007/s11274-022-03323-3
5
CondursoH. L.BrunerS. D. (2012). Structure and noncanonical chemistry of nonribosomal peptide biosynthetic machinery. Nat. Prod. Rep.29, 1099. doi: 10.1039/c2np20023f
6
DingN.DongH.OngenaM. (2025). Bacterial cyclic lipopeptides as triggers of plant immunity and systemic resistance against pathogens. Plants14, 2644. doi: 10.3390/plants14172644
7
El Arnouki BelhajiF.De RuysscherD.VanreppelenG.HuybrechtsL.-L.AlanjaryM. M.ZdoucM. M.et al. (2025). Charting the biosynthetic landscape of hybrid polyketide-nonribosomal peptide-specialized lipids. doi: 10.1101/2025.10.24.682833
8
Eras-MuñozE.FarréA.SánchezA.FontX.GeaT. (2022). Microbial biosurfactants: a review of recent environmental applications. Bioengineered13, 12365–12391. doi: 10.1080/21655979.2022.2074621
9
GauthierC.LavoieS.KubickiS.PiochonM.CloutierM.Dagenais-RoyM.et al. (2024). Structural characterization of a nonionic rhamnolipid from Burkholderia lata. Carbohydr. Res.535, 108991. doi: 10.1016/j.carres.2023.108991
10
GayathiriE.PrakashP.KarmegamN.VarjaniS.AwasthiM. K.RavindranB. (2022). Biosurfactants: potential and eco-friendly material for sustainable agriculture and environmental safety—a review. Agronomy12, 662. doi: 10.3390/agronomy12030662
11
GoyalM. R.VeenaN.MishraS. K. (2023). Analytical Methods for Milk and Milk Products: Volume 3: Microbiological Analysis, Isolation, and Characterization. 1st Edn (New York: Apple Academic Press). doi: 10.1201/9781032676074
12
GudiñaE. J.TeixeiraJ. A.RodriguesL. R. (2010). Isolation and functional characterization of a biosurfactant produced by Lactobacillus paracasei. Colloids Surfaces B. Biointerfaces76, 298–304. doi: 10.1016/j.colsurfb.2009.11.008
13
IshikawaF.NoharaM.NakamuraS.NakanishiI.TanabeG. (2020). Precise probing of residue roles by NRPS code swapping: mutation, enzymatic characterization, modeling, and substrate promiscuity of aryl acid adenylation domains. Biochemistry59, 351–363. doi: 10.1021/acs.biochem.9b00748
14
Kosaric (2017). Biosurfactants and Biotechnology. 1st Edn. Eds. KosaricN.CairnsW. L.GrayN. C. C. ( Routledge). doi: 10.1201/9781315138428
15
K.R.G.T.M.N.PeterA.C.N.L. R.V.K. K. (2025). Molecular cloning and heterologous expression of lipase gene from Pseudomonas aeruginosa in Escherichia coli. Int. J. Biol. Macromol.297, 139866. doi: 10.1016/j.ijbiomac.2025.139866
16
KumariM.PandeyK.KhumanA.ChaudharyB.SinghalB. (2026). Unveiling the structural diversity of non-ribosomal peptide synthetases in the Lactobacillaceae family through in silico approaches. Discov. Bact3, 3. doi: 10.1007/s44351-025-00039-1
17
LakraU.KumarV.DhanS.NigamV. K.SharmaS. R. (2025). Characterization and evaluation of biosurfactant produced from a thermophilc Bacillus licheniformis. Biorem. J.29, 25–41. doi: 10.1080/10889868.2024.2326570
18
LeeD. W.LeeH.KwonB.-O.KhimJ. S.YimU. H.KimB. S.et al. (2018). Biosurfactant-assisted bioremediation of crude oil by indigenous bacteria isolated from Taean beach sediment. Environ. pollut.241, 254–264. doi: 10.1016/j.envpol.2018.05.070
19
MadhuA. N.PrapullaS. G. (2014). Evaluation and functional characterization of a biosurfactant produced by Lactobacillus plantarum CFR 2194. Appl. Biochem. Biotechnol.172, 1777–1789. doi: 10.1007/s12010-013-0649-5
20
MedhiM. K.AmbustS.KumarR.DasA. J. (2023). “ Characterization and purification of biosurfactants,” in Advancements in Biosurfactants Research. Eds. AslamR.MobinM.AslamJ.ZehraS. ( Springer International Publishing, Cham), 79–93. doi: 10.1007/978-3-031-21682-4_4
21
Mejía-CaballeroA.López-SánchezR.Ramos-CerrilloB.GarciarrubioA.SegoviaL. (2025). Genomic insights into habitat adaptation of Lactobacillus species. World J. Microbiol. Biotechnol.41, 61. doi: 10.1007/s11274-025-04275-0
22
MnifI.GhribiD. (2015). Review lipopeptides biosurfactants: mean classes and new insights for industrial, biomedical, and environmental applications. Biopolymers104, 129–147. doi: 10.1002/bip.22630
23
MonteiroS. A.SassakiG. L.De SouzaL. M.MeiraJ. A.De AraújoJ. M.MitchellD. A.et al. (2007). Molecular and structural characterization of the biosurfactant produced by Pseudomonas aeruginosa DAUPE 614. Chem. Phys. Lipids147, 1–13. doi: 10.1016/j.chemphyslip.2007.02.001
