The 6–8-week-old female C57BL/6 mice were purchased from National Laboratory Animal Center. All animals were housed in Laboratory Animal Center of National Taiwan University College of Medicine under specific pathogen-free (SPF) condition. Water and food were provided sufficiently daily, and all mice were sacrificed by CO₂. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH). The protocol was approved by the Institutional Animal Care and Use Committee of National Taiwan University College of Medicine (Permit Number: 20190119).

Bone marrow cells were isolated from femur and tibia bones of mice with incomplete DMEM (Dulbecco's modification of Eagle's medium, Gibco, Darmstadt, Germany) by using 23G needles, and centrifuged at 4°C with 800 × g for 5 min. Red blood cells (RBC) were lysed by 900 μL RBC lysis buffer (10 mM Tris-HCl and 0.83% NH₄Cl in ddH₂O, pH 7.2) for 3 min on ice, and 100 μL 10X Dulbecco's phosphate-buffered saline (DPBS, Gibco) was added to cells. Cells were then centrifuged at 4°C with 800 × g for 5 min, and re-suspended with complete DMEM containing 10% fetal bovine serum (FBS, Corning, New York, United States), 1X penicillin/streptomycin (HyClone), 1X L-Glutamine (HyClone), 1X NEAA (non-essential amino acid, HyClone), 1X sodium pyruvate (HyClone), and 5 μM 2-Mercaptoethanol (2-ME, Thermo, Massachusetts, U.S.). 5 × 10⁶ cells or 2 × 10⁶ were seeded in 10-cm² petri dishes (α-Plus) or 6-well plates, respectively, at 37°C in 5% CO₂ incubator for 7 days. Cells were cultured in 20% L929 cell supernatant in complete DMEM. After culturing in 20% L929 cell supernatant for 7 days, bone marrow-derived macrophages (BMDMs) were collected by trypsinization and further seeded in 12-well and 24-well plates (Thermo) at a density of 1 × 10⁶/mL and 5 × 10⁵/mL per well for Western blot and real-time PCR (qPCR) analysis, respectively. For macrophages polarization, BMDMs were treated with LPS (1,000 ng/mL, O111:B4 E. coli) and IFN-γ (20 ng/mL, Peprotech, New Jersey, USA) or IL-4 (20 ng/mL, Peprotech) and IL-13 (20 ng/mL, Peprotech) for M1 and M2 polarization, respectively. To isolate peritoneal macrophages, C57BL/6 mice were injected with 1 mL of sterile 3.8% thioglycollate medium by intraperitoneal injection. On day 4, mice were euthanized and peritoneal cells were collected via peritoneal lavage with 5 ml sterile PBS. Cells were then spun down for 5 min at 800 × g, resuspended in complete RPMI and seeded 1 × 10⁶ cells/well in 12-well plate. After 24 h, the non-adherent cells were removed. Adherent cells were collected and stained with anti-CD11b and anti-F4/80 to confirm the macrophage population. M1/M2 polarization was defined by flow cytometry and qPCR. M1 dominant expression markers were CD86, Nos2 and Tnfa. M2 dominant expression markers were CD206, Arg1 and Egr2 (Supplementary Figure 1).

To stabilize Hif1α in M1 at normoxia condition (34), BMDMs were treated with 0.2 mM DMOG (Merck, Germany), a PHD inhibitor, and cell lysate was collected after DMOG treatment for 24 h. In some experiments, metformin and A-769662 (Merck), which enhance AMPK activation, were added to BMDMs to a final concentration of 10 and 20 μM, respectively, 30 min before LPS stimulation. On 24 h after treatment with metformin or A-769662, cell lysate was collected.

pcDNA3.1 which carried mouse Ak4 open reading frame (ORF) with flag tag (CloneID: OMu1602) was purchased from Genscript. Ak4 ORF with flag tag was amplified by PCR, and then purified by gel extraction kit (Geneaid, Taiwan, ROC). PCR product was constructed into pWPI lentiviral vector at SwaI site by Genbuilder cloning kit (Genscript, Piscataway Township, USA). The final construct was confirmed by DNA sequencing. The primer sequences are listed in Table 1.

