The study subjects comprised patients who underwent allo-HSCT at the Hematology Center of Ruijin Hospital, affiliated with Shanghai Jiao Tong University School of Medicine. Pre-transplant conditioning regimens, graft-versus-host disease (GvHD) prevention and treatment, as well as infection prevention protocols, were consistent with previous reports (21, 22). Specifically, calcineurin inhibitors with short-term methotrexate and mycophenolate mofetil served as the backbone for the GvHD prophylaxis. Peripheral blood stem cells, mobilized by granulocyte colony-stimulating factor from the donor, constituted the source of hematopoietic stem cell transplants.

All included patients were deemed high-risk for CMV reactivation due to CMV seropositive in both donor and recipients. CMV reactivation was monitored weekly with plasma CMV DNA testing for the initial 3 months post-transplant, bi-weekly during months 4–6, and monthly during months 7–12. In case of DNAemia occurrence, monitoring frequency was adjusted to weekly or bi-weekly. Data were recorded with a maximum follow-up duration of one year. Serum CMV-DNA testing utilized the CMV-DNA quantitative real-time PCR assay (Daan Gene Co., Ltd., Shenzhen), with a cutoff value of 500 IU/mL. Pre-emptive therapy commenced when two consecutive test results exceeded 500 IU/mL or when a single test result surpassed 1000 IU/mL. During the follow-up period, viremia occurrence was defined as CMV reactivation. In total, 28 reactivation cases were included, with a median time from allo-HSCT to CMV reactivation of 41 days (range from 19 to 81 days). Among these 28 patients, six were diagnosed with refractory CMV viremia, in line with previously described diagnostic criteria (23). Thirty-six control cases were selected based on matching criteria including the patient’s primary disease, age, donor-recipient type, pre-transplantation approach. Blood samples were obtained from control patients at time points comparable to the CMV reactivation time points of positive patients. Throughout the study period, all control patients were tested negative for various viruses (CMV, EBV, BKV, JCV, HHV6A/B, VZV), as outlined in Table 1 .

Peripheral blood mononuclear cells (PBMCs) were isolated using density gradient separation with Ficoll (Sigma-Aldrich). Subsequently, 0.5~2.0 × 10⁶ cells were used for analysis. Initially, cells were stained with Fixable Viability Stain-BV510 (FV510, BD Bioscience) at room temperature in the dark for 15 minutes. Following PBS washing, cells were incubated at room temperature in the dark for 20 minutes with appropriate monoclonal antibodies, including APC-anti-CD3 (BD Bioscience), PE-anti-pan TCR γ/δ (BD Bioscience), FITC-anti-TCR Vδ2 (BioLegend), PE/Cy7-anti-CD45RA (BD Bioscience), and PerCP/Cy5.5-anti-CD27 (BD Bioscience). After another washing step, the cells were analyzed using the BD Canto II flow cytometer with Diva software for data collection. FlowJo v10.6.2 software facilitated the analysis of γδ T cell proportions, subset distribution, and surface antigen expression. Data exhibiting γδ T cell proportions of 0% or cell counts < 50 in the γδ T cell gate were excluded from the analysis.

A previous study indicated that Vδ1 and Vδ3 subsets were the primary components of Vδ2^neg γδ T cells, with Vδ1 cells selectively expanded by CMV challenge (9, 24). Peripheral CD4^negCD8^negCD3⁺ cells were purified using the EasySepTM human T cell isolation kit (Stem cell Technologies) according to the manufacturer’s instructions. Total RNA was extracted from isolated T cell pellets using the RNeasy kit (QIAGEN) and reverse transcribed into complementary DNA (cDNA) following the manufacturer’s protocol (Promega). Each cDNA was subsequently amplified using primers for TCR Vδ-1 chain variable (GCCTTAACCATTTCAGCC), Vδ-2 chain variable (TACCGAGAAAAGGACATCTATGGC), and constant segments (GTCGTGTTGAACTGAACATGTCACTG). Aliquots of 2 μL of the PCR products were further amplified with the same forward primer for each Vδ chain, along with Cδ-FAM-labeled constant primer (5’-ACGGATGGTTTGGTATGAGGCTGA-3’), for 10 cycles under the same PCR conditions. Separation of the labeled products was performed using an ABI 3500 DNA Sequencer (Applied Biosystems). The fluorescence intensity for each sample was then analyzed using GeneScan Version 3.0 software (Applied Biosystems).

Fresh PBMCs were isolated from CMV reactivation recipients at +180d post-HSCT. Following the isolation of γδ T cells from PBMC using the TCRγ/δ⁺ T cell isolation kit (Miltenyi Biotec), Vδ2^neg γδ T cells were sorted out from γδ T cell population using anti-Vδ2 (BD Biosciences PharMingen) monoclonal antibodies. Sorted cells were then expanded using a modified protocol as previously described (25). Polyclonal γδ T-cell cultures were initiated with 1 μg/mL PHA-L (Sigma-Aldrich), 200 IU/mL of human recombinant IL-2 (R&D Systems), and irradiated allogeneic PBMCs (35 Gy). After 2 to 3 weeks of culture, polyclonal lines were immunophenotyped, and purity (routinely > 95%) was determined through multicolor fluorescent staining.

