Abstract
Neisseria meningitidis (Nm, the meningococcus) is considered an asymptomatic colonizer of the upper respiratory tract and a transient member of its microbiome. It is assumed that the spread of N. meningitidis into the bloodstream occurs via transcytosis of the nasopharyngeal epithelial barrier without destroying the barrier layer. Here, we used Calu-3 respiratory epithelial cells that were grown under air-liquid-interface conditions to induce formation of pseudostratified layers and mucus production. The number of bacterial localizations in the outer mucus, as well as cellular adhesion, invasion and transmigration of different carrier and disease N. meningitidis isolates belonging to MenB:cc32 and MenW:cc22 lineages was assessed. In addition, the effect on barrier integrity and cytokine release was determined. Our findings showed that all strains tested resided primarily in the outer mucus layer after 24 h of infection (>80%). Nonetheless, both MenB:cc32 and MenW:cc22 carrier and disease isolates reached the surface of the epithelial cells and overcame the barrier. Interestingly, we observed a significant difference in the number of bacteria transmigrating the epithelial cell barrier, with the representative disease isolates being more efficient to transmigrate compared to carrier isolates. This could be attributed to the capacity of the disease isolates to invade, however could not be assigned to expression of the outer membrane protein Opc. Moreover, we found that the representative meningococcal isolates tested in this study did not damage the epithelial barrier, as shown by TEER measurement, FITC-dextran permeability assays, and expression of cell-junction components.
1 Introduction
Neisseria meningitidis (Nm, meningococcus) is a Gram-negative human-specific bacterium. Approximately 10–35% of the human population carry meningococci in the nasopharynx as a part of their transient microbiome without symptoms (Yazdankhah and Caugant, 2004; ; ). In rare cases and by unknown mechanisms, N. meningitidis can cross the respiratory epithelial barrier, spread in the bloodstream, and cause a severe clinical picture called invasive meningococcal disease (IMD). Carriage status is a prerequisite for the transmigration of the pathogen from the respiratory tract into the bloodstream and thus the development of IMD.
N. meningitidis is classified into 12 serogroups based on the antigenic characteristics of its capsular polysaccharide. The vast majority of IMD cases worldwide are caused by six serogroups of N. meningitidis: A, B, C, W, X and Y (Whittaker et al., 2017; ). In developed countries, Serogroups B, C, Y, and W account for the great majority of cases of IMD (https://atlas.ecdc.europa.eu/public/index.aspx?Dataset=27&HealthTopic=36; https://www.cdc.gov/meningococcal/surveillance/index.html). Serogroup B isolates (MenB) clonal complex (cc) 32 is a major hypervirulent lineage, whilst MenW cc22 lineage causes sporadic and endemic outbreaks (Tsang et al., 2016).
The nasopharynx is located posterior to the nasal cavity and is lined with pseudostratified columnar epithelium. The pseudostratified columnar airway epithelium contains ciliated cells, goblet cells and basal cells (respiratory epithelium). The nasopharynx is also covered by stratified squamous epithelium, which comprises about 60% of the nasopharyngeal epithelium. Specialized structures, termed tight junctions, separate the epithelial layer into apical (luminal) and basolateral components, which form an important barrier for the passage of molecules and microbes from the lumen of the airways. In addition to their role in physical barrier function, respiratory epithelial cells are essential for the normal function of the mucociliary clearance. They produce a variety of antimicrobial molecules and contribute to the initiation and regulation of inflammatory responses.
The epithelium of the respiratory tract is coated with mucus, a multi-component secretion, that is produced by goblet cells. Mucus exists in two discreet layers (Zanin et al., 2016): a periciliary liquid layer (PCL), which bathes surface cilia and contacts the surface of the epithelial cells, and a more viscous gel layer on top. The gel layer contains the secreted mucins MUC5AC and MUC5B, while the PCL comprises the membrane-bound mucins MUC1, MUC4 and MUC16 (Zanin et al., 2016). Mucins have been shown to have a direct strong antipathogenic effect. For example, MUC5AC can be upregulated in the intestine during nematode infection and directly reduce ATP levels in the nematodes (). MUC2 acts as a chemoattractant; it binds to Campylobacter jejuni and has been shown to limit its growth (Tu et al., 2008). Bacteria can, however, employ various strategies to overcome the mucus layer and subsequently reach the epithelial surface of the mucous membrane.
Once N. meningitidis reaches the mucosal epithelial surface, the bacterium possesses several factors that promote adhesion to host tissues and biofilm formation. N. meningitidis expresses the type IV pili (Tfp), the outer membrane proteins Opa and Opc, and several so-called minor adhesion proteins, that mediate binding to the respective receptors on epithelial cells [reviewed in ()]. Meningococcal Tfp are suggested to mediate attachment to host cells by binding to CD46 (). However, studies with the related species N. gonorrhoeae have shown that pilus-mediated binding is not dependent on cellular CD46 expression (Tobiason and Seifert, 2001; ), but related on binding to integrins shown on urethral epithelial cells (). Opa proteins mediate binding to CEACAMs (carcinoembryonic antigen-related cell-adhesion molecule) and HSPGs (heparan sulfate proteoglycans), and the Opc protein can interact with HSPGs and, via vitronectin and/or fibronectin, bind to integrin receptors (Virji et al., 1992, 1994, 1995, 1999; Unkmeir et al., 2002; ). The Opc protein is encoded by a single gene, opcA, which is only expressed in N. meningitidis but not in the related species N. gonorrhoeae. Opc is a β-barrel protein, with five surface-exposed loops and its crystal structure was elucidated in 2002 (). Expression of Opc is due to phase variation via slipped strand mispairing within a poly-cytosine tract in the promoter region of opcA (Sarkari et al., 1994). The number of cytosine bases in this region controls the level of expression of Opc protein: if the number of cytosines is less than 10 or higher than 15, Opc is not expressed (Sarkari et al., 1994). While the bacterial factors that mediate binding to epithelial cells have been well studied and characterized, the mechanism of passage across the epithelial cell barrier has long been controversial (; ). A study by Sutherland and colleagues published in 2010, using Calu-3 cells, demonstrated that meningococci cross the epithelial cell barrier by a transcellular route; when crossing the layer, its integrity was not disrupted and the bacteria were detected within the cells of the monolayer (Sutherland et al., 2010). Furthermore, the authors were able to show that the successful crossing of the epithelial cell barrier by N. meningitidis requires the expression of Tfp and capsule and is dependent on the microtubule network of the host cell. In this study, Calu-3 cells were maintained under liquid-liquid interface (LLI) cell culture conditions. The study by Audry et al., used an air-liquid-interface (ALI) culture to allow formation of pseudostratified layers and mucus production, and showed that meningococci tend to reside in the mucus of the Calu-3 cell layer ().
The respiratory mucus represents a hitherto little-studied factor in the role of N. meningitidis-host interactions. Therefore, determining the interaction of N. meningitidis with mucus-producing epithelial cells of the respiratory tract and the mechanisms of passage through the epithelial layer is important for understanding both meningococcal carriage and disease. In this study we applied representative isolates of MenB:cc32 and MenW:cc22, including disease and carrier isolates, to study their interaction with the human bronchial epithelial cell line Calu-3, that can differentiate into polarized monolayers when grown on porous membranes in vitro (). Moreover, Calu-3 cells were grown under ALI conditions to induce formation of pseudostratified layers and production of mucus (). The rate of bacterial localization in the outer mucus, as well as the number of cell-associated bacteria, cellular adhesion, invasion and transmigration, the impact on barrier integrity and cytokine release was assessed.
2 Materials and methods
2.1 Bacterial strains and growth conditions
Bacteria were grown overnight on Columbia agar plates with 5% sheep blood (bioMérieux) at 37°C in 5% CO2. On the next day, a fraction of the bacteria was transferred to 10 ml proteose peptone medium (PPM) supplemented with 1× Kellogg´s supplement, 0.01 M MgCl2, and 0.005 M NaHCO3 (PPM+) and incubated for 90 min at 37°C in an orbital shaker at 200 rpm. Neisseria meningitidis strain MC58 is a serogroup (Sg) B (MenB) isolate (United Kingdom, 1983) of the clonal complex (cc) 32 and was kindly provided by E. R. Moxon (Tettelin et al., 2001). N. meningitidis Sg C (MenC) strain 8013/clone12 (cc18) was kindly provided by M. Taha (). N. meningitidis SgB (MenB) strain α711 (cc32) and N. meningitidis SgW (MenW) strain α275 were isolated during the Bavarian meningococcal carriage study (; ). N. meningitidis SgW (MenW) strain DE13664 was isolated from CSF. Meningococcal strains DE13664 and α711 were subject to whole-genome sequencing. Genome sequencing was performed on an Illumina NextSeq 500 sequencer (Illumina Inc., San Diego, CA, USA) at the core unit Systems Medicine of the University of Würzburg. The resulting FASTQ files were de novo assembled using the Velvet assembler integrated in Ridom SeqSphere+ software (Ridom GmbH, Münster, Germany). All strains are summarized in Table 1.
