Zebrafish (Danio rerio) (TU strain) was obtained from the China Zebrafish Resource Center (Wuhan, China) and maintained on a 14 h light/10 h dark cycle at 28.5°C. All the animal study procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health. Animal study protocols were approved by the Institutional Animal Care and Use Committee of Hunan Normal University.

The vmhc KI fish line: vmhc^KI–EGFP was generated by co-injection of single guide RNA (sgRNA), Cas9 protein, and the vmhc-P2A-EGFP donor vector into one-cell stage embryos.

The sgRNA targeted to the C-terminal of vmhc gene including the stop codon (GAUCAAGAGUAAGCUCAAGUGG) was in vitro transcribed using the MAXIscript™ T7 Transcription Kit (Invitrogen) according to the manufacturer’s instructions, followed by purification using the RNeasy Mini kit (Qiagen). Cas9 protein was purchased from TrueCut™ Cas9 Protein v2 (Invitrogen). In total, 40 ng sgRNA and 0.5 ng Cas9 protein complex were assembled by incubation for 10 min at 37°C and then was injected into one-cell stage embryos. Knockout efficiency of the sgRNA was determined by PCR and DNA gel analysis using genomic DNA isolated from injected embryos at 48 h postfertilization (hpf).

The vmhc-P2A-EGFP donor vector was constructed by cloning of the vmhc left and right homologous arm fragments into the pMCS1-P2A-EGFP-MCS2 vector. Briefly, a 2,218 bp left homologous arm fragment of the vmhc gene was PCR amplified with genomic DNA isolated from zebrafish tail fin using primers: left-F: (GGTCGACCACTCCCAGGTATGCTAAATGTTT) and left-R: (GGGATCCGACTCTTGATCATGTCCCTTCTGTA). The resultant PCR fragments were digested with Sal I and BamH I and cloned to the MCS1 site of the pMCS1-P2A-EGFP-MCS2 vector to generate pvmhc-left-P2A-EGFP-MCS2. Subsequently, to generate the final recombinant donor vector: vmhc-P2A-EGFP, a 1,926 bp right homologous arm fragment of the vmhc gene was PCR amplified using primers right-F: (GGCGGCCGCTGTGTCTCCGTTATGCTGAATT) and right-R: (GCTCGAGTTTGGCCGTTATAGTCCAGAAAC) and subcloned into the MCS2 sites of pvmhc-left-P2A-EGFP-MCS2 after digestion of Not I and Xho I. Correct clones of both the vmhc left and right homologous arms were further confirmed by Sanger sequencing.

Next, ∼1 nl solution containing 40 ng sgRNA, 400 ng donor recombinant vector, and 0.5 ng Cas9 protein was co-injected into one-cell stage embryos. Injected embryos with EGFP positive signals were raised to adulthood. Injected adult F0 fish were outcrossed with wide-type, and stable knock-in F1 fish with germline transmission were identified by positive EGFP signal and subsequent PCR validation using primers F1: TCTGTCTCATACTTCAGCCTCC, R1: GTCGTCCTTGAAGAAGATGGTG; F2: CCACAACGTCT ATATCATGGCC, R2: ATACACTCCATACATACACGCG, and Sanger sequencing.

Total protein was homogenized and extracted from 3 pooled embryos at 3 dpf using radioimmunoprecipitation assay (RIPA) solution (Beyotime Biotechnology, Shanghai, China) and was subjected to standard western blotting analysis. Briefly, extracted total protein was separated in 6% polyacrylamide gels, transferred onto nitrocellulose membrane, and subsequently incubated with primary and secondary antibodies. The primary antibody for anti-vmhc was obtained from proteintech (1:1,000, 22280-1-AP), and anti-tubulin was purchased from Affinity Biosciences (1:2,000, T0034). The secondary antibody was purchased from Affinity Biosciences (S0002). Quantification of relative protein expression was performed using Image J and student t-test was used to calculate the P-value.

One-cell stage vmhc^KI–EGFP embryos were incubated in the presence or absence of CPAAHTs (Gankang pharmaceutical, Wuhan, China) dissolved in E3 water (5 mM NaCl, 1 mM MgSO₄, 1 mM KCl, and 1 mM CaCl₂) at designated concentrations for 48 h. Cardiac morphology of both drug-treated and untreated control embryos were monitored under a fluorescence microscope (Leica, Berlin, Germany). To compare the EGFP signal intensity among different experimental groups, we used the same exposure time when the fluorescent images were captured. In total, 5–10 embryos were randomly chosen from each group for images capture. All the experiments were performed in triplicate.

