All subjects had a clinical diagnosis of asthma according to Global Initiative for Asthma (GINA) guidelines (18) that was supported by one or more of the following criteria: 1) variability in the maximum diurnal peak expiratory flow of >20% over the course of 14 days, 2) an increase in FEV1 of >15% after inhalation of 200-400 μg albuterol, or 3) a 20% reduction in FEV1 in response to a provocative concentration of inhaled methacholine (PC20 methacholine) of less than 10 mg/ml. All subjects underwent standardized assessments that included complete blood cell and differential counts, IgE measurement, chest posteroanterior radiography, allergy skin prick tests, and spirometry. Asthma exacerbation was defined as episodes of progressive increase in shortness of breath, cough, wheezing, or chest tightness, or some combination of these symptoms, accompanied by decreases in expiratory airflow and use of systemic corticosteroids (tablets, suspension, or injection), or an increase from a stable maintenance dose, for at least 3 days, and a hospitalization or emergency department visit because of asthma, requiring systemic corticosteroids. Normal control subjects were recruited from spouses of the subjects or members of the general population who answered negatively to a screening questionnaire regarding respiratory symptoms and other allergic diseases, had FEV1 values over 80% predicted, PC20 methacholine over 10 mg/ml, and normal findings on chest radiographs. The biospecimens and clinical data were provided by the biobank of Soonchunhyang University Bucheon Hospital, a member of the Korea Biobank Network. This study was approved by the Soonchunhyang University Bucheon Hospital Institutional Review Board (SCHBC 2020-05-038-003).

Primary normal human bronchial epithelial (NHBE) cells (CC-2540, Lonza, Walkersville, MD) (3500cells/cm²) were maintained as previously described (19). Cells were placed in bronchial epithelial cell growth medium (BEGM, CC-3170, Lonza) without supplements for 24 h and then stimulated with 10μg/ml Dermatophagoides pteronyssinus 1 (Der p1, Arthropods of Medical Importance Resource Bank, Institute of Tropical Medicine, Yonsei University). In separated tests, NHBE were transfected with small interfering RNA (siRNA) duplexes designed against Nectin4 or nonspecific siRNA control (1027418, Qiagen, CA, USA). NHBE cells cultured in 6-well plates were transfected with 100 nM siRNA or negative control using Lipofectamine 2000 (11668019, Invitrogen, CA, USA). After 24hr, cells were treated with 10 μg/ml Der p1 and harvested for western blotting. Trans-epithelial electrical resistance (TEER) was measured using an Epithelial Volt/Ohm Meter (EVOM) (EVOM2, World Precision Instruments, FL). TEER values are expressed by raw oh m values minus the oh m value of a blank insert, multiplied by the area of the insert (1.12 cm²).

All experimental animal methods followed a protocol approved by the Institutional Animal Care and Use Committee of the Soonchunhyang University Bucheon Hospital (SCHBC-animal-2020-11). Female 6-week-old BALB/c mice (n=6-10 mice per group) were sensitized by means of intraperitoneal injection at days 0 and 14 with 50 mg of grade V chicken egg OVA (A5503, Sigma-Aldrich, St Louis, Mo) that was emulsified in 10 mg of hydroxyl aluminum plus 100 mL of Dulbecco PBS. At days 21 to 23, all mice received intranasal challenges with 150 mg of grade III OVA (5378, Sigma-Aldrich) in 50 mL of Dulbecco PBS. Control mice were sensitized and challenged with saline. Airway hyperresponsiveness (AHR) was measured, bronchoalveolar lavage fluid (BALF) was collected, and lung tissue was processed for protein, RNA, and hematoxylin and eosin (H&E), periodic acid Schiff (PAS), Masson trichrome stain, and confocal imaging.