Table 1
| strain | 8013 | MC58 | α711 | DE13664 | α275 |
|---|---|---|---|---|---|
| PubMLST ID | 1038 | 240 | 10183 | 84878 | 9756 |
| Molecular Typing | |||||
| Serogroup (% of carriage/cases)* | C (3.3/17.2) | B (26.8/54.6) | B (26.8/54.6) | W (6.4/10.3) | W (6.4/10.3) |
| Sequence type (ST) | ST-177 | ST-74 | ST-32 | ST-22 | ST-22 |
| Clonal complex (CC) | ST-18 | ST-32 | ST-32 | ST-22 | ST-22 |
| porA-VR1 | 21 | 7 | 7 | 18-1 | 18-1 |
| porA-VR2 | 26-2 | 16-2 | 16 | 3 | 3 |
| fetA | F1-5 | F1-5 | F3-3 | F4-1 | F4-1 |
| General information | |||||
| No. of contigs (>2 kb) | 1 | 1 | 228 | 158 | 133 |
| Genome size, bp | 2,277,550 | 2,272,360 | 2,113,949 | 2,150,017 | 2,242,661 |
| G+C content, % | 51.4 | 51.5 | 51.75 | 51.5 | 51.2 |
| GenBank accession no. | FM999788 | AE002098 | NA | NA | AM889138 |
| Epidemiology* | |||||
| Source of the isolate | patient | patient | carrier | patient | carrier |
| Frequency of ST in carriers (%)+ | 0 | 0.05 | 1.0 | 2.5 | 2.5 |
| Frequency of CC in carriers (%)+ | 0.7 | 6.0 | 6.0 | 8.6 | 8.6 |
| Frequency of ST in cases (%)+ | <0.01 | 0.05 | 3.3 | 0.5 | 0.5 |
| Phenotypic characterization | |||||
| Opa expression | – | + | + | + | + |
| Opc expression | – | + | – | – | + |
| Class I type IV pilus | + | + | + | + | + |
Strains used in the study.
*Based on all isolates (43,336) in Europe with an assigned disease/carrier status listed in PubMLST (2023-12).
+Based on all carrier (15,432) or case isolates (27.904) in Europe listed in PubMLST.
#Based on case isolates with assigned disease for each ST or CC in Europe listed in PubMLST.
ND, Not determined; NA, Not available.
2.2 Cell culture
The human lung epithelial cell line Calu-3 (ATCC: HTB-55) was routinely cultivated in A-MEM (Advanced Minimum Essential Medium, Gibco) supplemented with 4 mM GlutaMAX (Gibco) and 2,5% fetal bovine serum (FBS; Thermo Fisher) based on the described optimized cell culturing conditions for Calu-3 cells in the study by Kreft et al. (). Cells were maintained at 37° C and 5% CO2 and 95% relative humidity until they reached 80-100% confluence. The cell culture medium was changed three times per week. For the development of Calu-3 cell models on the air-liquid or liquid-liquid interfaces, the cells were seeded on polyethylene terephthalate (PET) porous membranes with pore sizes of 3 µm (24-Well inserts, Greiner) and a seeding density of 4×105 cells/cm2 following the protocols by Kreft et al. (). For infection experiments, permeable cell culture inserts (12-, or 24-Well inserts, Greiner), with a pore size of 3 µm were used and coated with 0.2% gelatin for 1 h at 37°C. Afterwards, 800 µl (for 24-Well inserts) or 1600 µl of medium (for 12-Well inserts) was added to the basolateral chamber and cells were seeded in 200 µl (for 24-Well inserts) or 600 µl (for 12-Well inserts) medium on the apical side at a density of 4×105 cells/cm2. Cells were allowed to grow for seven days in a humidity incubator, at 37°C and 5% CO2, followed either by the removal (air lift) (for air-liquid interface (ALI) conditions) or replacement (for LLI conditions) of the apical, and replacement of the basal medium. Cells were grown for further seven days and barrier tightness was assessed by measuring the trans-epithelial electrical resistance (TEER) (Ω cm2) prior to the experiment. To assess the integrity of the barrier under ALI culture conditions, 200 µl of medium was placed on the apical side of the cells for 1 h, followed by the TEER measurement and then the medium was carefully removed again after the measurement.
2.3 Infection assay
(i) For infection experiments, bacteria were cultured as noted above. Cells were infected with 1x104 (24-Well inserts) or 4x104 (12-Well inserts) bacteria for 24 h at 37°C and 5% CO2, respectively. Calu-3 cells grown under ALI conditions were infected on the apical side by carefully applying the suspension of bacteria in 10 µl (24-Well inserts) or 40 µl (12-Well inserts). Calu-3 cells grown under LLI conditions, were infected with a suspension of bacteria in 200 µl, which was added to the medium on the apical side.
(ii) Adherence and invasion. The number of adherent and invasive bacteria was determined as described previously (; ). Briefly, cells grown under ALI or LLI culture conditions were infected for 24 h with the indicated strains using the CFUs described above. After infection, the apical sides of the cells were washed three times with 200 µl PBS and the Transwell™ membrane inserts were transferred into empty 24-Well plates. Cells were treated with 300 µl 1% saponin for 15 min and scraped off to determine the total number of adherent bacteria. To determine the number of invasive bacteria, Transwell™ membrane inserts were transferred, after the washing steps, into fresh medium containing 200 µg/ml gentamicin and 200 µl gentamicin containing medium was added to the apical side. After 2 h incubation at 37°C, Transwell™ membrane inserts were washed again and further processed as described recently (; ). To separate the bacteria in the outer mucus fraction from the cell-associated fraction, infected cell layers were incubated for 15 min with 200 µl of A-MEM-0.1% N-acetyl-L-Cysteine (N-ACC, Carl Roth) and harvested. This step was repeated three times as described by Audrey et al. (). CFU were determined by plating serial dilutions. N-ACC treatment did not affect bacterial growth (Supplementary Figure S1). Cells were furthermore treated with saponin as described for the total adherence, scraped off and bacterial numbers were assessed by plating serial dilutions to determine CFU to assess the number of cell-associated bacteria.
(iii) Transmigration assay. Bacterial transmigration was determined as recently described (; ). The cells were infected with the indicated bacterial isolate for 24 h. The inserts were then washed three times with PBS and transferred to wells of a 24-Well plate filled with 800 µl of fresh culture medium. Bacteria were allowed to transmigrate for 1 h and samples were taken for plating in a dilution series from the basolateral medium to determine bacterial CFU.
2.4 TEER determination and permeability assays
Barrier tightness was assessed by measuring the transepithelial electrical resistance (TEER) using a Millicell® ERS-2 Volt-Ohm Meter (Merck). In addition, the integrity of the cell monolayer was assessed using 70 kDa fluorescein isothiocyanate (FITC)-dextran (Sigma) permeability assays or sodium fluorescein (NaF) permeability measurements as described previously with minor adaptations (; ). Briefly, 200 µl of medium with 10 µM NaF or 1 mg/ml FITC-Dextran were added to the apical side of infected or non-infected cells and samples were taken every 15 min for a total of 1 h from the basolateral chamber. The samples were analyzed using a fluorescence plate reader (Infinite Pro, Tecan) and the permeability was calculated as described previously (Stebbins et al., 2016). TEER values of more than 400 Ω cm2 were considered to present a monolayer with intact tight junctions as described recently ().