Embryos with or without CPAAHTs treatment were randomly picked up and subjected to whole-mount in-situ hybridization (WISH) accordingly (17). Digoxigenin-labeled anti-sense RNA probes were generated from PCR products using T7 RNA polymerase or T3 RNA polymerase from the DIG-RNA labeling mix (Roche) according to the manufacturer’s instruction. The PCR primer sequences used for RNA probes synthesis are listed here: nkx2.5-ISH-F: CTTCCACTCCTTTCTCAGTGC, nkx2.5-ISH-R: TGCATGAGTAGTTCGAGTTGC; tbx20-ISH-F: GGCACTGAAATGATTATCACAAAG,

tbx20-ISH-R: CTTCTCCCAGAGTCTCTTCATCTC; mef2ca- ISH-F: GATCGCCCTCATCATCTTCAAC, mef2ca-ISH-R: ATG AGGTATTGATGGCAGACGG; gata4-ISH-F: CGAGTCCGG TTTCCTCCATA, gata4-ISH-R: TCGTGTCTGAATGCCCTCT T; spaw-ISH-F: CTGGGCAGCGTTAAATCAGTAG, spaw-ISH -R: CTCATCACCACTCCATCTCCTT; lft2-ISH-F: GATAAAC CACGCCAGAGTCAG, lft2-ISH-R: CGGAAGTTGATGAAA TGCTCCT; pitx2-ISH-F: CGCATTTTACTAGCCAGCAGT, pi tx2-ISH-R: ACTGGCAAGACTGGAGTTACA; lft1-ISH-F: ATGACTTCAGTCCGCGCCGCG, lft1-ISH-R: TTATACAACT GAAATATTGTC.

In total, three pooled embryos with or without CPAAHTs treatment were randomly picked up for total RNA extraction using Trizol (Thermo Fisher Scientific, Waltham, MA, United States). About 1 μg total RNA was used for reverse transcription and cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s instruction. Real-time quantitative PCR was run using the Computer Forensic Examiner (CFX) Connect Real-Time System (BIO-RAD, Hercules, CA, United States) in a total volume of 10 μl reaction solution containing 1 × SYBR Green Master Mix (Yeasen Biotechnology, Shanghai, China), 0.2 μM gene-specific primer pairs, and 1 μl cDNA template. A three-step PCR with a 60°C annealing temperature was used for all primers. Gene expression levels were normalized using the expression level of ββ-actin by –ΔΔCt (cycle threshold) values. All gene-specific primer sequences are listed here: gata4-F: GCCTATGTGAGCCCTAATATC, gata4-R: CCTCGCCCAGA TCATCAAA; mef2ca-F: AAAGTTCTGCTGAAATACACCGAG, mef2ca-R: CGTAGTTAGACTGAGGGATGGC; tbx20-F: GCA CTCATGTCAAGTGGGAA, tbx20-R: CGAGGTTTGGATGG CATGA; spaw-F: CACGCTGAACCGACCAGCAG, spaw-R: CAAAGTGAAGCTTGCTGTTCC; pitx2-F: TATCCGGACAT GTCGACTAGA, pitx2-R: CCTGTTGATTCCTCTCCCTTT; lf t1-F: CCTCAGAAAGACGGGTCAAA, lft1-R: CGCCTGGGT GACATCAAA; lft2-F: GCAAGTATCTGTCCATGCTGA, lft2-R: GTGGTGTCCGAGTACTTGATTT; nkx2.5-F: CTTCAGTGC TTCAGGCTTTTACGCG, nkx2.5-R: GCTCCGCATCATCCA GCTTCAGATC; β-actin-F: CGTGACATCAAGGAGAAG, β-actin-R: GAGTTGAAGGTGGTCTCAT.

Unpaired two-tailed Student’s t-tests were used for comparisons of two groups. The chi-squared test was used to determine the effects of different concentrations of CPAAHTs on cardiac looping during cardiogenesis. P-values of less than 0.05 were considered as statistically significant. All the statistical analyses were carried out using GraphPad Prism version 7.0 software.

To generate an EGFP KI fish in the vmhc gene, we first designed and synthesized a single guide RNA (sgRNA) target surrounding the stop codon region of the vmhc gene and assessed its cleavage efficiency of double-stand breaks (DSBs) induced by the CRISPR/cas9 system (Figure 1A). After optimized concentration of sgRNA and Cas9 protein, we obtained an 80% cleavage efficiency of DSBs in most of the injected embryos (data not shown). Next, we constructed the vmhc-P2A-EGFP donor vector that harbors a left homologous arm of ∼2.2 kb DNA spanning the last exon (exon 37) and exon 32 of the vmhc gene, P2A-EGFP, and a right homologous arm of ∼1.9 kb DNA of the vmhc 3-UTR sequences downstream of the guide RNA target site (Figure 1A). Notably, the P2A nucleotides encode a short peptide that can cleave two neighboring proteins, enabling induction of polygenes co-expression.

