Galleria mellonella larvae were acquired from Petco and Manduca sexta from DBDPet. Fly stocks were maintained on a cornmeal-soy-based diet (Meidi laboratories) with added baker's yeast and incubated at 25°C on a 12-h day-night cycle. The Drosophila melanogaster lines used included Oregon R for P. luminescens survival experiments, phagocytosis assays, and gene expression analyses, w¹¹¹⁸ for survival experiments with triple-concentrated ES product and Escherichia coli co-injections, Rel^E20 for the E. coli co-injection assays, and the Diptericin(Dpt)-GFP line T4202 (III) for the transcriptional activation assay. Bacterial strains included Photorhabdus luminescens subspecies laumondii, strain TT01, the E. coli strain K12, and the RET16 derivative of the Photorhabdus temperata strain NC1. Photorhabdus strains were cultured on MacConkey Agar (Sigma) at 28°C for a period of 48 h at which point a single colony was used to inoculate an overnight liquid culture in 10 mL of Lysogeny Broth (LB) media (VWR) incubated at 28°C in a rotary shaker set to 220 rpm. E. coli was cultured in a similar fashion, but initial growth on agar was carried out on LB agar at 37°C overnight.

Infective juveniles of the rhabditid nematode Heterorhabditis bacteriophora strain TT01 were maintained axenically through propagation in G. mellonella larvae carrying well-established infections of RET16. To establish the infection, 1 mL of an overnight RET16 culture was centrifuged for 3 min at 13,000 × g, the supernatant discarded, and the pellet washed once with sterile phosphate buffered saline (PBS). The resulting bacterial suspension was centrifuged again and resuspended, at which point the suspension was diluted 1:10 with sterile PBS, to a final volume sufficient for the injection of 50 μL of bacterial solution into the desired number of 5th to 6th instar G. mellonella larvae. To perform larval injections, G. mellonella larvae were surface-sterilized by brief submersion in a 70% solution of ethanol. The larvae were placed on ice for a period of 20 min in a 100 × 15 mm petri dish furnished with moistened 90 mm filter paper. Injections were performed with a 1 mL tuberculin syringe and 22G needle inserted in the intersegmental region at as shallow an angle as possible. Larvae were left on ice for 5 min post-injection and then kept at room temperature for 1 week. Successful RET16 infection caused the larva to die and turn the brick red color typical of a Photorhabdus infection. Those that did not display the appropriate color were discarded. After 1 week, H. bacteriophora IJs were pelleted, surface sterilized with a 3% bleach solution for 5 min, and washed twice with sterile water prior to their liberal application onto the infected G. mellonella at a concentration of ~500 IJs per larva. This secondary infection was allowed to progress in the dark at room temperature for 8 days at which point the larvae were transferred to white traps for the collection of emerging IJs in autoclaved water supplemented with 0.01% Tween 20 (19). To confirm that the IJs were axenic, an aliquot of the surface-sterilized, putatively axenic IJs was used to infect G. mellonella larvae, and the larvae monitored for coloration indicative of an infection and support for the growth and reproduction of the IJs. IJs were considered axenic if they failed to produce red pigmentation in larvae or propagate successfully as compared to a surface-sterilized symbiotic IJ control.

Approximately 500 μL of raw hemolymph was collected from each 5th instar Manduca sexta larvae. Prior to extraction, each larva was placed on ice for a period of 20 min. The area surrounding the posterior horn of the insect was treated with a 70% alcohol wipe just prior to the severing of the horn with microdissection scissors. This was performed directly over a 1.5 mL autoclaved microcentrifuge tube, as the release of hemolymph from the site of injury is rapid and immediate. To prevent melanization, an aliquot of 20 mM phenylthiourea dissolved in PBS was added to each aliquot of hemolymph to a final concentration of 0.33 mM. The extracted hemolymph was centrifuged for 5 min at 4000 × g and 500 μL of the resulting supernatant was added to 500 μL of ice-cold Ringer's buffer (100 mM NaCl, 1.8 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 5 mM HEPES adjusted to a pH of 6.9) in a separate sterile 1.5 mL microcentrifuge tube. For long-term storage, samples were frozen at −80°C. Before use, hemolymph was thawed on ice, diluted 1:1 in ice-cold Ringer's buffer, and filtered with a 0.45 μm syringe filter. Ampicillin and kanamycin were added to diluted hemolymph plasma solutions at concentrations of 100 and 50 μg/mL, respectively.