2.5 Immunofluorescence
For immunofluorescence imaging, Calu-3 cells were grown under LLI or ALI culture conditions as described above. Inserts were fixed with 2% formaldehyde and 0.2% glutaraldehyde (GA) for 15 min at room temperature, washed twice with PBS and permeabilized for 15 min with PBS containing 0.1% saponin and 2% bovine serum albumin (BSA) (staining buffer). The cells were immunolabeled with primary antibodies against MUC5AC (RRID: AB_10978001, clone 45M1; 1:250 in staining buffer), CRB3 (RRID: AB_2640142; 1:200 in staining buffer) for 90 min, washed three times and stained with Alexa Fluor (AF) conjugated secondary antibodies (Molecular Probes, Invitrogen, Thermo Fisher Scientific) for 45 min. After three washing steps with PBS, the cytoskeleton was stained using Phalloidin-488 for 15 min at 4°C and the nuclei were stained with Hoechst33342 for 15 min at 4° C. Insert membrane was then cut out and mounted with FluoroShield (Sigma-Aldrich) on glass slides. The membrane was covered with a high precision cover glass and imaging was performed on a Nikon Ti Eclipse spinning disc microscope. Image analyses were performed using the NIS-Elements software (Nikon) and FIJI ImageJ version 1.52 (NIH). For ZO-1 and occludin staining we followed a protocol provided by STEMCELL Technologies (https://www.stemcell.com/technical-resources/educational-materials/protocols/how-to-perform-immunocytochemistry-icc-staining-of-epithelial-cells-cultured-as-monolayers-or-at-the-air-liquid-interface.html). Briefly, Calu-3 cells were infected with 1x104 bacteria for 24 h. The infected cells on Transwell™ inserts were washed three times with PBS and then fixed overnight in ice-cold methanol at -20°C. The following day, the lower part of the inserts was washed with ice-cold acetone for 1 min. To permeabilize the samples, incubated on a shaker in staining buffer [1% BSA containing Triton X-100 (Roth 3051.4) and Tween 20 (Roth 9127.1)] for 1 h at room temperature. Afterwards, the inserts were washed three times with PBS. To detect tight junction proteins, the samples were incubated overnight at 4°C with primary antibodies against ZO-1 (Proteintech 2-1773-1-AP)) and occludin (BD Transduction Laboratories 611091). The next day, the inserts were washed in PBS and secondary staining was performed for 1 h at room temperature. Therefore, secondary antibodies Alexa Fluor 488 goat anti-mouse (Invitrogen) and Alexa Fluor 555 donkey anti-rabbit (Invitrogen) at a dilution of 1:200 in 1% BSA were used. Subsequently DAPI staining was performed (Invitrogen D1306; 1:1000 in PBS). The Transwell™ membranes were then cut out, mounted on glass slides (mounting medium: Fluoroshield, Sigma) and incubated at 4°C overnight. The imaging was performed on a Nikon Ti Eclipse spinning disc microscope. Image analyses were performed using the NIS-Elements software (Nikon).
2.6 Transmission electron microscopy
Preparation of the samples were performed as described previously (). Briefly, Calu-3 cells were infected with 1x104 bacteria for 24 h and afterwards fixed over night with 2,5% GA at 4°C. On the next day, samples were rinsed five times with cacodylate buffer pH 7,2 followed by the incubation with 2% osmium tetroxide for 90 min. The samples were than washed five times with ddH2O and the membranes were cut out of the inserts. Following, membranes were contrasted with 0,5% watersoluted uranyl acetate overnight. Before dehydration of the samples, membranes were washed five times with ddH2O and dehydration was performed through the addition of ethanol solutions with ascending concentrations (50%, 70%, 90%, 3 × 100%, each time for 30 min.) followed by 30 min exposure to propylenoxid. Embedding was conducted using a 1:1 solution of propylenoxid and durcopan which was added to the samples and allowed to dry overnight. Subsequently the samples were immersed in pure durcupan, which was changed twice each two h. Finally, the samples were placed in an embedding capsule polymerized at 60°C for 48 h, ultrathin sectioned and contrasted. The sections were examined by a JEM-1400Flash transmission electron microscope (JEOL) equipped with a Matataki camera system.
2.7 Quantitative PCR
The expression of tight junction proteins and cytokines was determined using quantitative PCR (qPCR). Calu-3 cells were grown on 12-Well inserts under ALI or LLI culture conditions, respectively, and were infected for 24 h with 4x104 bacteria. The cells were then lysed, and the RNA purified using the NucleoSpin RNA kit (Macherey-Nagel) according to the manufacturer’s instructions. RNA concentration was determined with the NanoDrop (Thermo-Fisher), and 500 ng were used for cDNA synthesis using LunaScript RT (New England Biolabs). qPCR was conducted on a StepOnePlus real-time PCR Thermocycler (Applied Biosystems) using PowerUp SYBR Green master mix (Applied Biosystems). Primer sequences are listed in Table 2. All primers were validated by primer efficiency analysis and specificity was controlled by agarose gel electrophorese of the qPCR products. All data are presented as fold change over 18S rRNA using the cycle threshold (ΔΔCt) calculation ().
Table 2
| Gene | Forward sequence | Reverse sequence |
|---|---|---|
| 18S rRNAa | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
| OCLN | ATGGCAAAGTGAATGACAAGCGG | CTGTAACGAGGCTGCCTGAAGT |
| CXCL8c | AGCTCTGTGTGAAGGTGCAG | AATTTCTGTGTTGGCGCAGT |
| CXCL1c | CTCTTCCGCTCCTCTCACAG | GGGGACTTCACGTTCACACT |
| CXCL2c | CTCAAGAATGGGCAGAAAGC | AAACACATTAGGCGCAATCC |
| IL6c | GGAGACTTGCCTGGTGAAAA | CAGGGGTGGTTATTGCATCT |
| CCL20c | GCGCAAATCCAAAACAGACT | CAAGTCCAGTGAGGCACAAA |
| TJP1 | GTCCAGAATCTCGGAAAAGTGCC | CTTTCAGCGCACCATACCAACC |
Primers used for qPCR.
a (), b (), c (van Sorge et al., 2008).
2.8 IL-8 and CCL20 ELISA
Samples for ELISA were collected from the basolateral chamber of Calu-3 cells grown on 12-Well inserts under ALI or LLI culture condition after 24 h of infection with 4x104 bacteria of the indicated strains. For detection of IL-8, the Human IL-8 ELISA Set (BD Biosciences) was used according to the manufactures protocol and as described previously (). For detection of CCL-20, the commercially available ELISA was used (R&D Systems). The ELISA was performed according to the manufacture’s instruction using the reagents provided within the kit.
2.9 Statistics
Statistical analysis was conducted using the GraphPad Prism software (version 6.01, GraphPad Software Inc.). For pairwise comparison, a two-tailed Student´s t test was used, and analysis of variance (ANOVA) followed by Dunnett’s multiple comparison test was used for multiple comparisons. Statistical significance was accepted at a P value below 0.05.
3 Results
3.1 Interaction between Calu-3 epithelial cells grown at an air-liquid interface or a liquid-liquid interface and N. meningitidis
A unique feature of the respiratory epithelium is that the apical side of the cells faces the air. To mimic this under laboratory conditions, we used the Calu-3 human lung epithelial cell line (ATCC HTB-55), cultured the cells at an air-liquid interface (ALI), and compared it with the culture model at the liquid-liquid interface (LLI) (Figures 1A–I). Calu-3 cells were grown on Transwell™ inserts with a 3 µm pore membrane in A-MEM supplemented with GlutaMAX and FBS in the apical and basal compartment. The cultures were maintained for 7 days until a transepithelial electrical resistance (TEER) ≥ 700 Ω cm2 was obtained, corresponding to a confluent culture. Calu-3 differentiation was initiated by changing culture conditions to ALI by removing the apical medium, whereas for LLI media from the apical and basal chamber were replaced with fresh media. The formation of the epithelial barrier was next monitored by measuring the TEER for further 7 days (Figure 1B). We observed an increase of the TEER with a maximum value of 744.7 ± 93.3 Ω cm2 at day 14 at LLI conditions (Figure 1B). TEER values of cells at the ALI conditions were approximately 40% below the values at the LLI condition. At day 8 (day 1 after air lift), the TEER decreased to 450.2 ± 151.5 Ω cm2, however, a TEER > 400 Ω cm2 was maintained for at least 7 days after establishing ALI conditions (Figure 1B). The paracellular permeability of the Calu-3 cells was measured by permeability assays on day 14 to confirm the TEER results (Figure 1C). Permeability to sodium fluorescein (NaF) was measured at 9.5 ± 12.6 × 10–7 cm/s for cells grown under ALI culture conditions, while values of 2.8 ± 3.4 × 10–7 cm/s were observed for cells grown under LLI culture conditions (Figure 1C). In parallel, permeability for fluorescein isothiocyanate (FITC-)dextran (70kDa) was determined and assessed at 3.9 ± 4.6 × 10–8 cm/s for cells grown under ALI culture conditions, while values of -1.8 ± 1.4 × 10–8 cm/s were observed for cells grown under LLI culture.