Lentiviral constructs carry GFP and Ak4 (TRCN0000345103; 5′CTGTGATGTGGACCTAGTAA T3′) or Hif1α (TRCN0000232222; 5′TGGATAGCGATATGGTCAATG3′) shRNA were purchased from Academia Sinica, ROC. The plasmids amplifications were followed by Academia Sinica's protocol. Plasmids psPAX2, pMD2.G and target plasmid including pWPI lentiviral plasmid carry Ak4 were co-transfected into HEK293T cells with Lipofectamin 3000 (Invitrogen). The supernatant was condensed with 0.4 M NaCl and 8.5% PEG6000 at 4°C overnight (O/N). The viruses were spun down by 7,000 × g at 4°C for 20 min, re-suspended in dPBS containing 2%FBS and HBSS (Gibco), and stored in −80°C. Lentiviral transduction was conducted in serum free medium containing 20% L929 supernatant with 8 μg/ml polybrene at day 3 of BMDM culture (MOI = 30). The medium containing lentivirus and polybrene was replaced with complete medium containing 20% L929 supernatant at day 4. The infected BMDMs were polarized into M1 or M2 macrophages. GFP⁺ cells were sorted out for RNA-Sequencing, qPCR, ATP, and ADP/ATP assay after M1 polarization for 24 h.

BMDMs were collected after culture bone marrow cells in 20% L929 supernatant for 7 days. Cells were washed twice with PBS and rested in complete medium for 3 h. Ak4 siRNA or AMPKα1/2 siRNA in 50 nM was transfected into BMDMs with Lipofectamin 3000 (thermo) for 24 h before LPS/IFN-γ stimulation. To knockdown Ak4 in peritoneal macrophage, after removing the non-adherent cells, 50 nM Ak4 siRNA were transfected into peritoneal macrophages with Lipofectamin 3,000 for 24 h before LPS/IFN-γ stimulation.

For real-time analysis of oxygen consumption rate (OCR) and extracellular acidification rate (ECAR), 10⁵ BMDMs were seeded in XF-96 cell culture plates, and stimulated with LPS/IFN-γ for 24 h. OCR and ECAR, which represent oxidative phosphorylation and glycolysis ability, respectively, were analyzed on XF-96 analyzer. For OCR analysis, 1 μM oligomycin, 2 μM fluoro-carbonyl cyanide phenylhydrazone (FCCP), and 100 nM rotenone plus 1 μM antimycin A (Rot/AA) were injected in sequence. For ECAR analysis, 60 mM glucose, 1 μM oligomycin, and 600 mM 2-deoxy-D-glucose (2-DG) were injected in sequence.

Total RNA was extracted from BMDMs using TRIzol reagent. RNA isolation kit, direct-zol RNA miniPrep (Zymo Research, Irvine, California, USA), was used according to the manufacturer's instruction. RNA was quantified with DS-II⁺ spectrophotometer (DeNoyix). The complementary DNA (cDNA) was generated using MMLV high performance reverse transcriptase (MMLV HP RT, Epicenter Biotechnologies, California, USA). Real-time PCR was performed on a PikoReal 96 Real-Time PCR System (Thermo Scientific) using SYBR green mixture (Bioline, London, UK). Relative expression of the target gene was normalized to Actb and calculated as 2^{–(Ct target–Ct β-actin)}. The Ct represents the threshold cycle for each target or reference gene determined by Thermo PikoReal Software 2.1. The relative target gene expression was calculated by using the 2^−ΔΔCt method. Sequences of primers used for quantitative real-time PCR were listed (Table 1).

In brief, 5 × 10⁵ BMDMs were seeded on 24-well plate after 7-days culture. For measuring cytosol and mitochondria ROS, CellRox and MitoSox probes were used, respectively, as manufacturer's protocol (Thermo Scientific). In brief, BMDMs were treated with LPS (1,000 ng/mL) and IFN-γ (20 ng/mL) for M1 polarization. Twenty-four hours later, M1 cells were washed with PBS two times and stained with CellRox or MitoSox diluted in staining buffer at 37°C for 15 min before analyzed by flow cytometry. To sort GFP⁺ cells, propidium iodide (PI, Biolegend) staining was used to identify viable cells. Samples were analyzed on LSR Fortessa (BD Biosciences, Franklin Lakes, New Jersey, USA) or sorted on FACSAriaIII and data were analyzed using FlowJo software.