24
MoraisI. M. C.CordeiroA. L.TeixeiraG. S.DominguesV. S.NardiR. M. D.MonteiroA. S.et al. (2017). Biological and physicochemical properties of biosurfactants produced by Lactobacillus jensenii P6A and Lactobacillus gasseri P65. Microb. Cell Fact.16, 155. doi: 10.1186/s12934-017-0769-7
25
MouafoH. T.SokamteA. T.MbawalaA.NdjouenkeuR.DevappaS. (2022). Biosurfactants from lactic acid bacteria: a critical review on production, extraction, structural characterization and food application. Food Biosci.46, 101598. doi: 10.1016/j.fbio.2022.101598
26
NagtodeV. S.CardozaC.YasinH. K. A.MaliS. N.TambeS. M.RoyP.et al. (2023). Green surfactants (biosurfactants): a petroleum-free substitute for sustainability─comparison, applications, market, and future prospects. ACS Omega8, 11674–11699. doi: 10.1021/acsomega.3c00591
27
PandeyK.KumariM.MehtabS.SinghalB. (2026). Isolation, purification, and structural characterization of biosurfactants derived from indigenous probiotics Lactobacillus helveticus MTCC5463 and Lactobacillus rhamnosus MTCC5462. Front. Bacteriol.4, 1726048. doi: 10.3389/fbrio.2025.1726048
28
ParraJ. L.GuineaJ.ManresaM. A.RobertM.MercadéM. E.ComellesF.et al. (1989). Chemical characterization and physicochemical behavior of biosurfactants. J. Americ Oil Chem. Soc66, 141–145. doi: 10.1007/BF02661805
29
QiaoJ.BorrissR.SunK.ZhangR.ChenX.LiuY.et al. (2024). Research advances in the identification of regulatory mechanisms of surfactin production by Bacillus: a review. Microb. Cell Fact.23, 100. doi: 10.1186/s12934-024-02372-7
30
QiaoN.ShaoZ. (2010). Isolation and characterization of a novel biosurfactant produced by hydrocarbon-degrading bacterium Alcanivorax dieselolei B-5. J. Appl. Microbiol.108, 1207–1216. doi: 10.1111/j.1365-2672.2009.04513.x
31
QuevillonE.SilventoinenV.PillaiS.HarteN.MulderN.ApweilerR.et al. (2005). InterProScan: protein domains identifier. Nucleic Acids Res.33, W116–W120. doi: 10.1093/nar/gki442
32
RashidM.SinghS. K.SinghC. (2021). “ Nuclear magnetic resonance spectroscopy: theory and applications,” in Modern Techniques of Spectroscopy. Eds. SinghD. K.PradhanM.MaternyA. ( Springer Singapore, Singapore), 469–512. doi: 10.1007/978-981-33-6084-6_18
33
SaikiaR. R.DekaH.GoswamiD.LahkarJ.BorahS. N.PatowaryK.et al. (2014). Achieving the best yield in glycolipid biosurfactant preparation by selecting the proper carbon/nitrogen ratio. J. Surfact Detergents17, 563–571. doi: 10.1007/s11743-013-1520-y
34
SakrE. A. E.AhmedH. A. E.Abo SaifF. A. A. (2021). Characterization of low-cost glycolipoprotein biosurfactant produced by Lactobacillus plantarum 60 FHE isolated from cheese samples using food wastes through response surface methodology and its potential as antimicrobial, antiviral, and anticancer activities. Int. J. Biol. Macromol.170, 94–106. doi: 10.1016/j.ijbiomac.2020.12.140
35
SaranrajP.ZayyedR. Z.SivasakthivelanP.DeviM. D.Al—TawahaA. R. M.SivasakthiS. (2022). “ Microbial biosurfactants sources, classification, properties and mechanism of interaction,” in Microbial Surfactants ( CRC Press, Boca Raton), 1–24. doi: 10.1201/9781003247739-1
36
SatputeS. K.MoneN. S.DasP.BanatI. M.BanpurkarA. G. (2019). Inhibition of pathogenic bacterial biofilms on PDMS based implants by L. acidophilus derived biosurfactant. BMC Microbiol.19, 39. doi: 10.1186/s12866-019-1412-z
37
SekhonK.KhannaS.CameotraS. (2011). Enhanced biosurfactant production through cloning of three genes and role of esterase in biosurfactant release. Microb. Cell Fact.10, 49. doi: 10.1186/1475-2859-10-49
38
SharmaN.AhlawatY. K.SharmaA. J.ChamoliN.ThakurM.SharmaA.et al. (2025). A comprehensive review on microbial production and significant applications of multifunctional biomolecules: biosurfactants. Biodegradation36, 26. doi: 10.1007/s10532-025-10121-9
39
SharmaD.SaharanB. S.ChauhanN.BansalA.ProchaS. (2014). Production and structural characterization of Lactobacillus helveticus derived biosurfactant. Sci. World J.2014, 1–9. doi: 10.1155/2014/493548
40
SittisartP.GasaluckP. (2022). Biosurfactant production by Lactobacillus plantarum MGL-8 from mango waste. J. Appl. Microbiol.132, 2883–2893. doi: 10.1111/jam.15452