We purchased SpCas9 protein and sgRNAs to generate Nectin4 knockout mice from Macrogen, Inc. (Seoul, Korea). To knock out the Nectin4 gene (NC_000067.6), we designed six sgRNAs (1 (intron1-2-gR1), AGTGCA AGAGTAGCCCCAGA; 2 (intron1-2-gR2), AGGGGGACAGTCAGAACCAATGG; 3 (intron1-2-gR3), GCAAAGGCGGCCGGAACTTCTGG; 4 (intron7-8-gR1), GTGCTAAGGTTGGGTGCATGGGG; 5 (intron7-8-gR2), AGGTTGGGTGCATGGGGTCGGGG; 6 (intron7-8-gR3), TCGGGGGGACATGGGCACACAGG) and its 5′ upstream sequences of the Nectin4 gene and validated them using the T7E1 in vitro cleavage reaction of template DNAs, which were amplified by PCR (F1:5′-TGTCCTTGGTTTCCTGGTTC-3′ and R1: 5′-GGTTCACATGAAGCCCGTAT-3′, F2: 5′-GCATCACCTACCATGCACAC-3′ and R2: 5′-AGTGCAAGAGTAGCCCCAGA-3′). Briefly, the amplified template DNA was incubated for 90 min at 37°C with Cas9 protein (20 nM) and sgRNA (40 nM) in 1× NEB 3 buffer. Reactions were stopped with 6× stop solution containing 30% glycerol, 1.2% SDS, and 100 mM EDTA. Cleavage activity was confirmed by electrophoresis of the reaction mixture.

Nectin4 knockout mice were generated by Macrogen, Inc., and were interbred and maintained in a pathogen-free condition at Macrogen, Inc. (Seoul, Korea). All manipulations were conducted with the Institutional Animal Care and Use Committee approval. Briefly, pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) were injected into C57BL/6N female mice. After 48 h, these female mice were mated with C57BL/6N stud male mice. Next day, virginal plug-checked female mice were sacrificed and fertilized embryos were harvested. The mixture of sgRNA and SpCas9 protein was microinjected into one-cell embryos, and microinjected embryos were incubated at 37°C for 1–2 h. Then, 14 to 16 injected one-cell-stage embryos were transplanted into oviducts of pseudopregnant recipient mice (ICR). After F0 mice were born, genotyping was done by direct PCR and sequencing methods using tail-cut samples (Forward primer, 5′- TGTCCTTGGTTTCCTGGTTC-3′; and Reverse primer, 5′- AGTGCAAGAGTAGCCCCAGA-3′). Among of the founders with altered sequences, we selected F0 mice with deletion of exon2&7 sequences of Nectin4.

Genomic DNA was isolated from the lung tissues of each mouse using a QIAamp DNA mini Kit (51304, Qiagen, MD, USA). Genotyping was done by PCR amplification using the following primers: Forward primer, 5′- TGTCCTTGGTTTCCTGGTTC-3′; and Reverse primer, 5′- AGTGCAAGAGTAGCCCCAGA-3′. The PCR products were visualized by agarose gel electrophoresis; a 6203 bp fragment was amplified in the wild-type mice, and a 443 bp fragment in Nectin4-null mice.

Protein levels of Nectin4 (MBS167116, Mybiosource, CA, USA) in human plasma and IL-4 (M4000B, R&D System, MN, USA), IL-5 (M5000, R&D System), TNF-α (MTA00B, R&D System), IFN-γ (MIF00, R&D System) in mouse BALF and lung proteins were measured by ELISA. A low detection limits were set at 6.56pg/ml for Nectin4, respectively on the basis of the manufacturer’s recommendation.

All stains were performed in accordance with the manufacturer’s protocol. The degree of inflammatory cell infiltration in the airway stained with H&E was scored in a double-blind manner by 2 independent observers. The peribronchiolar/perivascular inflammation scores for each view-field were determined as follows: 0, normal; 1, few cells; 2, a ring of inflammatory cells 1 cell layer deep; 3, a ring of inflammatory cells 2–4 cells deep; 4, a ring of inflammatory cells of >4 cells deep. The PAS-positive goblet cells were counted manually, normalized against the length of the bronchial epithelial perimeter on the basal side, and expressed as the number of PAS-positive cells per millimeter of basement membrane. To evaluate collagen deposition of lungs, the area stained with Masson’s trichrome in each section was semi-quantitatively calculated using the ImageJ program (National Institutes of Health, Bethesda, MD).