Cells were lysed with RIPA (25 mM Tris-HCl pH7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate and 0.1% SDS) on ice for 30 min, and centrifuged at 4°C with 20,000 × g for 20 min for the supernatant. Total protein concentrations were measured with Protein Assay Dye (Thermo scientific). The samples were separated on 8 or 12% SDS-PAGE, and transferred to 0.22 μm PVDF membranes. The membranes were blocked with 5% skim milk, and probed with primary antibodies p-AMPK, AMPK (Cell signaling technology), iNOS, HIF1α, and Ak4 (GeneTex, Taiwan, ROC) at 4°C shaking O/N. The membranes were washed with TBST, and incubated in goat anti-rabbit secondary antibody with HRP conjugated (Abcam) for 1 h at room temperature. Membranes were soaked in enhanced chemiluminescent reagent (GE healthcare), exposed to film or iBright 1500 Western Blot Imaging Systems. The expression of protein was quantified by ImageJ or app in Thermo fisher website. α-Tubulin, β-Actin, or COX IV (Abcam) as an internal control was re-probed to PVDF membranes, after stripping.

Five hundred thousand BMDMs were seeded on 24-well plates the day prior to the experiment. E coli were added to BMDMs (MOI = 2 or 10) after the culture medium were changed to P/S-free DMEM. The plates were incubated at 37°C for 1 h. BMDMs were washed with PBS twice, changed to 100 μg/ml gentamicin-containing DMEM, and incubated at 37°C for 1 h. BMDMs were then lysed with 0.1% tritonX-100 and plated for phagocytosis assay. BMDMs were incubated at 37°C for another 4 h, then lysed with 0.1% tritonX-100 and plated for killing assay. Colony forming unit (CFU) was counted after 24 h incubation.

M1 cells were lysed with extraction buffer (1 M sucrose, 1 mM EGTA, 5 mM Tris-HCl pH 7.4). The process of Mitochondria extraction was performed following a published protocol (35). In brief, BMDMs (5 × 10⁷) were lysed with 3 ml extraction buffer (1 M sucrose, 1 mM EGTA, 5 mM Tris-HCl pH 7.4) on ice for 30 min. Cell lysate was centrifuged with 300 × g for 10 min. The supernatant was transferred into a new tube, and centrifuged with 7,000 × g for 10 min. The pellet was washed with 1 ml extraction buffer twice. Protein lysate (50 μg) was used for Western blot.

To measure IL-1β, IL-6, and TNF-α production, culture supernatants from BMDMs and peritoneal macrophages in 12-well plates were collected. Mouse IL-1β, IL-6, and TNF-α ELISA kit (Biolegend) was used following the manufacturer's instructions.

The amount of ATP and ADP/ATP were measured by ApoSENSOR Cell Viability Assay Kit and ApoSENSOR ADP/ATP Ratio Bioluminescent Assay Kit (BioVision, California, USA) following the manufacturer's instructions. In brief, to measure intracellular ATP, 5 × 10⁴ GFP⁺ M1 cells were lysed with 250 μl lysis buffer on ice for 5 min. ATP monitor enzyme and lysis buffer were pre-mixed and the background luminescence value was designated as A. Cell lysate (50 μl) was added to the pre-mixed well, then the luminescence reading was designated as B. ADP converting enzyme was added to the well, then the luminescence reading was designated as C. The value of intracellular ATP is (B-A). The value of intracellular ADP/ATP is (C-B)/(B-A). The tests were done in duplicates.

Total RNA was extracted from M1 cells and digested to 180 bp fragments after removing rRNAs with a Ribo-Zero Gold kit (Illumina, San Diego, USA). A sequencing library was created by reverse-transcription of RNA fragments to cDNA, and ligating specific adapters at both ends of these cDNA fragments. Next, the sequencing libraries were loaded to the surface of flow cells, and amplified into clonal clusters though bridge amplification. All of the clusters on the flow cell were sequenced by NextSeq 500 (Illumina). FastQC (v0.11.8) program (http://www.bioinformatics. babraham.ac.uk/projects/fastqc/) was used to examine the quality of sequencing reads, and HISAT2 (v2.1.0) was used to align sequencing reads to mouse genome references (GRCm38) (36). The output SAM files were normalized and quantified with R packages Rsubread (v 2.0.0) (37) and edgeR (v 3.28.0) (38) from Bioconductor. A robust normalization approach, the trimmed mean of M value (39), was applied and log₂-transformation was used to obtain the final expression values. In the differential gene expression analyses, Student's t-test (P < 0.01) and 2-fold changes were used to identify differentially expressed (DE) genes between Ak4 shRNA knockdown samples and scramble samples. The functional and pathway analyses for DE genes were further analyzed by Ingenuity Pathway Analysis (QIAGEN Inc., https://www.qiagenbioinformatics.com/products/ingenuity-pathway-analysis). All of the data have been deposited in Gene Expression Omnibus (GEO, GSE143302).