41
SmythT. J. P.PerfumoA.McCleanS.MarchantR.Banat*I. M. (2010). “ Isolation and analysis of lipopeptides and high molecular weight biosurfactants,” in Handbook of Hydrocarbon and Lipid Microbiology. Ed. TimmisK. N. ( Springer Berlin Heidelberg, Berlin, Heidelberg), 3687–3704. doi: 10.1007/978-3-540-77587-4_290
42
SrivastavaR. K.BothraN.SinghR.SaiM. C.NedungadiS. V.SarangiP. K. (2022). Microbial originated surfactants with multiple applications: a comprehensive review. Arch. Microbiol.204, 452. doi: 10.1007/s00203-022-03086-3
43
StachelhausT.MootzH. D.MarahielM. A. (1999). The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chem. Biol.6, 493–505. doi: 10.1016/S1074-5521(99)80082-9
44
SuryantiV.MasykurA.SetyonoH. A.RamadaniS. (2021). Production and characterization of biosurfactant produced by Lactobacillus lactis grown in media containing crude palm oil (CPO). Biodiversitas22 (12), 5501–5506. doi: 10.13057/biodiv/d221234
45
TavaresJ.AlvesL.SilvaT. P.PaixãoS. M. (2021). Design and validation of an expeditious analytical method to quantify the emulsifying activity during biosurfactants/bioemulsifiers production. Colloids and Surfaces B: Biointerfaces208, 112111. doi: 10.1016/j.colsurfb.2021.112111
46
ThakurB.KaurS.TripathiM.UpadhyayS. K. (2024). Exploring the potential of lactic acid bacteria and its molecular mechanism of action in the development of biosurfactants: current finding and future outlook. Biotechnol. Genet. Eng. Rev.40, 4737–4768. doi: 10.1080/02648725.2023.2216421
47
ThompsonJ. D.HigginsD. G.GibsonT. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res.22, 4673–4680. doi: 10.1093/nar/22.22.4673
48
TiwaryM.DubeyA. K. (2018). Characterization of biosurfactant produced by a novel strain of Pseudomonas aeruginosa , isolate ADMT1. J. Surfact Detergents21, 113–125. doi: 10.1002/jsde.12021
49
YaraguppiD. A.BagewadiZ. K.MahantaN.SinghS. P.KhanT. M. Y.DeshpandeS. H.et al. (2022). Gene expression and characterization of iturin A lipopeptide biosurfactant from Bacillus aryabhattai for enhanced oil recovery. Gels8, 403. doi: 10.3390/gels8070403
50
YeJ.McGinnisS.MaddenT. L. (2006). BLAST: improvements for better sequence analysis. Nucleic Acids Res.34, W6–W9. doi: 10.1093/nar/gkl164
51
YiJ. S.ChoiJ. W.Le ThiN. H.KimS. J.KimH.-J.KimJ. M.et al. (2025). Transformation-associated recombination and heterologous expression of noncanonical depsipeptide nonribosomal peptide synthetase derived from marine Streptomyces. Mar. Life Sci. Technol.7, 937–948. doi: 10.1007/s42995-025-00296-8
52
ZargarA. N.MishraS.KumarM.SrivastavaP. (2022). Isolation and chemical characterization of the biosurfactant produced by Gordonia sp. IITR100. PloS One17, e0264202. doi: 10.1371/journal.pone.0264202
53
ZhangT.ZhouQ. (2022). Using large-scale multi-module NRPS to heterologously prepare highly efficient lipopeptide biosurfactants in recombinant Escherichia coli. Enzyme Microb. Technol.159, 110068. doi: 10.1016/j.enzmictec.2022.110068
54
ZhengJ.WittouckS.SalvettiE.FranzC. M. A. P.HarrisH. M. B.MattarelliP.et al. (2020). A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol.70, 2782–2858. doi: 10.1099/ijsem.0.004107
Summary
Keywords
adenylation domain, biosurfactant, glycolipopeptide, Lactobacillus, non-ribosomal peptide synthetase (NRPS), probiotics
Citation
Kumari M, Pandey K, Mehtab S and Singhal B (2026) In silico and experimental characterization of NRPS adenylation domain-mediated biosurfactant production in Lactobacillus helveticus MTCC 5463. Front. Bacteriol. 5:1895576. doi: 10.3389/fbrio.2026.1895576
Received
30 May 2026
Revised
21 July 2026
Accepted
27 July 2026
Published
04 September 2026
Volume
5 - 2026
Edited by
Kumaragurubaran Karthik, Tamil Nadu Veterinary and Animal Sciences University, India
Reviewed by
Liang Sun, Nanjing Tech University, China
Peterson Felipe Ferreira da Silva, Universidade Estadual de Campinas, Brazil
Updates
Copyright
© 2026 Kumari, Pandey, Mehtab and Singhal.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Barkha Singhal, gupta.barkha@gmail.com
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.