Abstract
Background:
Aortic dissection (AD) is a life-threatening cardiovascular disease. ARHGAP27 can regulate cytoskeleton and cellular functions, which may be related to the phenotypic switching of vascular smooth muscle cells (VSMCs) in AD. However, the role of ARHGAP27 in AD has not been reported yet.
Methods:
The AD-related data sets were downloaded from GEO database to screen differential genes. HE and IHC staining was used to detect the pathological changes and the expression level of ARHGAP27 in AD tissue. AD cell models were constructed in vitro by inducing HAVSMCs with PDGF-BB to evaluate the effects of ARHGAP27 overexpression or knockdown on cell survival, migration, invasion and phenotypic switching. Rescue experiments were performed using the ROCK activator LPA to test pathway specificity.
Results:
ARHGAP27 was significantly upregulated in the dataset and the tissue. In vitro experiments have shown that overexpression of ARHGAP27 can further promote the survival, migration and invasion of VSMCs, and the expression of synthetic phenotypic proteins MMP2 and MMP9, and inhibit the expression of contraction phenotypes α-SMA and SM22α. Knockdown of ARHGAP27-2 can obtain the opposite result. In terms of mechanism, PDGF-BB down-regulates the expression levels of RhoA, ROCK1/2, and up-regulates the phosphorylation levels of YAP in VSMCs. Overexpression of ARHGAP27 further enhances the effect of PDGF-BB, while knockdown of ARHGAP27-1 and ARHGAP27-2 inhibits the effect of PDGF-BB. Treatment with LPA would reverse the effects produced by ARHGAP27 overexpression.
Conclusion:
ARHGAP27 is upregulated in AD and accelerates its pathological progression by regulating the RhoA/ROCK/YAP pathway.
1 Introduction
Aortic dissection (AD) is an acute and potentially life-threatening condition characterized by a tear in the intimal layer of the aorta, allowing blood to enter the medial layer and create a false lumen, which may lead to aortic rupture (). However, its clinical presentation symptoms may not be obvious or overlap with other conditions and not be specific, thus increasing the difficulty of diagnosis (). As a result, AD is frequently underdiagnosed (). Because symptoms are usually atypical, mild, or even absent, the clinical suspicion level for AD is often low. Although CT angiography can reliably detect AD, it is frequently postponed when symptoms are unclear, delaying timely imaging (, ). Meanwhile, although current European guidelines recommend preventive surgery when the aortic diameter reaches 5.5 centimeters, many AD cases still occur within smaller diameters (). These limitations highlight the significance of conducting further in-depth research on the potential pathophysiological mechanisms of AD, with the aim of improving the risk prediction models for AD and enhancing the strategies for early diagnosis and treatment.
ARHGAP27 is a member of the Rho GTPase-activating protein (ARHGAPs) family and functions as a negative regulator of Rho GTPases by accelerating the hydrolysis of bound guanosine triphosphate (GTP) to guanosine diphosphate (GDP). Through this regulatory role, ARHGAP27 participates in key cellular processes such as cytoskeletal remodeling, cell migration, contraction, and differentiation (). Differential expression of ARHGAP27 has been reported in specific tissues and diseases, including spleen, intervertebral disc, chronic lymphocytic leukemia, autism spectrum disorder, pancreatic cancer, and lung cancer, etc (–). Given the important role of ARHGAP27 in processes such as cytoskeletal remodeling and cell migration, it is likely involved in the dysfunction of VSMCs and aortic wall remodeling during the pathological process of AD. However, no study has yet investigated the potential role of ARHGAP27 in AD.
Vascular smooth muscle cells (VSMCs) constitute the primary cellular component of the aortic media and are essential for maintaining vascular wall integrity and function (). The phenotypic switching of VSMCs from the contractile phenotype (differentiated state) to the synthetic phenotype (dedifferentiated state) has been recognized as a key factor in the progression of AD. This process is typically characterized by changes in cell morphology, enhanced cell survival, migration, and invasion capabilities, as well as alterations in the secretion levels of related protein markers (, ).