Prior to activation, IJs were sedimented in aliquots of 200,000 and surface-sterilized with 3% commercial bleach in 10 mL of 0.01% Tween 20, resulting in a final hypochlorite concentration of 0.26%. Bleach-treated IJs were pelleted by centrifugation for 30 s at 1300 × g and washed twice with sterile Ringer's solution containing 0.01% Tween 20. After the second wash step, IJs were pelleted and resuspended in either 10 mL of the 25% hemolymph plasma solution (activated) or 10 mL of Ringer's-Tween (non-activated) containing antibiotics. The IJ suspensions were transferred to T75 tissue culture flasks, which were subsequently wrapped in foil and placed in a shaking incubator at 27°C and 200 RPM. Following a 20-h incubation, the IJs were transferred to 15 mL conical tubes, centrifuged, and washed 10 times with 10 mL of Ringer's-Tween 20 solution. Following the final wash, the IJs were resuspended in 10 mL of Ringer's solution without Tween 20. These tubes were wrapped in foil and returned to the incubator for 5-h at 27°C and 200 RPM to collect ES products. After incubation, the supernatants were removed and placed in a separate sterile 15 mL conical tube. The collected ES products were either stored at −80°C or immediately concentrated. To concentrate the collected products, ES products were filtered through a 0.2 μm low protein-binding syringe filter (Millex) and transferred to a new sterile 15 mL conical tube. Filtered products were added to a Vivaspin 6 tube (GE Healthcare) with a 3 kDa molecular weight cutoff, with aliquots of each treatment being added sequentially to the tube as sufficient volumes of solution cleared the filter. Concentration was allowed to continue until the volume of the retentate fell below 100 μL, at which point the solution was collected and supplemented with additional sterile Ringer's buffer to a final volume of 100 μL. For the triple-concentration of ES products, the same protocol was followed except that the ES products were initially distributed between two Vivaspin tubes, and the final 500 μL from each tube pooled and concentrated in a single tube until the volume was below 100 μL. ES concentrations were expressed as larval equivalents (LE/μL) by dividing the number of IJs used by the final volume of ES products.

Protein concentration of the ES products was quantified using a Pierce BCA Protein Assay Kit (Thermo Scientific) according to the manufacturer's instructions. For samples that produced a readable concentration of protein above the threshold sensitivity of the BCA assay, 6 μg of protein were loaded into a Novex WedgeWell 4–20% Tris-Glycine Gel (Invitrogen) following reduction in 50 mM DTT. For samples not producing a readable signal for protein concentration, the maximum volume was added to the gel. The final volume added to each well-included 26 μL of sample and water, 4 μL of the reducing agent, and 10 μL of Laemmli buffer. Protein size was demarcated with PageRuler Plus Prestained Protein Ladder (Thermo Scientific) and gels were stained with a Pierce Silver Stain for Mass Spectrometry kit (Thermo Scientific).

For survival and gene expression analyses, treatments were loaded into an oil-filled pulled glass capillary mounted on a Drummond Nanoject III Programmable Nanoliter Injector. Adult flies aged seven to 10 days were anesthetized with carbon dioxide and injected intramesothoracially with 69.0 nL of ES products or buffer, corresponding to 138 IJ equivalents of ES products, or 414 for triple-concentrated products. Injected flies were returned to vials containing instant Drosophila medium (Carolina Biological) and kept at 25°C on a 12-h day-night cycle. Flies injected for gene expression analysis at a 6-h time point were consistently injected in the late morning to alleviate effects attributable to natural variability arising from the circadian cycle. Wandering 3rd instar larvae were injected with 50.2 nL of ES products, representing ~100 IJ equivalents. Each insect was washed once with Ringer's solution upon removal from their original vial. Larvae were anesthetized with carbon dioxide for ~2–3 min before transfer to moist filter paper for injection. In order to ensure accurate, consistent injections, larvae were secured at the posterior end with forceps and injected at a shallow angle in an intersegmental region of the dorsal side of the abdomen to avoid damage to the organs or imaginal discs. Larvae were returned to a fresh petri dish furnished with filter paper moistened with Ringer's solution and incubated under the same conditions.