Figure 1
Calu-3 cells grown at the ALI and LLI culture conditions were then characterized using transmission electron microscopy (TEM) and confocal immunofluorescence imaging. Using TEM, we observed various electron dense regions between adjacent cells most likely representing cellular junctions including tight junctions or adherens junctions when cells were grown at LLI conditions (Figure 1D). Calu-3 cells grown under ALI culture conditions showed a pseudostratified columnar epithelium (Figure 1E). Moreover, cells showed apical-basal polarization with nuclei located on the basolateral side of cells and microvilli formation at the apical surface (Figure 1E). Tight junctions and adhesion belts were present at sites of cell-cell contact (Figure 1F). Calu-3 cells differentiate into ciliated and non-ciliated cells. The latter produce mucus and have previously been described as goblet-like cells (Shen et al., 1994; ). A representative image shows a mucus-producing cell with an abundance of mucin vesicles (Figure 1G). Cells were next stained for F-actin with phalloidin (green), for nuclei with Hoechst (blue), for secreted mucin with anti-MUC5AC (red) antibody, and for cell polarity with anti-crumbs cell polarity complex component (CRB) 3 (magenta) antibody and analyzed by confocal microscopy (Figure 1H; Supplementary Figure S2). Calu-3 cells grown at LLI conditions showed a densely packed and thin monolayer, approximately 8 µm high, with low expression of mucin and CRB3. In contrast, Calu-3 cells grown at ALI conditions showed a stratified columnar epithelium with a multicellular columnar cell layer, approximately 20-30 µm in height, with mucus-secreting cells, and strong expression of CRB3 (Figure 1H).
We next evaluated the traversal of N. meningitidis of Calu-3 cells grown either at ALI or LLI conditions. N. meningitidis strain 8013 (MenC:cc18), recently used in the report of Audry et al. (), served as a control. Both models were infected with N. meningitidis 8013 or N. meningitidis MC58 (MenB:cc32) (characterized in Table 1) for 24 h to determine the ability of the bacteria to cross the epithelial barrier (Figure 1I). N. meningitidis strain MC58 was chosen as a prototype sequence type (ST)-32 strain belonging to the hyperinvasive lineage ST-32 clonal complex (cc). The results showed a significant reduction in the number of transmigrating bacteria for both meningococcal strains tested when Calu-3 cells were grown under ALI conditions compared to cells grown under LLI conditions. Data received for strain N. meningitidis 8013 confirmed previously published data using Calu-3 cells grown under ALI culture conditions ().
3.2 Carrier and disease isolates of MenB:cc32 and MenW:cc22 primarily colonize the outer mucus of epithelial cells
The number of bacteria found in lower chamber of the Transwell™ were significantly lower when cells were grown under ALI compared to LLI conditions, regardless of which isolate was analysed. One reason might be that bacteria are trapped within the mucus and recent work has indicated, that N. meningitidis primarily reside in the outer mucus when cells are grown under ALI conditions, which indicates that the mucus layer is probably the actual niche for the pathogen (). Therefore, we next assessed the ability of N. meningitidis isolates to interact with epithelial cells and measured the number of cell-attached bacteria and bacteria found in the outer mucus after 24 h incubation of Calu-3 cells grown under ALI culture conditions. Moreover, we included disease and carrier isolates of two hypervirulent lineages. Isolate α711 was chosen as a representative carrier isolate highly related to MC58 from the ST-32 cc. In addition, a representative disease-carrier pair of MenW:cc22 (DE13664 and α275) was included in the analyses. Although the disease-carrier isolates belong to the same cc, they differ in the expression of some of their outer membrane proteins, for instance in the expression of the major adhesin Opc, which was expressed only by strain MC58 and carrier isolate α275 (Supplementary Figure S3) and was not expressed by strain 8013 due to deletion of the opcA gene or by the isolates α711 and DE13664 because of phase variation (Supplementary Figure S3).
Following previous studies performed with meningococcal strain 8013 (), we first examined the localization of the bacteria in the mucus layer, which can be separated into cell-associated fraction and outer mucus fractions. After infecting the cells with 1x104 bacteria for 24 h, the outer and cell-attached mucus fractions were collected, and the CFU per sample was determined. Meningococcal strain 8013 showed that the bacteria primarily resided in the outer mucus layer (>80%) as reported previously () (Figure 2A). Similar data were observed for MenB:cc32 and MenW:cc22 isolates (Figure 2A). Most bacteria were found in the outer mucus (87.07% for MC58, 91.84% for α711, 84.94% for DE13664 and 83.83% for α275), whereas a lower number of bacteria was found in the cell-attached mucus (12.92% for MC58, 8.15% for α711, 15.05% for DE13664 and 16.16% for α275). In addition, we determined the absolute number of total adherent bacteria (outer mucus and cell-attached bacteria): at 24h post-infection (p.i.) the rate of total adherent bacteria was comparable high for the MenB:cc32 isolates (MC35 and α711) compared to strain 8013 (Figure 2B), whereas a slight increase of the number of total adherent bacteria was detected at 24h p.i. for both MenW:cc22 isolates DE13664 and α275 compared to MenB:cc32 isolate MC58. The total number of adherent bacteria for α711 did not significantly differ from the number determined for the MenW:cc22 isolates (Figure 2B).
Figure 2
3.3 Carrier and disease isolates of MenB:cc32 and MenW:cc22 differ in their ability to overcome the nasopharyngeal epithelial barrier
We next determined the frequency of transmigration events for each strain after 4 and 24 h of infection with 1x104 bacteria. Transmigration was analysed by plating the entire amount (for the 4 h timepoint), or appropriate dilutions (for the 24 h timepoint) of the basal media on agar plates. Transmigration was assessed positive if at least one CFU was recovered from the basal chamber as described recently (). When we infected the cells with the MenC:cc18 strain 8013 only 1 out of 9 basal chambers were found positive at 4 h p.i., and 5 out of 18 basal chambers were found positive at 24 h p.i., clearly showing that this strain is mainly non-transmigrating after 4 h of infection, and the frequency just rises insignificantly after 24 h of infection (from 11 to 27%, Figure 3A). When we compared disease and carrier isolates of MenB:cc32 or MenW:cc22, we did not detect any differences between MenB:cc32 disease strain MC58 and carrier strain α711 or MenW:cc22 disease strain DE13664 and carrier α275 in their transmigration frequencies (2 out of 9 (4 h) and 17 out of 18 (24 h) basal chambers for MC58, 2 out of 9 (4 h) and 16 out of 18 (24 h) basal chambers for α711, 0 out of 9 (4 h) and 18 out of 18 (24 h) basal chambers for DE13664, 2 out of 9 (4 h) and 18 out of 18 (24 h) basal chambers for α275) (Figures 3B, C, left panel). In addition, we examined the absolute number of bacteria that migrated through the barrier. Therefore, the infected chambers were washed and transferred to fresh medium after 24 h of infection, and the number of transmigrating bacteria was counted after 1 h. The results showed that even if the transmigration frequency did not differ between disease and carrier isolates, the total number of bacteria entering the basal chamber was reduced by 80% for α711 compared to MC58 and 95% for α275 compared to DE13664 (Figures 3B, C, right panel).