The RhoA/ROCK/YAP pathway is critical in cardiovascular diseases (, ). RhoA (Ras homolog family member A) cycles between active GTP-bound and inactive GDP-bound states; its effectors ROCK (Rho-associated coiled-coil containing protein kinase, include two isoforms: ROCK1 and ROCK2) regulate cytoskeletal dynamics and YAP (Yes-associated protein) phosphorylation, influencing cell survival and migration (, ). And previous studies reported downregulation of the RhoA/ROCK1/YAP axis in AD ().
This study aims to validate the differential expression of ARHGAP27—identified through bioinformatics analysis—as a candidate gene associated with AD, at both clinical and in vitro VSMC levels. Furthermore, we also attempted to initially explore the molecular pathways by which ARHGAP27 influences the progression of AD, which would help us gain a deeper understanding of its pathogenesis.
2 Materials and methods
2.1 Materials and reagents
2.1.1 Tissue collection
Normal tissue samples (n = 3) were obtained from healthy donors who had died accidentally without heart and aortic diseases, while AD tissue samples (n = 5) were collected during the surgical procedures of AD patients. None of the patients had received preoperative adjuvant therapy. This study was approved by the Ethics Committee of Xinjiang Uygur Autonomous Region People's Hospital (Approval No. KY2023042008). All participants provided written informed consent.
2.1.2 Cells
Human aortic vascular smooth muscle cells (HAVSMCs) were purchased from the American Type Culture Collection (ATCC, catalog number: ATCC-CRL-1999).
2.1.3 Reagents
Primary antibodies, ARHGAP27, α-SMA, SM22α, MMP2, MMP9, RhoA, ROCK1, ROCK2, YAP, p-YAP and GAPDH monoclonal antibodies, as well as second antibody, HRP-conjugated goat anti-rabbit IgG, Alexa Fluor 488- and Alexa Fluor 594-conjugated goat anti-rabbit IgG, were obtained from Abcam (Cambridge, UK). Batch numbers: ab171973, ab7817, ab10135, ab92536, ab76003, ab187027, ab134181, ab125025, ab205270, ab76252, and ab181602, as well as ab6721, ab150113, and ab150084, respectively. HRP-labeled goat anti-rabbit IgG antibody was purchased from Lianke Biotechnology Co., Ltd. (Hangzhou, China), batch number: GAR007. ARHGAP27 interference and overexpression plasmids were obtained from Ruibo Biotechnology Co., Ltd. (Guangzhou, China). Cell transfection primer sequence was listed in Table 1. Transwell chambers were purchased from Corning (Costar), batch number: 3422. The CCK-8 kit was obtained from Dojindo Laboratories (Kumamoto, Japan), batch number: CK04. RIPA lysis buffer, BCA protein assay kit, apoptosis detection kit, hematoxylin-eosin staining (H&E) kit, and Active Rho Pull-down and Detection Kit were purchased from Beyotime Biotechnology (Shanghai, China), with batch numbers P0013B, P009, C0003, C0105S, and P2065S, respectively. Lysophosphatidic acid (LPA) was purchased from Avanti Polar Lipids Inc. (Alabaster, USA), with batch number A85328. Platelet-derived growth factor-BB (PDGF-BB) was purchased from MedChem Express (Monmouth Junction, USA), with batch number HY-P73351.
Table 1
| primer | The sequence is 5′→3′ |
|---|---|
| oe-ARHGAP27 Forward | GGACTCAGATCTCGAGGCCACCATGCAGCCGGGCCTGAGC |
| oe-ARHGAP27 Reverse | TAGAGTCGCGGGATCCTCAGTGCGGCGGGAAGATG |
| sh-ARHGAP27-1 Forward | GATCCCGGGAAGCCATACTTCTACAACTCGAG TTGTAGAAGTATGGCTTCCCG TTTTTT |
| sh-ARHGAP27-1 Reverse | CTAGAAAAAACGGGAAGCCATACTTCTACAACTCGAG TTGTAGAAGTATGGCTTCCCG G |
| sh-ARHGAP27-2 Forward | GATCCCCATCCAGAAGCTACGCTATACTCGAG TATAGCGTAGCTTCTGGATGG TTTTTT |
| sh-ARHGAP27-1 Reverse | CTAGAAAAAACCATCCAGAAGCTACGCTATACTCGAG TATAGCGTAGCTTCTGGATGG G |
Primer sequences.