At the indicated time points, five adult flies (three males and two females) or five larvae were collected in duplicate and total RNA was extracted using TRIzol reagent (Ambion, Life Technologies). Reverse transcription was carried out using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and 1 μg of RNA template. The subsequent RT-PCR reactions were performed in a CFX96 Real-Time System, C1000 Thermal Cycler. The reactions themselves consisted of 10 μL of GreenLink No-ROX qPCR Mix (BioLink), 40 ng of cDNA template, forward and reverse primers at a final concentration of 200 nM, and ultrapure water to a final volume of 20 μL. Cycle conditions were as follows: 95°C for 2 min, 40 repetitions of 95°C for 15 s followed by 61°C for 30 s, and then one round of 95°C for 15 s, 65°C for 5 s, and finally 95°C for 5 s. The primer sets used for amplification included those for Diptericin (F: 5′ GCTGCGCAATCGCTTCTACT 3′; R: 5′ TGGTGGAGTTGGGCTTCATG 3′), Cecropin (F: 5′ TCTTCGTTTTCGTCGCTCTC 3′; R: 5′ CTTGTTGAGCGATTCCCAGT 3′), Drosomycin (F: 5′ GACTTGTTCGCCCTCTTCG 3′; R: 5′ CTTGCACACACGACGACAG 3′), mcf1 (F: 5′ AAGGAGGTCAATGCTCGCTAC 3′; R: 5′ GACACAACTAATCTGCCGTTCTC 3′), P. luminescens 16S rRNA (F: 5′ ACAGAGTTGGATCTTGACGTTACCC 3′; R: 5′ AATCTTGTTTGCTCCCCACGCTT 3′), and rp49 (F: 5′ GATGACCATCCGCCCAGCA 3′; R: 5′ CGGACCGACAGCTGCTTGGC 3′). Fold change was calculated using the 2^-ΔΔC method (20, 21) with all values being normalized to rp49. Graphs show fold change for each treatment over 0-h expression and error bars represent standard error applied to ΔΔCt values prior to conversion to a log scale. Statistical analysis was performed with a one-way ANOVA for ΔΔCt values accumulated from three biological replicates with two technical replicates each.

Larvae of the Dpt-GFP Drosophila line were injected with 50.2 nL of non-activated or activated ES products according to the aforementioned injection protocol. Following the 6-h incubation period, the fat body was dissected out of the insect, but left attached to the body while the gut was removed completely. Tissues were fixed in PBT (PBS containing 0.2% Triton X-1000) with 4% paraformaldehyde for a period of 30 min. Three 10-min washes in PBT were performed followed by a 30-min incubation with TRITC (Molecular Probes) diluted 1:100 in PBS. After washing once with PBS, the fat body tissues were removed from the insect carcass, cut into pieces small enough to lie flat on a slide, and mounted with Antifade mounting medium with DAPI (Molecular Probes). Images were acquired with a Zeiss LSM 510 confocal microscope and corrected total fluorescence measurements were processed for isolated green channels using ImageJ software. Ten images were analyzed per treatment for each trial.

Co-injection solutions were prepared by mixing ES products and bacterial suspensions such that each injection contained 310 larval equivalents of ES products and either ~ 8 × 10⁴ CFUs of E. coli or 50 CFUs of P. luminescens. This was achieved by diluting cultures of E. coli (OD600 of 3.0) or P. luminescens (OD600 of 0.4) 1:4 in the triple-concentrated ES products. All solutions were mixed immediately prior to use and injected using the same injection protocol. For consistency, control treatments were likewise comprised of PBS diluted 1:4 in Ringer's solution.

Phagocytic activity was assessed by measuring fluorescence following the injection of pHrodo Red E. coli BioParticles Conjugate for Phagocytosis (Molecular Probes). A 4 mg/mL suspension of pHrodo particles was diluted 1:4 in ES products such that each co-injection contained 310 larval equivalents in a 1 mg/mL solution of pHrodo particles. Upon injection, flies were incubated at 25°C for 1 h at which time the dorsal side of the abdomen associated with the pericardial nephrocytes was imaged using a Nikon ECLIPSE Ni microscope at 10x magnification with a Zyla (ANDOR) 5.5 camera. Corrected total fluorescence was measured using ImageJ software.

All statistical analyses were performed using GraphPad Prism 5 software. Gene expression analyses and CTF measurements for the phagocytosis assay were compared using a one-way ANOVA and Bonferroni multiple comparisons test to determine differences between specific treatments. Significance for CTF measurements for the Dpt-GFP assay was determined with a Student's t-test, and survival curves were assessed using a Log-Rank (Mantel-Cox) test. All analyses were performed on data accumulated through three independent experiments.

