In the published article, there was an error in Figure 9E as published. Due to negligence and lack of careful inspection, and this part of the sequence is very similar. Therefore, some base mapping errors occurred, the inaccurate WT sequence for SNHG1 is:UCUUUAUCUUGAGCUGUGGUA (In Figure 9E). The corrected WT sequence for SNHG1 is: AUUUUUCUACUGCUCGUGGUA. The Figure 9E caption was correct. The corrected Figure 9E appear below.
FIGURE 9
In the published article, there was an error in the Materials and methods, Quantitative Real-Time PCR section: primer sequences: SNHG1-F: AGCATCCACGAGCAAGAGAC, SNHG1-R: GATGCTACTAGTGTGGCGGG.
A correction has been made to primer sequences: SNHG1-F: GCATCTCATAATCTATCCTGG, SNHG1- R:CCTAGTTTTCCTCAAACTCCT. This sentence previously stated:
“SNHG1-F: AGCATCCACGAGCAAGAGAC, SNHG1-R: GATGCTACTAGTGTGGCGGG”
The corrected sentence appears below:
“SNHG1-QPCR-F-GCATCTCATAATCTATCCTGG, SNHG1-QPCR-R-CCTAGTTTTCCTCAAACTCCT”
The authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.
Statements
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Summary
Keywords
epigenetics, SNHG1, miRNA-140-3p, UBE2C, pan-cancer, prognosis, immunotherapy, drug sensitivity
Citation
Jiang X, Yuan Y, Tang L, Wang J, Liu Q, Zou X and Duan L (2024) Corrigendum: Comprehensive pan-cancer analysis of the prognostic and immunological roles of the METTL3/lncRNA-SNHG1/miRNA-140-3p/UBE2C axis. Front. Cell Dev. Biol. 12:1392532. doi: 10.3389/fcell.2024.1392532
Received
27 February 2024
Accepted
22 March 2024
Published
05 April 2024
Volume
12 - 2024
Edited and reviewed by
Ping Wang, Tianjin Medical University, China
Updates
Copyright
© 2024 Jiang, Yuan, Tang, Wang, Liu, Zou and Duan.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Lincan Duan, duanmumuhuosan@163.com
† These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.