Figure 3
The number of bacteria detected in the lower chamber of the Transwell™ might result from loss of barrier integrity. In previous research, it has been a question of debate, whether N. meningitidis crosses the epithelium by a transcellular (
Figure 4

Effects of N. meningitidis infection on cell-junction expression in Calu-3 cells, FITC-dextran permeability, or TEER. Calu-3 cells were infected with either MenC:cc18 strain 8013, or representative strains from MenB:cc32 or MenW:cc22 lineages for 24 h (A) TEER values of infected and uninfected (control) Calu-3 cells measured at 24 p.i. Data presented as mean ± SD from three independent experiments performed in duplicates. (B) FITC-Dextran (70kDa) permeability. Data presented as mean ± SD from three independent experiments performed in duplicates. (C) Relative gene expression of tight junction components ZO-1 (TJP1) or occludin (OCLN) quantified by qPCR. Data were normalized to 18S rRNA and presented as the mean Log2 fold change ± SD of three independent experiments performed in duplicates. (D) Enumeration of intracellular CFU per monolayer in Calu-3 cells grown under ALI conditions after infection with 1x104 bacteria of the indicated N. meningitidis strains, determined by gentamicin protection assays. **P < 0.01; unpaired, two-tailed Student’s t-test.
To further rule out that the expression of tight junction proteins is not altered in response to infection, we conducted qPCR to assess the expression of the tight junction proteins ZO-1 (TJP1) and occludin (OCLN). The expression levels of both proteins remained constant after infection (Figure 4C), indicating that neither the disease nor the carrier isolates of both lineages tested in this study altered tight junction expression.
To further assess the effects of N. meningitidis on the localization of ZO-1 and occludin, we analyzed Calu-3 cell layers after 24 h of infection with MenB:cc32 and MenW:cc22 strains using confocal microscopy. Here, we observed that neither ZO-1 nor occludin distribution was altered during infection (Figure 5), furthermore corroborating that tight junctions remain intact during N. meningitidis infection.
Figure 5

Effects of N. meningitidis infection on cell-junction localization in Calu-3 cells. Epithelial cell layers were infected with 1×104 bacteria of meningococcal isolates MenB:cc32 strain MC58, MenB:cc32 strain α711, MenW:cc22 strain DE13664, and MenW:cc22 strain α275 for 24 h or cells were left uninfected as control (uninf). Confocal microscopy images showing tight junction staining for occludin (green), zonula occludens (ZO)-1 (red) in Calu-3 cells grown under ALI conditions. Nuclei staining was performed with DAPI (blue). Scale bars represent 10 µm.
The higher efficiency of the disease isolates to transmigrate the barrier might be a result of a higher efficiency to invade into Calu-3 cells. We therefore determined invasion rate for both the disease and carrier isolates of MenB:cc32 and MenW:cc22 strains. The number of recovered intracellular bacteria was significantly lower (2.5× 102cfu/monolayer for MenB:cc32 strain α711 and 4.3 × 102 cfu/monolayer for MenW:cc22 strain α275) compared to the respective disease strains from the same lineage (10.3 × 102 cfu/monolayer for MenB32:cc strain MC58 and 36.3 × 102 cfu/monolayer for MenW:cc22 strain DE13664) (Figure 4D). The differences in invasive capacity, however, could not be attributed to the expression of the outer membrane protein Opc, as outlined above (Supplementary Figure S3).
In addition, infected Calu-3 monolayers were examined by transmission electron microscopy (TEM) after appropriate preparation of semi-thin sections. TEM pictures showed that all isolates interacted directly with the cells and were able to effectively penetrate the cell layer without damaging the cell-cell junctions (Figures 6A–E, Supplementary Figures S4-S6). The bacteria were found either as single cells (Supplementary Figure S5F) or in conglomerates (Figure 6F, Supplementary Figures S4F, S6F), often enclosed within vacuoles, strongly suggesting their intracellular localization (Figure 6F), indicating that transcytosis occurs in vacuoles as previously described for human brain microvascular endothelial cells or Calu-3 cells, respectively (
Figure 6

TEM of infected Calu-3 cells grown under ALI conditions. Epithelial cell layers were infected with 1×104N. meningitidis MC58 for 24 h. (A) Image shows intimate attachment of meningococci to the cells. Boxed region in (A) is enlarged in (B). (B) The white arrow indicates adherent bacteria, and the black arrow indicates a folding artefact. (C) Intact cell junctional structures. The boxed region in (C) is enlarged in (D). (D) Enlargement of the region between the cells reveal the presence of major junctional structures (white arrows). (E) Monolayers remain intact and appeared undamaged. Image shows bacterial colonies on the apical surface of the epithelial cell layer. (F) Bacterial transcytosis across the epithelial cell layer. The white arrows points to bacteria, which are likely situated intracellularly within a vacuole.
3.4 Cytokine release from infected Calu-3 cells differs between LLI and ALI cell culture condition and is induced to varying degrees by the different meningococcal isolates
We next were interested in the cellular immune response after challenging the cells - grown under LLI or ALI conditions - with bacteria and investigated the cytokine responses upon infection. We selected five cytokines, including CXCL-1, CXCL-2, IL-6, IL-8, and CCL-20, and determined their expression levels 24 h after infection using qPCR (Figure 7A). MenB:cc32 strain MC58 induced a significant stronger increase in cytokine expression compared to control MenC:cc18 strain 8013 when cells were infected under ALI conditions, CXCL-1 was 3.4-fold higher expressed for MC58-infected cells compared to strain 8013. In general, the cytokine release appeared to be higher from cells grown under ALI conditions compared to LLI conditions. Whereas for CXCL-2 and IL-6, we observed no significant differences in expression levels, we detected a strongly enhanced upregulation for CXCL-1, IL-8, and CCL-20 when cells were grown under ALI culture conditions and infected with the different strains compared to cell grown under LLI conditions. As IL-8 and CCL-20 showed the strongest increase in mRNA expression, we next examined the secretion of these cytokines using commercially available ELISA kits. Calu-3 cells were infected for 24 h, and samples were taken from the basolateral chamber. The ELISA results were consistent with those obtained by qPCR, with the strongest increase observed when cells were grown under ALI conditions and infected with the disease MenB:cc32 strains (Figure 7B).
Figure 7

Effects of N. meningitidis infection on expression of proinflammatory cytokines/chemokines in Calu-3 cells grown under LLI or ALI conditions. (A) Relative expression of CXCL1, CXCL2, CCL20, IL6, and IL8 transcripts in Calu-3 cells grown on 12-Well inserts infected with 4x104 bacteria. Results show the mean ± SD Log2 fold changes, relative to uninfected control cells from three independent experiments performed in duplicates. Data were normalized to 18S rRNA. (B) Concentration of CCL-20 and IL-8 measured in the basal chamber at 24 h p.i., determined using ELISA. Data presented as mean ± SD from three independent experiments performed in duplicates. *P < 0.05; **P < 0.01; ****P < 0.0001 by One-way ANOVA.
4 Discussion
Neisseria meningitidis is an effective colonizer of the human nasopharynx, with asymptomatic carriage rates of greater than 25% described in some series of adolescents and young adults (Yazdankhah and Caugant, 2004;
In this study we made use of a Calu-3 air-liquid-interface (ALI) cell culture-based model that induces formation of pseudostratified layers and mucus production and investigated the interaction of carrier and disease N. meningitidis isolates belonging to MenB:cc32 and MenW:cc22 with the epithelial barrier. Our data with the hypervirulent lineage MenB:cc32 and the endemic lineage MenW:cc22 showed that all isolates, regardless of the genetic lineage and whether they are a carrier and disease strain, are mainly trapped in the outer mucus layer of the respiratory tract, as recently shown for N. meningitidis isolate 8013, a MenC:cc18 strain (
The nasopharyngeal respiratory epithelium is lined by pseudostratified columnar ciliated epithelium (
When we infected the Calu-3 cells grown under ALI condition, most bacteria (80–90%) were detected in the outer mucus layer as recently described for the first time in the study by Audry et al. (
The Opc protein is one of the meningococcal factors involved in adhesion to and invasion into host cells: Opc can interact with HSPGs and, via vitronectin and/or fibronectin, enable binding to integrin receptors (Virji et al., 1992, 1994, 1995, 1999; Unkmeir et al., 2002;
The role of other virulence factors of N. meningitidis in the interaction with Calu-3 cells grown under either ALI or LLI conditions has been investigated in more detail in other published studies (Sutherland et al., 2010;
We also determined the cellular immune response to infection of ALI Calu-3 cells with the various strains. Expression of IL-6, IL-8 (CXCL8), CXCL1, CXCL2, and CCL-20, which are known to be expressed in the respiratory epithelium upon infection (Starner et al., 2003; Shieh et al., 2014; Yamamoto et al., 2014;
The nasopharynx of healthy individuals is colonized by a wide variety of bacterial genera, including Streptococcus, Corynebacterium, Haemophilus, Staphyloccocus, and Neisseria sp (
The development of physiologically relevant respiratory epithelium analogues is important for infection studies as these models more accurately reflect the in vivo situation. Growing Calu-3 cells on Transwell® inserts [(two-dimensional (2D)] under ALI conditions allows the differentiation of cells into polarized monolayers and formation of pseudostratified layers and mucus production (
Taken together, our results provide evidence that both disease and carrier isolates of the species N. meningitidis irrespective of the genetic lineage are mainly trapped in the outer mucus of the infected respiratory epithelium, however a sufficient proportion of bacteria can reach the surface of host cells and transmigrate across the epithelial barrier. Further exploration of the mechanistic basis that defines the invasive phenotype of disease isolates within N. meningitidis strains may improve our understanding of the transition of meningococci from benign commensals to life-threatening pathogens.
