AUTHOR=Zhang Lily , Mao Xiao , Long Hongyu , Xiao Bo , Luo Zhaohui , Xiao Wenbiao , Jin Xingbing 

TITLE=Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia

JOURNAL=Frontiers in Genetics

VOLUME=Volume 11 - 2020

YEAR=2020

URL=https://www.frontiersin.org/journals/genetics/articles/10.3389/fgene.2020.00564

DOI=10.3389/fgene.2020.00564

ISSN=1664-8021

ABSTRACT=Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies (IGDs) are a new subclass of congenital disorders of glycosylation (CDGs). Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (IS), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia and intellectual disability, whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS(MIM: 610271) : c.148C>T(p. Gln50*) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG(p.Asp381_Val388dup). Flow-cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs.  This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes, and reviews the clinical features of PIGS-associated disorders.