2.2 Methods
Bioinformatics analysis of GEO datasets (GSE147026, GSE235995, GSE183997) identified differentially expressed genes, which were validated using GSE190635. HE staining and Immunohistochemistry (IHC) staining were performed on human aortic tissues (normal, n = 3; AD, n = 5) to assess morphological changes and ARHGAP27 expression.
HAVSMCs were stimulated with 20 ng/mL PDGF-BB to establish an AD cell model. ARHGAP27 overexpression and knockdown were achieved by plasmid transfection. The survival, migration and invasion abilities of the cells were detected by CCK-8, scratch and Transwell assays to explore the effect of ARHGAP27 on the function of VSMCs. Expression of contractile markers (α-SMA, SM22α), synthetic markers (MMP2, MMP9), and RhoA/ROCK/YAP pathway proteins (ARHGAP27, RhoA, ROCK1, ROCK2, YAP, p-YAP) was analyzed by Western blot. Additionally, a rescue experiment using the ROCK activator LPA (10 μmol/L) was performed to confirm pathway specificity (see Supplementary Results).
Detailed experimental procedures are provided in the Supplementary Material.
2.3 Statistical analysis
All experimental data were analyzed using GraphPad Prism version 8.0. Data were expressed as mean ± standard deviation. Comparisons between two groups (e.g., Control vs. PDGF-BB, sh-NC vs. Sh-ARHGAP27-2) were performed using Student's t-test, while one-way ANOVA followed by Tukey's post hoc test was used for comparisons among multiple groups (e.g., Control, PDGF-BB, PDGF-BB + oe-ARHGAP27). The “Control” group refers to HAVSMCs cultured without PDGF-BB or transfection. A p-value < 0.05 was considered statistically significant.
3 Results
3.1 ARHGAP27 was significantly upregulated in AD chips and tissue samples
Based on the GEO datasets GSE147026, GSE235995, and GSE183997 (using thresholds of |logFC| > 1, P < 0.05), a total of 3,110, 3,112, and 735 differentially expressed genes were identified, respectively (Figure 1A).
Figure 1
The intersection of these gene sets was then analyzed. A total of 19 significantly upregulated co-expressed genes (ITGAX, PLAUR, ARHGAP22, COTL1, PIK3AP1, PODNL1, CTSL, UHRF1, PNP, HMGA1, CLEC5A, MIF, THBS2, TGM2, ARHGAP27, IFITM10, NRIP3, SLC29A3, CLDN7) and four significantly downregulated genes (ACADL, TIMP3, PDE4D, FAM107A) (Figure 1B). Further validated using the GSE190635 dataset, which revealed 1,176 differentially regulated genes (Figure 1C). Notably, ARHGAP27 was consistently upregulated across all four datasets—GSE147026, GSE235995, GSE183997, and GSE190635—with statistically significant P-values (Figure 1D, all P < 0.05). Therefore, ARHGAP27 is hypothesized to potentially function as a key molecular player in the progression of AD.
Based on the results of bioinformatics analysis, we conducted histological evaluations on both normal aortic tissue samples and AD tissue samples obtained clinically. The HE staining results revealed that normal aortic tissues exhibited an intact and continuous lumen, well-organized elastic fibers, and VSMCs with regular morphology and orderly arrangement. In contrast, the AD group displayed structural disruptions, including cavities within the elastic fibers and disorganized cellular architecture (Figure 1E). Subsequently, immunohistochemical (IHC) staining was performed to assess the expression levels of ARHGAP27 in the tissue samples. The results demonstrated a significantly higher expression of ARHGAP27 in AD tissues compared to normal aortic tissues (Figure 1F, P < 0.01). To further determine the cellular localization of ARHGAP27 in aortic tissues, immunofluorescence double staining was performed using antibodies against ARHGAP27 and the VSMCs marker α-SMA. In normal aortic tissues, ARHGAP27 expression was weak and showed limited overlap with α-SMA-positive cells. In contrast, AD tissues exhibited markedly increased ARHGAP27 fluorescence signals that predominantly co-localized with α-SMA-positive cells, indicating that ARHGAP27 is highly expressed in VSMCs during AD progression (Figure 1G).