Statements
Data availability statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://pubmlst.org/bigsdb?db=pubmlst_neisseria_isolates&page=query, id10183 https://pubmlst.org/bigsdb?db=pubmlst_neisseria_isolates&page=query, id84878.
Ethics statement
Ethical approval was not required for the studies on humans in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used. Ethical approval was not required for the studies on animals in accordance with the local legislation and institutional requirements because only commercially available established cell lines were used.
Author contributions
SP: Conceptualization, Data curation, Formal Analysis, Funding acquisition, Investigation, Methodology, Supervision, Visualization, Writing – original draft. KM: Data curation, Formal Analysis, Investigation, Writing – original draft. HC: Data curation, Funding acquisition, Investigation, Methodology, Writing – review & editing. CS: Funding acquisition, Methodology, Resources, Writing – review & editing. AS: Conceptualization, Project administration, Resources, Supervision, Writing – original draft, Funding acquisition, Validation.
Funding
The author(s) declare that financial support was received for the research, authorship, and/or publication of this article. SP was supported by a grant (Anschubförderung) from the University of Wuerzburg, AS-U received funding from the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) research training program GRK2157 entitled “3D Tissue Models for Studying Microbial Infections by Human Pathogens”. A JEOL JEM-1400 Flash electron microscope was provided by the DFG – 426173797 (INST 93/1003-1 FUGG).
Acknowledgments
We are grateful to Johanna Krzok for excellent technical help as well as for excellent technical execution of the confocal analyses. We are grateful to Johannes Stumpf for help with the Western blots. We would like to thank Daniela Bunsen and Claudia Gehrig-Höhn for sample preparation and technical assistance with TEM, and Ingo Fohmann for excellent help in analysing the confocal microscopy images and useful discussions.
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2024.1389527/full#supplementary-material
References
1
AudryM.Robbe-MasselotC.BarnierJ.-P.GachetB.SaubaméaB.SchmittA.et al. (2019). Airway mucus restricts neisseria meningitidis away from nasopharyngeal epithelial cells and protects the mucosa from inflammation. mSphere4, e00494–e00419. doi: 10.1128/mSphere.00494-19
2
BarrileR.KasendraM.Rossi-PaccaniS.MerolaM.PizzaM.BaldariC.et al. (2015). Neisseria meningitidis subverts the polarized organization and intracellular trafficking of host cells to cross the epithelial barrier. Cell Microbiol.17, 1365–1375. doi: 10.1111/cmi.v17.9
3
BirknessK. A.SwisherB. L.WhiteE. H.LongE. G.EwingE. P.Jr.QuinnF. D. (1995). A tissue culture bilayer model to study the passage of Neisseria meningitidis. Infect. Immun.63, 402–409. doi: 10.1128/iai.63.2.402-409.1995
4
BogaertD.KeijserB.HuseS.RossenJ.VeenhovenR.van GilsE.et al. (2011). Variability and diversity of nasopharyngeal microbiota in children: A metagenomic analysis. PloS One6, e17035. doi: 10.1371/journal.pone.0017035
5
CallaghanM. M.DillardJ. P. (2019). Mucus is a key factor in neisseria meningitidis commensalism. mSphere4, e00777-19. doi: 10.1128/mSphere.00777-19
6
CaugantD. A.MaidenM. C. (2009). Meningococcal carriage and disease–population biology and evolution. Vaccine27 Suppl 2, B64–B70. doi: 10.1016/j.vaccine.2009.04.061
7
ChenM.HeS.MilesP.LiC.GeY.YuX.et al. (2022). Nasal bacterial microbiome differs between healthy controls and those with asthma and allergic rhinitis. Front. Cell. Infection Microbiol.12. doi: 10.3389/fcimb.2022.841995
8
ChristensenH.MayM.BowenL.HickmanM.TrotterC. L. (2010). Meningococcal carriage by age: a systematic review and meta-analysis. Lancet Infect. Dis.10, 853–861. doi: 10.1016/S1473-3099(10)70251-6
9
ClausH.MaidenM. C.WilsonD. J.McCarthyN. D.JolleyK. A.UrwinR.et al. (2005). Genetic analysis of meningococci carried by children and young adults. J. Infect. Dis.191, 1263–1271. doi: 10.1086/428590
10
ComanducciM.BambiniS.BrunelliB.Adu-BobieJ.AricoB.CapecchiB.et al. (2002). NadA, a novel vaccine candidate of Neisseria meningitidis. J. Exp. Med.195, 1445–1454. doi: 10.1084/jem.20020407
11
DaveN.AlbiheyriR. S.WanfordJ. J.GreenL. R.OldfieldN. J.TurnerD. P. J.et al. (2023). Variable disruption of epithelial monolayers by Neisseria meningitidis carriage isolates of the hypervirulent MenW cc11 and MenY cc23 lineages. Microbiol. (Reading)169. doi: 10.1099/mic.0.001305
12
DaviesJ.CarlstedtI.NilssonA. K.HåkanssonA.SabharwalH.van AlphenL.et al. (1995). Binding of Haemophilus influenzae to purified mucins from the human respiratory tract. Infect. Immun.63, 2485–2492. doi: 10.1128/iai.63.7.2485-2492.1995
13
DerrienM.van PasselM. W. J.van de BovenkampJ. H. B.SchipperR.de VosW.DekkerJ. (2010). Mucin-bacterial interactions in the human oral cavity and digestive tract. Gut Microbes1, 254–268. doi: 10.4161/gmic.1.4.12778
14
EdwardsJ. L.ApicellaM. A. (2005). I-domain-containing integrins serve as pilus receptors for Neisseria gonorrhoeae adherence to human epithelial cells. Cell Microbiol.7, 1197–1211. doi: 10.1111/j.1462-5822.2005.00547.x
15
EndresL. M.JungblutM.DivyapicigilM.SauerM.StigloherC.ChristodoulidesM.et al. (2022). Development of a multicellular in vitro model of the meningeal blood-CSF barrier to study Neisseria meningitidis infection. Fluids Barriers CNS19, 81. doi: 10.1186/s12987-022-00379-z
16
FosterK. A.AveryM. L.YazdanianM.AudusK. L. (2000). Characterization of the Calu-3 cell line as a tool to screen pulmonary drug delivery. Int. J. Pharm.208, 1–11. doi: 10.1016/S0378-5173(00)00452-X
17
GaraiP.AtackJ. M.WillsB. M.JenningsM. P.BakaletzL. O.BrockmanK. L. (2023). Adherence of nontypeable haemophilus influenzae to cells and substrates of the airway is differentially regulated by individual modA phasevarions. Microbiol. Spectr.11, e0409322. doi: 10.1128/spectrum.04093-22
18
GlaserL.CoulterP. J.ShieldsM.TouzeletO.PowerU. F.BroadbentL. (2019). Airway epithelial derived cytokines and chemokines and their role in the immune response to respiratory syncytial virus infection. Pathogens8, 106. doi: 10.3390/pathogens8030106
19
HarrisonO. B.ClausH.JiangY.BennettJ. S.BratcherH. B.JolleyK. A.et al. (2013). Description and nomenclature of Neisseria meningitidis capsule locus. Emerg. Infect. Dis.19, 566–573. doi: 10.3201/eid1904.111799
20
HasnainS. Z.EvansC. M.RoyM.GallagherA. L.KindrachukK. N.BarronL.et al. (2011). Muc5ac: a critical component mediating the rejection of enteric nematodes. J. Exp. Med.208, 893–900. doi: 10.1084/jem.20102057
21
HillD. J.GriffithsN. J.BorodinaE.VirjiM. (2010). Cellular and molecular biology of Neisseria meningitidis colonization and invasive disease. Clin. Sci. (Lond)118, 547–564. doi: 10.1042/CS20090513
22
HughesG. W.RidleyC.CollinsR.RosemanA.FordR.ThorntonD. J. (2019). The MUC5B mucin polymer is dominated by repeating structural motifs and its topology is regulated by calcium and pH. Sci. Rep.9, 17350. doi: 10.1038/s41598-019-53768-0
23
KällströmH.LiszewskiM. K.AtkinsonJ. P.JonssonA.-B. (1997). Membrane cofactor protein (MCP or CD46) is a cellular pilus receptor for pathogenic Neisseria. Mol. Microbiol.25, 639–647. doi: 10.1046/j.1365-2958.1997.4841857.x
24
Kia'iN.BajajT. (2024). “Histology, respiratory epithelium,” in StatPearls. (StatPearls Publishing Copyright © 2024, StatPearls Publishing LLC, Treasure Island (FL).