To investigate the proteins secreted in response to host stimulus, groups of 200, 100, or 25 thousand (k) H. bacteriophora IJs were activated as previously described (11). IJs were activated for 20 h by incubation in 25% Manduca sexta hemolymph diluted in Ringer's buffer, washed several times, and transferred into fresh Ringer's buffer without hemolymph to collect ES products. This activation time point was selected based on preliminary experiments in order to optimize as closely as possible an in vitro activation that may be only minimally informed by knowledge of in vivo activation kinetics. Filtered collection buffer was subsequently concentrated by ultrafiltration through a 3 kDa cutoff membrane, which restricts the analysis to proteins rather than small molecules. Activated batches of 200, 100, and 25 k IJs yielded 286, 216, and 39 ng/μL of protein, respectively, whereas protein was undetectable in ES products collected from similar numbers of non-activated IJs incubated in Ringer's throughout. To visualize proteins present in the ES products, 6 μg of activated ES products were separated by SDS-PAGE and silver stained (Figure 1). The maximum volume of non-activated ES products (26 μl) were used because protein was undetectable. A comparison of the lanes shows that certain species of protein are unique to the ES products of activated nematodes, with two conspicuous examples in the activated 200 K lane at estimated molecular weights of 21.2 and 18.9 kDa. Importantly, these proteins are absent from the M. sexta hemolymph, confirming that the extensive washes following the 20-h incubation removed residual hemolymph. This indicates that H. bacteriophora IJs specifically release a unique suite of proteins in response to hemolymph exposure.

The effects of concentrated ES products on the immune response of Drosophila were first examined in the context of the antimicrobial peptide (AMP) response. Imd and Toll pathway activity was assessed in flies by examining the expression of Diptericin and Drosomycin, respectively, following the injection of 69.0 nL of the highest concentration of ES products, a volume equivalent to the excretory/secretory output of 138 IJ. Expression was also assessed in larvae though with a lower injection volume of 50.2 nL, corresponding to ~100 IJ equivalents. Both adult flies and larvae were collected at a 6-h time point following ES injection, which was chosen to capture expression during peak Imd activity. Drosomycin transcript, as measured by qPCR, was not significantly altered by the injection of activated or non-activated ES products, and notably the products also failed to elicit a response at the 24-h time point known to correlate to peak Toll pathway activity (data not shown). Conversely, Diptericin was significantly upregulated by injection of non-activated ES products compared to the Ringer's buffer control injection. However, injection of activated ES products failed to increase diptericin expression above the Ringer's buffer control injection, suggesting the presence of suppressive or non-immunogenic components in activated ES (Figure 2). This pattern was observed in both adult flies and larvae, though on a slightly larger scale through all three treatments in larvae, possibly due to the primary immune organ, the fat body, being proportionally larger relative to body size in larvae. The immune response to a nematode infection minimally includes a strong Imd response, which is apparent through Diptericin expression, and the H. bacteriophora countermeasures to this activity are clearly capable of neutralizing the effect to levels associated with mere injury rather than infection.

To more precisely describe the effects of ES products on the regulation of Diptericin, larvae of a Drosophila line carrying GFP under the control of the Diptericin promoter were injected with ~100 IJ equivalents of either activated or non-activated products, and collected for observation at a 6-h time point. The fat body was dissected and imaged by confocal microscopy at 40x magnification. Fluorescence was clearly visible in all samples, though on average fat body samples that had been exposed to non-activated products were substantially brighter than those treated with activated ES products. This observation was confirmed by corrected total fluorescence (CTF) measurements of isolated green channels for each image (Figure 3). Because fluorescence is a measure of promoter activation, the specific interaction that mediates the differential responses to activated and non-activated ES products can be posited to take place either at or upstream of transcriptional activation. These measurements also confirm that the differences seen in Diptericin expression are mediated at least in part by cells of the fat body.