3.2 The effect of ARHGAP27 overexpression on the function of VSMCs and the rhoA/ROCK/YAP pathway
The effect of ARHGAP27 on AD was further verified through in vitro cell experiments. Firstly, HAVSMCs cells were stimulated with PDGF-BB to construct the AD cell model, and the cell morphology was observed under a microscope. The control group had a normal morphology and was spindle-shaped, while the cells in the model group gradually became polygonal, indicating the successful construction of the model (Figure 2A). Furthermore, PDGF-BB induction significantly upregulated the expression level of ARHGAP27 in the cells (Figure 2B, P < 0.01). Subsequently, ARHGAP27 overexpression was achieved via plasmid transfection. The results of the CCK-8 assay, scratch assay and Transwell assay indicated that compared with the Control group, cell survival, migration and invasion increased after induction by PDGF-BB, while overexpression of ARHGAP27 could further promote cell survival, migration and invasion (Figures 2C–E, all P < 0.05). The results of Western blot indicated that, compared with the Control group, PDGF-BB would reduce the expression of proteins α-SMA and SM22α related to the contractile phenotype in cells and upregulate the expression of proteins MMP2 and MMP9 related to the synthetic phenotype. Overexpression of ARHGAP27 would further promote the effect of PDGF-BB (Figure 2F, all P < 0.01).
Figure 2
To investigate whether ARHGAP27 affect AD via the RhoA/ROCK/YAP signaling pathway, this study examined the expression levels of key proteins in this pathway following overexpression of ARHGAP27. The results demonstrated that, compared with the control group, PDGF-BB treatment significantly downregulated the expression of RhoA, ROCK1, and ROCK2, while increasing the phosphorylation level of YAP. Overexpression of ARHGAP27 markedly enhanced these effects induced by PDGF-BB (Figure 2G, all P < 0.01).
To further explore the causal relationship between ARHGAP27 and the RhoA/ROCK/YAP pathway, we treated ARHGAP27-overexpressing VSMCs with the ROCK activator LPA. LPA treatment significantly reversed the enhanced survival, migration, and invasion abilities of VSMCs caused by ARHGAP27 overexpression (Supplementary Figures S1A–C), while restoring the expression of contraction phenotype markers α-SMA and SM22α, and inhibiting the expression of synthetic phenotype markers MMP2 and MMP9 (Supplementary Figure S1D). The pathway detection results showed that LPA effectively restored the protein expression levels of ROCK1/2, and reduced the p-YAP/YAP ratio (Supplementary Figure S1E). The GTP pull-down results showed that ARHGAP27 overexpression significantly reduced RhoA-GTP levels, and LPA treatment reversed this effect (Supplementary Figures S1F). This indicates that when the RhoA/ROCK/YAP pathway is artificially activated, the pro-AD effects produced by ARHGAP27 overexpression are significantly weakened. This further proves that the pro-AD effect of ARHGAP27 depends on the inhibition of this pathway.
3.3 The effect of ARHGAP27 knockdown on the functions of VSMCs and the RhoA/ROCK/YAP pathway
ARHGAP27 expression was suppressed using cell transfection techniques. Due to alternative splicing of the promoter region, ARHGAP27 has two isoforms: ARHGAP27-1 and ARHGAP27-2 (). Therefore, knockdown experiments were conducted separately on ARHGAP27-1 and ARHGAP27-2. The transfection efficiency is presented in Figure 3A. Compared with ARHGAP27-1, the knockdown effect of ARHGAP27-2 was more effective (Figure 3A). Results from the CCK-8 assay, scratch assay, and Transwell assay demonstrated that, in comparison to the sh-NC group, silencing ARHGAP27-2 significantly inhibited cell survival, migration, and invasion (Figures 3B–D, all P < 0.05), whereas knockdown of ARHGAP27-1 did not yield statistically significant differences (Figures 3B–D, all P > 0.05). Western blot analysis revealed that, compared to the sh-NC group, suppression of ARHGAP27-2 led to increased expression of contractile phenotype-related proteins α-SMA and SM22α, while decreasing the expression of synthetic phenotype-related proteins MMP2 and MMP9 (Figure 3E, both P < 0.01). In contrast, no significant changes were observed following knockdown of ARHGAP27-1 (Figure 3E, P > 0.05). Silencing either ARHGAP27-1 or ARHGAP27-2 attenuated the regulatory effects of PDGF-BB on the expression of RhoA, ROCK1, ROCK2, and on YAP phosphorylation (Figure 3F, all P < 0.05).