25
KimB. J.McDonaghM. A.DengL.GastfriendB. D.Schubert-UnkmeirA.DoranK. S.et al. (2019). Streptococcus agalactiae disrupts P-glycoprotein function in brain endothelial cells. Fluids Barriers CNS16, 26. doi: 10.1186/s12987-019-0146-5
26
KirchnerM.HeuerD.MeyerT. F. (2005). CD46-independent binding of neisserial type IV pili and the major pilus adhesin, PilC, to human epithelial cells. Infect. Immun.73, 3072–3082. doi: 10.1128/IAI.73.5.3072-3082.2005
27
KreftM. E.JermanU. D.LasičE.Hevir-KeneN.RižnerT. L.PeternelL.et al. (2015). The characterization of the human cell line Calu-3 under different culture conditions and its use as an optimized in vitro model to investigate bronchial epithelial function. Eur. J. Pharm. Sci.69, 1–9. doi: 10.1016/j.ejps.2014.12.017
28
LeeR. E.ReidelB.NelsonM. R.MacdonaldJ. K.KesimerM.RandellS. H. (2023). Air-Liquid interface cultures to model drug delivery through the mucociliary epithelial barrier. Adv. Drug Delivery Rev.198, 114866. doi: 10.1016/j.addr.2023.114866
29
LivakK. J.SchmittgenT. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods25, 402–408. doi: 10.1006/meth.2001.1262
30
MarrazzoP.MaccariS.TaddeiA.BevanL.TelfordJ.SorianiM.et al. (2016). 3D reconstruction of the human airway mucosa in vitro as an experimental model to study NTHi infections. PloS One11, e0153985. doi: 10.1371/journal.pone.0153985
31
MartinsM.PorriniC.du MerleL.DanneC.Robbe-MasselotC.Trieu-CuotP.et al. (2016). The Pil3 pilus of Streptococcus gallolyticus binds to intestinal mucins and to fibrinogen. Gut Microbes7, 526–532. doi: 10.1080/19490976.2016.1239677
32
Martins GomesS. F.WestermannA. J.SauerweinT.HertleinT.ForstnerK. U.OhlsenK.et al. (2019). Induced pluripotent stem cell-derived brain endothelial cells as a cellular model to study neisseria meningitidis infection. Front. Microbiol.10. doi: 10.3389/fmicb.2019.01181
33
MikuckiA.McCluskeyN. R.KahlerC. M. (2022). The host-pathogen interactions and epicellular lifestyle of neisseria meningitidis. Front. Cell Infect. Microbiol.12. doi: 10.3389/fcimb.2022.862935
34
MinK. A.RosaniaG. R.KimC. K.ShinM. C. (2016). Functional and cytometric examination of different human lung epithelial cell types as drug transport barriers. Arch. Pharm. Res.39, 359–369. doi: 10.1007/s12272-015-0704-6
35
NassifX.LowyJ.StenbergP.O'GaoraP.GanjiA.SoM. (1993). Antigenic variation of pilin regulates adhesion of Neisseria meningitidis to human epithelial cells. Mol. Microbiol.8, 719–725. doi: 10.1111/j.1365-2958.1993.tb01615.x
36
NikulinJ.PanznerU.FroschM.Schubert-UnkmeirA. (2006). Intracellular survival and replication of Neisseria meningitidis in human brain microvascular endothelial cells. Int. J. Med. Microbiol.296, 553–558. doi: 10.1016/j.ijmm.2006.06.006
37
ParikhS. R.CampbellH.BettingerJ. A.HarrisonL. H.MarshallH. S.Martinon-TorresF.et al. (2020). The everchanging epidemiology of meningococcal disease worldwide and the potential for prevention through vaccination. J. Infect.81, 483–498. doi: 10.1016/j.jinf.2020.05.079
38
PetersS.SchlegelJ.BecamJ.AvotaE.SauerM.Schubert-UnkmeirA. (2019). Neisseria meningitidis type IV pili trigger Ca2+-dependent lysosomal trafficking of the acid sphingomyelinase to enhance surface ceramide levels. Infection Immun.87 (8), IAI.00410–00419. doi: 10.1128/IAI.00410-19
39
PrinceS. M.AchtmanM.DerrickJ. P. (2002). Crystal structure of the OpcA integral membrane adhesin from Neisseria meningitidis. Proc. Natl. Acad. Sci. U.S.A.99, 3417–3421. doi: 10.1073/pnas.062630899
40
PrincipatoS.PizzaM.RappuoliR. (2020). Meningococcal factor H binding protein as immune evasion factor and vaccine antigen. FEBS Lett.594, 2657–2669. doi: 10.1002/1873-3468.13793
41
PujolC.EugeneE.de Saint MartinL.NassifX. (1997). Interaction of Neisseria meningitidis with a polarized monolayer of epithelial cells. Infect. Immun.65, 4836–4842. doi: 10.1128/iai.65.11.4836-4842.1997
42
RhoH. W.LeeB. C.ChoiE. S.ChoiI. J.LeeY. S.GohS. H. (2010). Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR. BMC Cancer10, 240. doi: 10.1186/1471-2407-10-240
43
Sa E. CunhaC.GriffithsN. J.VirjiM. (2010). Neisseria meningitidis Opc invasin binds to the sulphated tyrosines of activated vitronectin to attach to and invade human brain endothelial cells. PloS Pathog.6, e1000911. doi: 10.1371/journal.ppat.1000911
44
SarkariJ.PanditN.MoxonE. R.AchtmanM. (1994). Variable expression of the Opc outer membrane protein in Neisseria meningitidis is caused by size variation of a promoter containing poly-cytidine. Mol. Microbiol.13, 207–217. doi: 10.1111/j.1365-2958.1994.tb00416.x
45
SeilerA.ReinhardtR.SarkariJ.CaugantD. A.AchtmanM. (1996). Allelic polymorphism and site-specific recombination in the opc locus of Neisseria meningitidis. Mol. Microbiol.19, 841–856. doi: 10.1046/j.1365-2958.1996.437970.x
46
ShenB. Q.FinkbeinerW. E.WineJ. J.MrsnyR. J.WiddicombeJ. H. (1994). Calu-3: a human airway epithelial cell line that shows cAMP-dependent Cl- secretion. Am. J. Physiol.266, L493–L501. doi: 10.1152/ajplung.1994.266.5.L493
47
ShengY. H.HasnainS. Z. (2022). Mucus and mucins: the underappreciated host defence system. Front. Cell Infect. Microbiol.12. doi: 10.3389/fcimb.2022.856962
48
ShiehJ. M.TsaiY. J.TsouC. J.WuW. B. (2014). CXCL1 regulation in human pulmonary epithelial cells by tumor necrosis factor. Cell Physiol. Biochem.34, 1373–1384. doi: 10.1159/000366344
49
ShuterJ.HatcherV. B.LowyF. D. (1996). Staphylococcus aureus binding to human nasal mucin. Infect. Immun.64, 310–318. doi: 10.1128/iai.64.1.310-318.1996
50
SilvaS.BickerJ.FalcãoA.FortunaA. (2023). Air-liquid interface (ALI) impact on different respiratory cell cultures. Eur. J. Pharm. Biopharm184, 62–82. doi: 10.1016/j.ejpb.2023.01.013
51
SorianiM. (2017). Unraveling Neisseria meningitidis pathogenesis: from functional genomics to experimental models. F1000Res6, 1228. doi: 10.12688/f1000research.11279.1
52
SorianoL.KhalidT.O'BrienF. J.O'LearyC.CryanS. A. (2021). A tissue-engineered tracheobronchial in vitro co-culture model for determining epithelial toxicological and inflammatory responses. Biomedicines9, 631. doi: 10.3390/biomedicines9060631
53