Protein extracts of mouse lung tissue were collected as previously described (19). Protein was separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked for 5% bovine serum albumin (BSA) in 0.1% Tween 20 in Tris-buffered saline (TBS) (21°C, 2h) and incubated with anti- Nectin4, Afadin, p-Src, Src, Rac1-GTP, Rac1 (4°C, overnight) followed by horseradish peroxidase (HRP)-conjugated secondary antibodies. Detection was performed using WEST-ZOL plus Western Blot Detection System (16024, iNtRon, SungNam, Korea). The relative abundance of protein was determined by quantitative densitometry data were normalized to actin, beta (A2228, Sigma-Aldrich, MA, United States).

Mouse lung sections were de-paraffinized and rehydrated in an ethanol series. The sections were treated with 1.4% H₂O₂ in methanol for 30 min to inhibit endogenous peroxidase, and then treated for non-specific binding with 1.5% horse serum and incubated with the anti- Nectin4, Afadin, p-Src, Src, Rac1-GTP, Rac1. The next day, sections were incubated with avidin and biotinylated horseradish peroxidase macromolecular complex (PK-4001, Vector Laboratories, Burlingame, CA). Color reaction was developed by staining with liquid DAB+ substrate kit (C09-100, Golden Bridge International Inc., Mukilteo, WA). After immunohistochemical staining the slides were counterstaining the slide with Gill’s hematoxylin for 1 min. Images were analyzed with the ImageJ program (National Institutes of Health, Bethesda, MD).

Staining was performed on mouse lung sections. Samples were blocked for non-specific binding with 1.5% horse serum and incubation overnight at 4°C with Nectin4 and Rac1-GTP followed by Donkey polyclonal anti-Rabbit IgG H&L (Alexa Fluor 488) (ab150073, Abcam, Cambridge, MA) and Donkey Anti-Mouse IgG H&L (PE) (ab7003, Abcam, Cambridge, MA). Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Ab104139, Abcam, Cambridge, MA). Sections were observed using confocal laser scanning microscopy (LSM 510 META) and images were generated using the Zeiss LSM image browser (Carl Zeiss Microsystems, Thornwood, NY). Quantification of the immunofluorescent staining was performed with the ImageJ software (NIH, Bethesda, MD). Nectin4 and Rac1-GTP immunostained structures were detected by thresholding technique after subtraction of background. The area of immunostaining for Nectin4 and Rac1-GTP in corresponding nucleus was related to the area of interest (at least 6 sections) and expressed as the mean of relative area (%) ± SD.

Data were presented as means ± standard error of the mean (SEM) or median (range) using SPSS version 22 (SPSS, Chicago, IL). Comparisons of nonparametric variables and parametric variables were performed using Kruskal-Wallis tests and ANOVA respectively, and then post hoc analyses using Dunn-tests or turkey-HSD test were performed. Correlations between outcome measures were evaluated by calculating Pearson or Spearman correlation coefficients analysis. A Values of P<0.05 were deemed to indicate statistical significance.

Sixty-two patients with asthma (duration: 0.21 ± 0.74 or 1.62 ± 3.28 years) and 60 controls were recruited ( Table 1 ). The initial FEV1% pred., FVC% pred., FEV1/FVC%, and methacholine PC20 values were significantly lower, and the total IgE and blood eosinophil levels were significantly higher in the asthma patients than in the controls. There was no significant difference in the body mass indices between the two groups.

Plasma Nectin4 levels were significantly higher in the latter (68.11 ± 46.38 pg/ml vs. 105.16 ± 40.75 pg/ml or 132.79 ± 45.87 pg/ml p<0.001, Figure 1A ). During exacerbation, Nectin4 levels tended to be higher in patients with than without steroid medication.

The Nectin4 ROC curves for asthma patients and controls are shown in Figure 1B (AUC=0.716, p<0.001). A Nectin4 cutoff of 72.54 pg/mL distinguished between asthma patients and controls with 70.25% accuracy, 82.4% sensitivity, and 58.1% specificity ( Figure 1B ). Additionally, the plasma Nectin4 level correlated with specific IgE to Dermatophagoides pteronyssinus (D1) and Dermatophagoides farinae (D2) ( Figure 2A ), and with FVC% pred. (r  = - 0.229, p = 0.015), FEV1% pred. (r  = - 0.220, p  =  0.020), FEV1/FVC% (r  = - 0.211, p  =  0.026), and PC20 (r  =-  0.230, p = 0.022) ( Figure 2B ).