Figure 3
4 Discussion
In this study, ARHGAP27 was identified as a significantly upregulated gene in AD across four GEO datasets and validated in human AD tissues by IHC staining. Functional experiments demonstrated that overexpression of ARHGAP27 promotes the survival, migration, invasion of VSMCs, and the phenotypic switching from the contractile to the synthetic phenotype, while knockdown results in the opposite effect. Mechanistically, ARHGAP27 negatively regulates the RhoA/ROCK/YAP axis, which is supported by the decreased expression of RhoA, ROCK1/2 and increased phosphorylation of YAP when ARHGAP27 is overexpressed. Importantly, the rescue experiments using the ROCK activator LPA reversed all the phenotypic and molecular changes caused by ARHGAP27 overexpression. This provides reverse evidence that ARHGAP27 affects the function and phenotypic switching of VSMCs in AD by negatively regulating RhoA/ROCK/YAP.
ARHGAP27 belongs to the RhoGAP family, and several members of this family have been shown to be related to vascular diseases. For example, ARHGAP18 can prevent atherosclerosis by regulating the alignment of vascular endothelial cells (EC) in the direction of flow, and maintain vascular homeostasis through Rho-mediated microtubule regulation of the endothelial cell barrier function (, ). ARHGAP24 can regulate the proliferation and dedifferentiation of VSMCs, and is related to neointimal hyperplasia diseases such as restenosis and atherosclerosis (). However, the role of ARHGAP27 in AD has not been reported yet. Our findings extend the current understanding of RhoGAP proteins to the pathogenesis of AD, providing a new potential direction to address the current issue of inadequate diagnostic approaches for AD. Additionally, recent discoveries have also indicated that the RhoA/ROCK/YAP pathway is inhibited in AD (). Our research further discovered that ARHGAP27 might be a new and important upstream negative regulator of this pathway in AD.
The significant upregulation of ARHGAP27 in AD suggests that it may serve as a new biomarker or therapeutic target. However, this study still has some limitations. Firstly, the clinical sample size was small (n = 5 AD, n = 3 normal), but the expression difference of ARHGAP27 reached statistical significance and was consistent with four independent GEO datasets. Secondly, our AD cell model (VSMCs stimulated by PDGF-BB) cannot fully simulate the complex mechanical forces of the aortic wall. Thirdly, we did not conduct animal studies; the causal relationship and in vivo correlation need to be verified by a vascular smooth muscle cell-specific ARHGAP27 knockout mouse model. These limitations are common in exploratory studies. Future research will expand the sample cohort and conduct more in-depth validation in AD mouse models by specifically deleting ARHGAP27 in VSMCs. At the same time, conducting chromatin immunoprecipitation sequencing (ChIP-seq) or other more in-depth mechanism studies will help us gain a deeper understanding of the specific molecular mechanisms by which ARHGAP27 regulates the RhoA/ROCK/YAP pathway. Studying the impact of ARHGAP27 on the microfibrillar tissue in AD and its potential role in extracellular matrix remodeling will also be very meaningful. Additionally, single-cell RNA sequencing of human AD tissues may reveal the cell source of ARHGAP27, and the mechanical stretching system may better simulate the AD microenvironment.
In summary, this study first demonstrated that ARHGAP27 is upregulated in AD and affects the function and phenotypic switching of VSMCs by negatively regulating the RhoA/ROCK/YAP pathway. The rescue experiments provided more powerful evidence for this regulatory relationship. Although further in vivo validation is needed in the future, our current findings provide a new approach for exploring the pathogenesis of AD and potential therapeutic targets.
5 Conclusion
In conclusion, ARHGAP27 is upregulated in AD and correlates with enhanced VSMCs survival, migration, invasion, and phenotypic switching in PDGF-BB-induced cellular models. The signaling pathway experiments and rescue experiments indicate that ARHGAP27 negatively regulates the RhoA/ROCK/YAP axis. While this study provides preliminary clinical and in vitro insights, further in vivo investigations are required to establish causality and clinical relevance.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.