After the correct construction of the recombinant vmhc-P2A-EGFP donor vector was confirmed by PCR and Sanger sequencing (data not shown), we then co-injected it with the sgRNA/Cas9 complex into one-cell stage embryos. Embryos with a low-mosaic EGFP signal detected in the heart ventricle were raised up and termed as candidate vmhc^KI–EGFP F0 founders. After they reached adulthood, we outcrossed these candidate’s vmhc^KI–EGFP F0 founders to identify stable F1 mutants. Out of 8 F0 founder fish screened, we successfully identified one with stable EGFP signal detected in the F1 offsprings, and the P2A-EGFP sequences knocked in the vmhc C-terminal locus was confirmed by PCR and Sanger sequencing (Figure 1B). The EGFP signal was mostly noted in the lateral plate mesoderm, cardiac tube, and ventricle (Figure 2A), which was very similar to the endogenous expression patterns of the vmhc gene at corresponding stages detected by WISH (Figure 2B). To determine whether the P2A-EGFP element knocked in the vmhc C-terminus would interfere expression of the endogenous vmhc protein, we performed Western blotting analysis and detected no difference in terms of the vmhc protein expression level between the vmhc^KI–EGFP KI fish and wide-type (WT) controls (Figure 2C), suggesting the P2A-EGFP KI event did not interfere expression of the endogenous vmhc protein. Taken together, these results demonstrated that we successfully generated a novel EGFP KI fish line in which the EGFP could faithfully report the spatial and temporal expression of the endogenous vmhc gene.

After we successfully generated the vmhc^KI–EGFP KI fish line, we sought to employ it to study the potential toxic effects of CPAAHTs during early cardiogenesis in vivo. We found that exposure to CPAAHTs induced heart malformation in a dose-dependent manner. As shown in Figure 3A, all untreated vmhc^KI–EGFP control embryos exhibited exclusively D-loop patterning at 48 hpf. In contrast, embryos treated with 0.2 μg/μl of CPAAHTs started to show L-loop patterning in a small percentage (Figures 3A,B). As the doses were increased to 0.6 or 0.8 μg/μl, respectively, the percentage of embryos with L-loop and no-loop increased significantly, concurrent with apparent cardiac malformation phenotypes. In addition to the abnormal cardiac-looping defects, we also detected ectopic EGFP signal in the atrium of CPAAHTs treated embryos (Figure 3A), suggesting intrinsic factors that defined the ventricle-specified expression of vmhc gene were altered. Together, these results showed that CPAAHTs could cause cardiac-looping or LR asymmetry defects during early cardiogenesis.

To investigate molecular mechanisms underlying the CPAAHTs-induced ectopic expression of vmhc gene in the atrium, we first analyzed expression patterns of several key transcription factors including nkx2.5, gata4, mef2ca, and tbx20 that define the myocardial precursor cell differentiation during early cardiac development. Our WISH results showed that, in untreated control embryos, these 4 genes were mostly expressed as bilateral stripes in the heart-forming region at 8-somite stage (Figure 4A). In contrast, CPAAHTs-treated embryos showed a dramatic reduction in expression of all 4 genes. Furthermore, we performed quantitative RT-PCR analysis and confirmed significant transcriptional reduction for gata4, mef2ca, and tbx20 genes, with marginally decreased expression of nkx2.5 detected as well (Figure 4B). Thus, it is plausible to speculate that CPAAHTs might cause cardiac developmental defects by disturbing the differentiation of myocardial precursor cells. Given that embryos exposed to CPAAHTs exhibited obvious cardiac-looping or LR asymmetry defects, we hypothesized that CPAAHTs might disrupt early cardiac development through inhibiting gene expression of key genes specifying cardiac LR asymmetry. We particularly examined the expression of spaw, a key factor of the Nodal signaling pathway that plays a critical role in LR patterning, and its downstream target genes including pitx2, lft1, and lft2. The WISH results demonstrated that near-complete loss of the spaw expression was observed in the CPAAHTs-treated embryos, in contrast to its robust expression in the untreated control embryos (Figure 4C). Consistently, the expression levels of other spaw downstream genes such as pitx2, lft1, and lft2 were also reduced drastically. Similarly, quantitative RT-PCR was carried out and confirmed the significantly decreased expression of these 4 genes in the CPAAHTs-treated embryos as well (Figure 4D). Together, these results supported our hypothesis that CPAAHTs exposure caused LR asymmetry defects at least partially through suppressing the expression of key factors of the Nodal signaling pathway.