While the activated ES products clearly do not provoke as strong a Diptericin response as the non-activated products, the relative equivalence of the responses to Ringer's buffer and activated ES products makes it impossible to determine whether the activated nematode is secreting factors that suppress immunity or simply eliminating the production of factors that are immunogenic in the host. In an attempt to resolve this ambiguity, three separate batches of ES products produced with 200,000 IJs were concentrated together such that suppressive effects would be stronger, but the absence or masking of immunogenic compounds would not have compounding effects on Diptericin expression to limit upregulation below that evoked by a control injection. The increased potency of these products was immediately apparent, as injection of 414 IJ equivalents resulted in ~70% mortality over a period of 6 h (Figure 4). Flies that survived the injection at the 6-h time point were collected and Diptericin transcript levels measured. The 3x concentrated ES products significantly decreased the Diptericin response below that of the Ringer's buffer alone (Figure 5A), thus indicating that H. bacteriophora secretes factors capable of the specific suppression of Diptericin upregulation. The specificity of Diptericin suppression was examined by assessing the response of a second Imd-responsive AMP, Cecropin, as well as the Toll pathway AMP Drosomycin to the concentrated activated ES products. Injection of 414 IJ equivalents had no effect on either Cecropin (Figure 5B) or Drosomycin (Figure 5C) expression in adult flies.

While the specific suppression of Diptericin is significant, this result does not allow conclusions about whether the ES products released by H. bacteriophora are sufficiently immunosuppressive to augment a bacterial infection. To explore this possibility, adult flies were co-injected with a high inoculum of Escherichia coli (8 × 10⁴ CFUs) and ~310 IJ equivalents of activated ES products, non-activated ES products, or an equivalent volume of Ringer's buffer. Tracking mortality every 12 h for a period of 72 h revealed that while Ringer's buffer or non-activated ES products co-injected with E. coli were not lethal to flies, the injection of activated products and E. coli together (A+Ec) resulted in ~50% mortality in the first 24 h (Figure 6). Notably, this reduced dose (310 vs. the lethal 414 IJ equivalents) of activated ES products no longer induces mortality, so the observed decrease in survival cannot be attributed to the previously noted lethality stemming from the products alone.

In the context of a natural H. bacteriophora infection, the bacteria of interest would be the natural symbiont of the nematode, Photorhabdus luminescens. The bacteria are released from the gut of the IJ shortly after entry into the hemolymph, and the possibility exists that the ES products may serve in part to prepare the hemolymph environment for a more successful infection by P. luminescens. This possibility was tested by similarly co-injecting adult flies with ~310 IJ equivalents of ES products or an equivalent volume of Ringer's buffer and 50 cells of P. luminescens. Time points were at 12 h, then every hour from 24 to 33 h, in order to capture the majority of mortality, and then once again at 48 h. Survival curves revealed a slightly protective effect imparted by the non-activated ES products relative to the control injection, and when compared to co-injections with activated ES products, the lethality produced by the activated ES products and P. luminescens was significantly different from and effected earlier than that produced by the non-activated ES product co-injections (Figure 7). Even at a sublethal dose, the ES products of H. bacteriophora are sufficiently immunosuppressive to negatively impact the AMP response and to enhance the virulence of a bacterial infection.

The delay in the onset of mortality for populations of flies co-injected with ES products and P. luminescens (Figure 7) demonstrates that this mortality initiated by Photorhabdus requires an accumulation of bacteria beyond the initial inoculum. To test whether the influence of activated ES products is capable of accelerating this accumulation, the co-injections of ES products and Photorhabdus were repeated under the same conditions and surviving flies were collected at a 14-h time point for the assessment of relative bacterial growth, as measured by RT-qPCR targeting the P. luminescens 16S rRNA and mcf1 genes. Subsequent analysis of expression for both genes revealed that bacterial proliferation is significantly higher in the presence of activated ES products, which supported an ~100-fold transcript increase for each gene (Figure 8). Those treated with either Ringer's buffer or non-activated products showed increases between 3- and 10-fold for the same genes. This difference in bacterial survival and proliferation is therefore likely responsible for the ~12-h decrease in the time to mortality onset for flies co-injected with activated ES products as compared to those injected with non-activated products.

Another possible mechanism causing increased mortality when flies are challenged simultaneously with activated nematode ES products and bacteria is interference with the normal activity of phagocytic hemocytes. To determine whether this effect is also contributing to the enhanced success of bacteria in ES-treated flies, adult D. melanogaster were co-injected with ~310 IJ equivalents of ES products or an equal volume of Ringer's buffer and pHrodo E. coli conjugates that fluoresce when engulfed by a phagocyte. CTF measurements of images captured with fluorescence microscopy showed that phagocytic activity around the pericardium, where the highest degree of activity is observed, is significantly elevated in flies co-injected with activated ES products (Figure 9). The immunosuppressive effect of the ES products is not mediated by the phagocytic response, and may in fact provoke more phagocytic activity. Despite this compensatory phagocytic response, the effects on AMP production or other systems are still potent enough to enhance a bacterial infection.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.