The mechanism by which Der p1 alters Nectin4 was investigated by exposing NHBE cells to the allergen, and then measuring Nectin4/Afadin and Src/Rac1 protein levels ( Figure 3 ). Both were increased in NHBE cells within 4-, 8-, and 24-h exposure to Der p1 (p < 0.05, Figures 3A, B ).

The cellular suppression of Nectin4 associated with siRNA transfection reduced Afadin, p-Src, and Rac1-GTP, but not Src or Rac1, expression ( Figures 4A, B ). Changes in the levels of Nectin4/Afadin and Src/Rac1 pathway proteins in NHBE cells treated with both Der p1 and siRNA were also observed. The effects of Nectin4 on the AJ permeability of NHBE cells were examined in a Transwell assay, which revealed a decrease in TEER in NHBE cells at 4, 8, and 24 h after Der p1 exposure, and an increase 8 and 24 h after Nectin4 siRNA treatment ( Figure 4C ).

To determine whether Nectin4 deletion affects features of OVA-induced asthma, Nectin4^−/− mice and wild-type (WT) control littermates were sensitized on days 0 and 14 with OVA, and then challenged on days 21 to 23 with OVA or saline ( Figure 5A ). As expected from previous work using the OVA-induced asthma model, AHR expression in response to increasing doses of methacholine increased in WT OVA/OVA mice compared to WT sham mice ( Figure 5B ). Nectin4^−/− mice sensitized and challenged with OVA (Nectin4^−/− OVA/OVA) had a lower AHR than their WT counterparts when treated with higher doses of methacholine ( Figure 5B ). The numbers of total cells, macrophages, eosinophils, neutrophils, and lymphocytes in BAL fluid were higher in WT OVA/OVA than WT mice (WT sham) ( Figure 5C ), and much lower in Nectin4^−/− OVA/OVA than WT OVA/OVA mice ( Figure 5C ). Type 2 cytokine expression (IL-4 and IL-13) in BAL fluid was higher in WT OVA/OVA mice than in WT sham mice ( Figure 5D ). In BAL fluid of Nectin4^−/− OVA/OVA mice, and the amounts of IL-4, IL-13 and Transwell Th1 and Th2 cytokines were significantly lower than in WT OVA/OVA mice ( Figures 5D, E ). Histologic analysis showed that WT OVA/OVA mice had mucosal gland hyperplasia and numerous inflammatory cell and collagen infiltrates in peribronchial areas ( Figure 5F ). The lung inflammation score, which measures goblet cells and collagen-positive areas, was 40% lower in Nectin4^−/− OVA/OVA mice than WT OVA/OVA mice ( Figures 5G–I ).

Total Nectin4/Afadin and Src/Rac1 pathway protein levels in the lung were higher in WT OVA/OVA than WT sham mice ( Figures 6A, B ). Immunohistochemical staining revealed increased Nectin4/Afadin and Src/Rac1 protein levels in the mononuclear inflammatory cells and epithelial cells of WT OVA/OVA mice ( Figures 6C, D ). However, both the expression of Nectin4/Afadin and the levels of the activated form of Src/Rac1 (p-Src/Rac1-GTP) were decreased in Nectin4-/- OVA/OVA mice. No significant differences in Src and Rac1 expression were detected between WT OVA/OVA and Nectin4-/- OVA/OVA mice ( Figure 6 ).

To confirm that the activated form of Rac1, Rac1-GTP, was responsible for the airway inflammation seen in Nectin4–/– mice, double-staining immunofluorescence of Nectin4 and Rac1-GTP was performed in lung tissue from mice with OVA-induced asthma. The results showed a lower level of Rac1-GTP expression in Nectin4^–/– OVA/OVA than WT OVA/OVA mice ( Figure 7 ).