CORRECTION article

Front. Cell Dev. Biol., 05 April 2024

Sec. Epigenetics and Genome Architecture

Volume 12 - 2024 | https://doi.org/10.3389/fcell.2024.1392532

Corrigendum: Comprehensive pan-cancer analysis of the prognostic and immunological roles of the METTL3/lncRNA-SNHG1/miRNA-140-3p/UBE2C axis

  • XJ

    Xiulin Jiang 1

  • YY

    Yixiao Yuan 2

  • LT

    Lin Tang 2

  • JW

    Juan Wang 2

  • QL

    Qianqian Liu 2

  • XZ

    Xiaolan Zou 2

  • LD

    Lincan Duan 2*

  • 1. Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese Academy of Sciences and Yunnan Province, Kunming Institute of Zoology, Kunming, China

  • 2. Department of Thoracic Surgery, The Third Affiliated Hospital of Kunming Medical University, Kunming, China

In the published article, there was an error in Figure 9E as published. Due to negligence and lack of careful inspection, and this part of the sequence is very similar. Therefore, some base mapping errors occurred, the inaccurate WT sequence for SNHG1 is:UCUUUAUCUUGAGCUGUGGUA (In Figure 9E). The corrected WT sequence for SNHG1 is: AUU​UUU​CUA​CUG​CUC​GUG​GUA. The Figure 9E caption was correct. The corrected Figure 9E appear below.

FIGURE 9

In the published article, there was an error in the Materials and methods, Quantitative Real-Time PCR section: primer sequences: SNHG1-F: AGC​ATC​CAC​GAG​CAA​GAG​AC, SNHG1-R: GAT​GCT​ACT​AGT​GTG​GCG​GG.

A correction has been made to primer sequences: SNHG1-F: GCA​TCT​CAT​AAT​CTA​TCC​TGG, SNHG1- R:CCTAGTTTTCCTCAAACTCCT. This sentence previously stated:

“SNHG1-F: AGC​ATC​CAC​GAG​CAA​GAG​AC, SNHG1-R: GAT​GCT​ACT​AGT​GTG​GCG​GG”

The corrected sentence appears below:

“SNHG1-QPCR-F-GCATCTCATAATCTATCCTGG, SNHG1-QPCR-R-CCTAGTTTTCCTCAAACTCCT”

The authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.

Statements

Publisher’s note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.

Summary

Keywords

epigenetics, SNHG1, miRNA-140-3p, UBE2C, pan-cancer, prognosis, immunotherapy, drug sensitivity

Citation

Jiang X, Yuan Y, Tang L, Wang J, Liu Q, Zou X and Duan L (2024) Corrigendum: Comprehensive pan-cancer analysis of the prognostic and immunological roles of the METTL3/lncRNA-SNHG1/miRNA-140-3p/UBE2C axis. Front. Cell Dev. Biol. 12:1392532. doi: 10.3389/fcell.2024.1392532

Received

27 February 2024

Accepted

22 March 2024

Published

05 April 2024

Volume

12 - 2024

Edited and reviewed by

Ping Wang, Tianjin Medical University, China

Updates

Copyright

*Correspondence: Lincan Duan,

† These authors have contributed equally to this work

Disclaimer

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.

Outline

Figures

Cite article

Copy to clipboard


Export citation file


Share article

Article metrics