Ethics statement
The studies involving humans were approved by Xinjiang Uygur Autonomous Region People's Hospital (Approval No. KY2023042008). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study. The manuscript presents research on animals that do not require ethical approval for their study.
Author contributions
ZW: Validation, Methodology, Writing – original draft, Data curation, Investigation, Visualization, Software, Formal analysis. JT: Resources, Investigation, Software, Funding acquisition, Validation, Methodology, Data curation, Writing – review & editing. YY: Project administration, Writing – review & editing, Funding acquisition, Supervision, Conceptualization.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This study was supported in part by grants from the National Natural Science Foundation of China (82570503), the Xinjiang Uygur Autonomous Region Tianshan Talent Training Program (2023TSYCCX0048) and the Key R & D Program of the Xinjiang Uygur Autonomous Region (2024B03032, 2024B03032-2).
Acknowledgments
We would like to thank Professor Yining Yang for his guidance and support throughout this research. We are also grateful to the College of Life Science and Technology, Xinjiang University, the People's Hospital of Xinjiang Uygur Autonomous Region, and the Xinjiang Key Laboratory of Cardiovascular Homeostasis and Regenerative Medicine Research for providing the research platform and resources.
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcvm.2026.1831795/full#supplementary-material
References
1.
OwensG. Think aorta: aortic dissection awareness and perspectives from the patient. Nat Rev Cardiol. (2025) 22(8):527–8. 10.1038/s41569-025-01177-4
2.
ZhouYChenH. Diagnostic dilemmas in acute type A aortic dissection with acute myocardial infarction: a fatal misdiagnosis case and improvement strategies. Medicine (Baltimore). (2025) 104(46):e45809. 10.1097/md.0000000000045809
3.
WangSYangLHuTDengHTuWWuYet al. Related factors affecting misdiagnosis of aortic dissection: a single-center retrospective study. Front Cardiovasc Med. (2025) 12:1561225. 10.3389/fcvm.2025.1561225
4.
ReedMJ. Diagnosis and management of acute aortic dissection in the emergency department. Br J Hosp Med. (2024) 85(4):1–9. 10.12968/hmed.2023.0366
5.
ShimamotoTTomotsukaSTakeharaMTsumaruS. Three cases of diagnostic delay of type A acute aortic dissection. Egypt Heart J. (2024) 76(1):10. 10.1186/s43044-024-00444-y
6.
JondeauGCarboneABravermanACDi EusanioMKorachAChenEPet al. Aortic diameters at time of type A acute aortic dissection in genetically triggered versus non genetic aortopathies. Eur Heart J. (2025) 46(Supplement_1):ehaf784.2989. 10.1093/eurheartj/ehaf784.2989
7.
AminEJaiswalMDerewendaUReisKNouriKKoessmeierKTet al. Deciphering the molecular and functional basis of RHOGAP family proteins: a systematic approach toward selective inactivation of RHO family proteins. J Biol Chem. (2016) 291(39):20353–71. 10.1074/jbc.M116.736967
8.
YurikoKMasaruK. Identification and characterization of ARHGAP27 gene in silico. Int J Mol Med. (2004) 14(5):943–7. 10.3892/ijmm.14.5.943
9.
LiJYuCNiSDuanY. Identification of core genes and screening of potential targets in intervertebral disc degeneration using integrated bioinformatics analysis. Front Genet. (2022) 13:864100. 10.3389/fgene.2022.864100
10.
GaoTDangWJiangZJiangY. Identifying the impact of ARHGAP and MAP gene families on autism spectrum disorders. PLoS One. (2024) 19(11):e0306759. 10.1371/journal.Pone.0306759
11.
LiZMLiuGLiuQQYouWMZhaoMG. Targeting enabled homolog with daunorubicin inhibits ERK1/2/c-Fos pathway and suppresses hepatocellular carcinoma progression. Clin Transl Med. (2025) 15(6):e70366. 10.1002/ctm2.70366
12.