Statistical analyses were performed with unpaired, two-tailed Student's t-test or one-way ANOVA for multiple comparisons. A value of P < 0.05 was considered statistically significant.

To examine the expression of Ak family members in functional subsets of macrophages, we differentiated total bone marrow cells into macrophages (bone marrow-derived macrophage, BMDM) in 20% L929 conditioned medium for 7 days in vitro. BMDMs were subsequently left unstimulated (M0) or activated with LPS+IFN-γ (M1) or IL-4+IL-13 (M2) for 24 h. The mRNA expression of Ak family members among M0, M1 and M2 were analyzed by qPCR. While the expressions of Ak5, Ak7, and Ak9 were too low to be detected, that of Ak6 was comparable among M0, M1, and M2. Interestingly, the levels of Ak1, Ak2, Ak3, and Ak8 were higher in M2 than M1 cells. Notably, Ak4 was expressed almost exclusively in M1 cells and it located in mitochondria (Figure 1A; Supplementary Figure 2). Consistently, we found that Ak4 protein level in M1 macrophages was about two to three folds of that of M0 and M2 macrophages (Figure 1B). Moreover, we found that Ak4 expression was mainly induced by LPS stimulation. LPS and IFN-γ co-treatment further enhanced Ak4 expression in BMDMs (Figure 1C). These results suggest that Ak4 plays an important role in M1 macrophages. Therefore, we focus our study on characterizing the role of Ak4 in M1 macrophages.

To investigate the role of Ak4 in M1 macrophages, BMDMs were transduced with Ak4 shRNA or scramble lentivirus for 5 days followed by stimulation with LPS and IFN-γ for 24 h. Transduced cells were sorted for in vitro analysis. The transcript level of Ak4 was reduced by more than 80%, whereas the expression of other Aks was not affected by the Ak4 shRNA (Figure 1D). In addition, cellular ATP level was elevated and ADP/ATP ratio was reduced by Ak4 shRNA and Ak4 siRNA (Figure 1E; Supplementary Figure 3A). Moreover, cytosol and mitochondrial ROS production were decreased in Ak4 shRNA-treated M1 cells (Figure 1F). Phagocytosis and bacterial clearance are two major functions of macrophages. Killing of bacteria is mediated by ROS and NO (40, 41). We infected Ak4 shRNA- and scramble shRNA-treated BMDMs with E coli. While bacteria uptake was not altered by either scramble or Ak4 shRNA, bacteria clearance ability was reduced in Ak4 shRNA-treated BMDMs at both MOI 2 and 10 compared to scramble shRNA-treated BMDMs (Figure 1G). Interestingly, both glycolysis and glycolytic capacity decreased in Ak4 shRNA-treated M1 cells. By contrast, the oxygen consumption rate (OCR) was not affected by the Ak4 shRNA (Figure 1H). These data indicate that Ak4 plays a non-redundant role in maintaining the homeostasis of ATP and ROS, sustaining bactericidal ability, and promoting glycolysis in M1 macrophages.

IL-1β, IL-6, TNF-α, iNOS (encoded by Nos2), and Nox2 (encoded by Nox2) promote inflammatory responses to eradicate pathogens in M1 macrophage. Ak4 protein level was reduced in Ak4-silenced M1 cells (Figure 2A). Interestingly, the expressions of Il1b, Tnfa, and Il6 were also down-regulated in cells treated with Ak4 shRNA and siRNA (Supplementary Figures 3B,C,F,G). Silencing Ak4 by siRNA in LPS/IFN-γ-treated thioglycollate-elicited peritoneal macrophages also reduced Il1b, Tnfa, and Il6 transcripts (Supplementary Figure 3I). ELISA assay confirmed that silencing Ak4 reduced the protein levels of IL-1β, IL-6, and TNFα (Figure 2B; Supplementary Figure 3J). Moreover, Hif1a and Nos2 transcripts as well as iNOS, Nox2, and Hif1α proteins were reduced by Ak4 shRNA and Ak4 siRNA treatments (Supplementary Figures 3D,E,H; Figure 2C). The data suggest that Ak4 positively regulates the expression of pro-inflammatory cytokines, iNOS, Nox2, and Hif1α in M1 cells.