StarnerT. D.BarkerC. K.JiaH. P.KangY.PaulB.McCrayJ. (2003). CCL20 is an inducible product of human airway epithelia with innate immune properties. Am. J. Respir. Cell Mol. Biol.29, 627–633. doi: 10.1165/rcmb.2002-0272OC
54
StebbinsM. J.WilsonH. K.CanfieldS. G.QianT.PalecekS. P.ShustaE. V. (2016). Differentiation and characterization of human pluripotent stem cell-derived brain microvascular endothelial cells. Methods101, 93–102. doi: 10.1016/j.ymeth.2015.10.016
55
SutherlandT. C.QuattroniP.ExleyR. M.TangC. M. (2010). Transcellular Passage of Neisseria meningitidis across a Polarized Respiratory Epithelium. Infection Immun.78, 3832–3847. doi: 10.1128/IAI.01377-09
56
TeoS. M.MokD.PhamK.KuselM.SerralhaM.TroyN.et al. (2015). The infant nasopharyngeal microbiome impacts severity of lower respiratory infection and risk of asthma development. Cell Host Microbe17, 704–715. doi: 10.1016/j.chom.2015.03.008
57
TerraV. S.ZhiX.KahyaH. F.AndrewP. W.YesilkayaH. (2016). Pneumococcal 6-phospho-β-glucosidase (BglA3) is involved in virulence and nutrient metabolism. Infect. Immun.84, 286–292. doi: 10.1128/IAI.01108-15
58
TettelinH.NelsonK. E.PaulsenI. T.EisenJ. A.ReadT. D.PetersonS.et al. (2001). Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science293, 498–506. doi: 10.1126/science.1061217
59
ThomasV. L.SanfordB. A.RamsayM. A. (1993). Calcium- and mucin-binding proteins of staphylococci. J. Gen. Microbiol.139, 623–629. doi: 10.1099/00221287-139-3-623
60
TobiasonD. M.SeifertH. S. (2001). Inverse relationship between pilus-mediated gonococcal adherence and surface expression of the pilus receptor, CD46. Microbiology147, 2333–2340. doi: 10.1099/00221287-147-8-2333
61
TsangR. S.DeeksS. L.WongK.Marchand-AustinA.JamiesonF. B. (2016). Invasive serogroup W Neisseria meningitidis (MenW) in Ontario, Canada shows potential clonal replacement during the period January 1, 2009 to June 30, 2016. Can. Commun. Dis. Rep.42, 263–266. doi: 10.14745/ccdr.v42i12a06
62
TuQ. V.McGuckinM. A.MendzG. L. (2008). Campylobacter jejuni response to human mucin MUC2: modulation of colonization and pathogenicity determinants. J. Med. Microbiol.57, 795–802. doi: 10.1099/jmm.0.47752-0
63
UnkmeirA.LatschK.DietrichG.WintermeyerE.SchinkeB.SchwenderS.et al. (2002). Fibronectin mediates Opc-dependent internalization of Neisseria meningitidis in human brain microvascular endothelial cells. Mol. Microbiol.46, 933–946. doi: 10.1046/j.1365-2958.2002.03222.x
64
van der VaartJ.CleversH. (2021). Airway organoids as models of human disease. J. Intern. Med.289, 604–613. doi: 10.1111/joim.13075
65
van SorgeN. M.EbrahimiC. M.McGillivrayS. M.QuachD.SabetM.GuineyD. G.et al. (2008). Anthrax toxins inhibit neutrophil signaling pathways in brain endothelium and contribute to the pathogenesis of meningitis. PloS One3, e2964. doi: 10.1371/journal.pone.0002964
66
VirjiM.EvansD.HadfieldA.GrunertF.TeixeiraA. M.WattS. M. (1999). Critical determinants of host receptor targeting by Neisseria meningitidis and Neisseria gonorrhoeae: identification of Opa adhesiotopes on the N-domain of CD66 molecules. Mol. Microbiol.34, 538–551. doi: 10.1046/j.1365-2958.1999.01620.x
67
VirjiM.MakepeaceK.FergusonD. J.AchtmanM.SarkariJ.MoxonE. R. (1992). Expression of the Opc protein correlates with invasion of epithelial and endothelial cells by Neisseria meningitidis. Mol. Microbiol.6, 2785–2795. doi: 10.1111/j.1365-2958.1992.tb01458.x
68
VirjiM.MakepeaceK.MoxonE. R. (1994). Distinct mechanisms of interactions of Opc-expressing meningococci at apical and basolateral surfaces of human endothelial cells; the role of integrins in apical interactions. Mol. Microbiol.14, 173–184. doi: 10.1111/j.1365-2958.1994.tb01277.x
69
VirjiM.MakepeaceK.PeakI. R.FergusonD. J.JenningsM. P.MoxonE. R. (1995). Opc- and pilus-dependent interactions of meningococci with human endothelial cells: molecular mechanisms and modulation by surface polysaccharides. Mol. Microbiol.18, 741–754. doi: 10.1111/j.1365-2958.1995.mmi_18040741.x
70
von PapenM.OosthuysenW. F.BecamJ.ClausH.Schubert-UnkmeirA. (2016). Disease and carrier isolates of neisseria meningitidis cause G1 cell cycle arrest in human epithelial cells. Infect. Immun.84, 2758–2770. doi: 10.1128/IAI.00296-16
71
WhittakerR.DiasJ. G.RamlidenM.KödmönC.EconomopoulouA.BeerN.et al. (2017). The epidemiology of invasive meningococcal disease in EU/EEA countries 2004-2014. Vaccine35, 2034–2041. doi: 10.1016/j.vaccine.2017.03.007
72
WiddicombeJ. H. (2002). Regulation of the depth and composition of airway surface liquid. J. Anat201, 313–318. doi: 10.1046/j.1469-7580.2002.00098.x
73
YamamotoK.AhyiA.-N. N.Pepper-CunninghamZ. A.FerrariJ. D.WilsonA. A.JonesM. R.et al. (2014). Roles of lung epithelium in neutrophil recruitment during pneumococcal pneumonia. Am. J. Respir. Cell Mol. Biol.50, 253–262. doi: 10.1165/rcmb.2013-0114OC
74
YazdankhahS. P.CaugantD. A. (2004). Neisseria meningitidis: an overview of the carriage state. J. Med. Microbiol.53, 821–832. doi: 10.1099/jmm.0.45529-0
75
ZaninM.BaviskarP.WebsterR.WebbyR. (2016). The interaction between respiratory pathogens and mucus. Cell Host Microbe19, 159–168. doi: 10.1016/j.chom.2016.01.001
Summary
Keywords
Neisseria meningitidis, clonal complexes, transmigration, air-liquid-interface, epithelial barrier
Citation
Peters S, Mohort K, Claus H, Stigloher C and Schubert-Unkmeir A (2024) Interaction of Neisseria meningitidis carrier and disease isolates of MenB cc32 and MenW cc22 with epithelial cells of the nasopharyngeal barrier. Front. Cell. Infect. Microbiol. 14:1389527. doi: 10.3389/fcimb.2024.1389527
Received
21 February 2024
Accepted
12 April 2024
Published
02 May 2024
Volume
14 - 2024
Edited by
Mathieu Coureuil, Institut National de la Santé et de la Recherche Médicale (INSERM), France
Reviewed by
Federico Iovino, Karolinska Institutet (KI), Sweden
Nathan Weyand, Ohio University, United States
Jennifer L. Edwards, The Ohio State University, United States
Updates

Check for updates
Copyright
© 2024 Peters, Mohort, Claus, Stigloher and Schubert-Unkmeir.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Alexandra Schubert-Unkmeir, aunkmeir@hygiene.uni-wuerzburg.de
†These authors have contributed equally to this work and share first authorship
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.