ZhouCLinZCaoHChenYLiJZhuangXet al. Anxa1 in smooth muscle cells protects against acute aortic dissection. Cardiovasc Res. (2022) 118(6):1564–82. 10.1093/cvr/cvab109
13.
ZhangXCheYMaoLLiDDengJGuoYet al. H3.3B controls aortic dissection progression by regulating vascular smooth muscle cells phenotypic transition and vascular inflammation. Genomics. (2023) 115(5):110685. 10.1016/j.Ygeno.2023.110685
14.
JiangHZhaoYJinMZhangZWangLChengXet al. Colchicine inhibits smooth muscle cell phenotypic switch and aortic dissection in mice. Arterioscler, Thromb, Vasc Biol. (2025) 45(6):979–84. 10.1161/atvbaha.124.322252
15.
ProiettiRGiordaniASLorenzoA. ROCK (Rhoa/Rho kinase) activation in atrial fibrillation: molecular pathways and clinical implications. Curr Cardiol Rev. (2023) 19(3):31–6. 10.2174/1573403X19666221117092951
16.
KilianLSVoranJFrankDRangrezAY. Rhoa: a dubious molecule in cardiac pathophysiology. J Biomed Sci. (2021) 28(1):33. 10.1186/s12929-021-00730-w
17.
TucciFAPennisiRRigiraccioloDCFilipponeMGBonfantiRRomeoFet al. Loss of NUMB drives aggressive bladder cancer via a RHOA/ROCK/YAP signaling axis. Nat Commun. (2024) 15(1):10378. 10.1038/s41467-024-54246-6
18.
EspositoDPantIShenYQiaoRFYangXBaiYet al. Retraction note: ROCK1 mechano-signaling dependency of human malignancies driven by TEAD/YAP activation. Nat Commun. (2025) 16(1):9284. 10.1038/s41467-025-65053-y
19.
ZhangWWangMWangELuWLiZZhangYet al. Downregulation of RhoA/ROCK1/YAP/F-actin causing decreased aortic smooth muscle cell stiffness promotes aortic dissection formation. Life Metab. (2024) 3(5):loae022. 10.1093/lifemeta/loae022
20.
YounMSmithSMLeeAGChaeHDSpiteriEErdmannJet al. Comparison of the transcriptomic signatures in pediatric and adult CML. Cancers (Basel). (2021) 13(24):6263. 10.3390/cancers13246263
21.
LayAJColemanPRFormaz-PrestonATingKKRoedigerBWeningerWet al. ARHGAP18: a flow-responsive gene that regulates endothelial cell alignment and protects against atherosclerosis. J Am Heart Assoc. (2019) 8(2):e010057. 10.1161/jaha.118.010057
22.
LovelaceMDPowterEEColemanPRZhaoYParkerAChangGHet al. The RhoGAP protein ARHGAP18/SENEX localizes to microtubules and regulates their stability in endothelial cells. Mol Biol Cell. (2017) 28(8):1066–78. 10.1091/mbc.E16-05-0285
23.
LiuWHanJYangQXiaLChenCSongJet al. Knockdown of ARHGAP24 reduces intimal hyperplasia through inhibiting the proliferation and phenotypic switching of smooth muscle cells possibly by inactivating both AKT and ERK1/2 signaling pathways. Biochem Biophys Rep. (2024) 37:101591. 10.1016/j.Bbrep.2023.101591
Summary
Keywords
aortic dissection, ARHGAP27, phenotype switch, RhoA/ROCK/YAP signaling, VSMC
Citation
Wang Z, Tao J and Yang Y (2026) Mechanistic study of ARHGAP27 promoting the progression of aortic dissection by regulating the RhoA/ROCK/YAP pathway. Front. Cardiovasc. Med. 13:1831795. doi: 10.3389/fcvm.2026.1831795
Received
16 March 2026
Revised
19 June 2026
Accepted
30 June 2026
Published
10 July 2026
Volume
13 - 2026
Edited by
Masanori Aikawa, Brigham and Women's Hospital and Harvard Medical School, United States
Reviewed by
Papia Basuthakur, Yale University, United States
Nico Arndt, University Medical Center Hamburg-Eppendorf, Germany
Updates
Copyright
© 2026 Wang, Tao and Yang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yining Yang yangyn5126@163.com
† These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.