Hif1α reportedly up-regulates IL-1β and iNOS (42). In agreement with this report, we found that suppressing the expression of Hif1α with shRNA resulted in downregulation of IL-1β, IL-6, TNF-α, and iNOS (Supplementary Figures 4A–C). Reversely, treating M1 cells with dimethyloxalylglycine (DMOG), which is known to stabilize Hif1α protein even in normoxia conditions, had an opposite effect (Supplementary Figures 4D–F). Surprisingly, the expressions of Ak4 was down-regulated in Hif1α shRNA-treated M1 macrophages and up-regulated in M1 macrophages treated with DMOG (Figures 3A,B). These observations are consistent with published data showing that the expression of Ak4 increased under hypoxia environment (19) and strongly suggest that Ak4 and Hif1α form a positive feedback loop in M1 cells.

To investigate the role of the Ak4-Hif1α feedback loop in regulating the expression of inflammation genes in M1 cells, we transduced BMDMs with Ak4 shRNA or scramble shRNA for 5 days, then treated the cells with DMOG for 4 h before stimulation with LPS and IFN-γ. We found that DMOG restored the expression of Ak4, Hif1α, iNOS, Nox2, IL-1β, IL-6, and TNF-α in Ak4 shRNA-treated M1 cells (Figures 3C,D). Reversely, the effect of DMOG on the expression of Hif1α was much blunted by Ak4 shRNA.

Previous study has shown that AMPK activation is enhanced in A549 cell line by Ak4 shRNA treatment (19). Consistently, we found the level of p-AMPK was increased in Ak4 shRNA-treated M1 cells (Figure 4A). Treatment with A-769662 and metformin, two AMPK agonists, further reduced the expression of iNOS, IL-1β, IL-6, and TNF-α in Ak4 shRNA-treated cells (Figures 4B,C; Supplementary Figures 5A,B). Reversely, AMPKα1/2 siRNA blunted the effect of Ak4 shRNA (Figures 4B,C). While Ak4 promotes inflammatory genes by inhibiting AMPK activation, our study shows that AMPK agonists increase the level of Ak4 and silencing AMPKα1/2 reduces Ak4 expression (Figure 4B; Supplementary Figure 5A).

We subsequently examined the impact of Ak4 shRNA on the transcriptome of M1 macrophages. We stimulated the Ak4 shRNA- or scramble shRNA-transduced BMDMs with LPS and IFN-γ for 6 h. Total mRNAs were prepared from transduced cells and subjected to RNA-Seq. The Ak4 shRNA-transduced cells from thee independent experiments were transcriptomically segregated from scrambled shRNA-transduced cells in principal component analysis (PCA) (Figure 5A). Using a cut-off p-value of 0.01, fold-change (FC) > 2 or <1/2, we identified 145 genes, whose expression was enhanced, and 268 genes, whose expression was down-regulated by Ak4 shRNA treatment (Figures 5B–D). Interestingly, Il1b and Il6 were among the top 10 most down-regulated genes by Ak4 shRNA (Figure 2B; Supplementary Tables 1, 2). Analyses of the differentially regulated genes (DRGs) with Ingenuity Pathway Analysis (IPA) showed that the DRGs participated in Hif1α signaling, a finding consistent with the data shown in Figures 2, 3, adhesion and diapedesis, cytokine-mediated communication, and TLR signaling (Figure 5E; Table 2). However, Gene Set Enrichment Analysis (GSEA) analysis of the RNA-seq data failed to detect any significant change in the expression of genes regulating M1/M2 polarization (Supplementary Figures 6A,B). Subsequent qPCR analyses also demonstrated that Ak4 shRNA treatment of M1 cells had no consistent effect on the expression of M1 genes, such as Scos3 and Irf7, and M2 genes, such as Arg1, Egr2, Chil3, Rentla, Il10, Socs1, and Irf4 (Figure 6A). Moreover, Ak4 overexpression in M2 cells had no consistent effect on the expression of M1 genes, such as Nos2, Il6, Socs3, and Irf7, and M2 genes, such as Egr2, Chil3, Il10, Rentla, Arg1, and Irf4 (Figure 6B).

In conclusion, iNOS, Nox2, and pro-inflammatory cytokine, IL-1β, IL-6, and TNF-α expressions are regulated by Ak4-Hif1α and Ak4-AMPK bidirectional loops. Moreover, Ak4 mediates several pathways important for M1 function. However, Ak4 does not regulate M1/M2 polarization.