Human embryonic lung fibroblast MRC5 cells were sourced from the Institute of Cell Biology, Chinese Academy of Sciences. These cells were cultured at 37°C in a 5% CO2 incubator using MEM medium (Gibco) supplemented with 2mM L-glutamine (Sigma-Aldrich) and 10% FCS (Gibco). Fibroblasts utilized were within 32 and 40 passage range and were maintained at 37°C in a humid atmosphere containing 5% CO₂. The clinical CMV strain TB40/E was obtained from Institute of Virology, Chinese Academy of Sciences. CMV suspensions were generated as previously described (25). Briefly, MRC-5 cells were infected with CMV at a multiplicity of infection (MOI) of 0.1 and incubated for 10 days at 37°C in serum-depleted culture medium. The resulting supernatant was harvested and initially centrifuged for 15 minutes at 1,200 g to eliminate cell debris. Subsequently, the virus was concentrated by centrifugation at 6,900 g for 18 hours. The resulting pellet was resuspended in PBS (1:100) without Ca²⁺ or Mg²⁺ and sonicated in an ultrasonic bath for 2 minutes. The protein concentration of the virus preparation was adjusted to 1 mg/mL, and the material was stored at –70°C. For lysis experiments, MRC5 fibroblasts were incubated with the CMV suspension at a MOI of 1 for 2 h, washed, and then cultured for indicated time at 37°C. Microscopic examination was conducted to confirm infection and assess cytopathic effects. Infected cell layers were washed before being used for coculture experiments.

To assess the function of cultured polyclonal T-cells, cultured polyclonal γδ T cells were co-cultured with monolayers of CMV-infected or noninfected MRC5 at a ratio of 5:1 for 6 hours at 37°C. For the blocking assay, polyclonal γδ T cells were preincubated for 1 hour with 20μg/mL of anti-NKG2D (R&D), anti-TCRγ/δ (Beckman), or control mouse IgG. IFN-γ released into the supernatant was quantified by ELISA according to the manufacturer’s recommendations (Bender Medsystems).

To evaluate the responses of freshly isolated γδ T cells to CMV-infected MRC5 cells, peripheral γδ T cells were isolated from PBMC of three recipients without CMV reactivation. Isolated γδ T cells were then co-cultured with monolayers of CMV-infected or noninfected MRC5 at a ratio of 5:1 for 6–8 days at 37°C. During the final 6 hours of co-culture, Brefeldin A (BioLegend) working solution was added at a ratio of 1:1000. After culturing, cells were collected for detection of intracellular IFN-γ in γδ T cells. Surface markers, including CD3, pan TCR γ/δ, and TCR Vδ2, were labeled as described above. Cells were fixed with 1 mL of Cytofix buffer (BioLegend) for 20 minutes, followed by centrifugation to remove the supernatant. Subsequently, cells were washed twice with 2 mL of Cytoperm buffer (BioLegend) and incubated at room temperature, protected from light, with anti-IFN-γ (BioLegend) for 20 minutes. After washing with Cytoperm buffer, cells were collected using a flow cytometer (BD CantoII) for analysis.

To assess the cytotoxic effect of freshly isolated Vδ2neg T cells on CMV-infected cells, Vδ2^neg T cells were obtained from three CMV reactivation recipients at day +180 post-transplant. Effector Vδ2^neg T cells were co-incubated at effector/target ratios (E:Ts) of 10:1 with CMV-infected MRC5 cells or non-infected MCR5 cells as controls. Cytotoxicity was measured after 4-hour culture at 37°C. For the blocking assay, cultured polyclonal γδ T cells were evaluated for cytotoxicity via flow cytometry after co-culture with monolayer CMV-infected MRC5 cells in the absence or presence of 20 μg/mL of anti-NKG2D, anti-TCRγ/δ or control mouse IgG. Following PBS washing, FV510 was added for cell staining for 15 minutes in PBS. Cells were then stained with PE-anti-pan TCR γ/δ in the dark for an additional 20 minutes. At least 10 000 target cells were acquired after gating out the TCR γ/δ positive cells, and the proportion of FV510-positive cells to TCR γ/δ negative cells were calculated. Background target cell death was determined from cells incubated in the absence of effector cells.

Data processing and statistical graph generation were carried out using IBM SPSS 26.0 and Graphpad Prism 9.5 software. Flow cytometry data were expressed as percentages. Normally distributed quantitative data were described using means (standard deviations) and analyzed for intergroup differences using one-way analysis of variance or independent-sample t-tests under conditions of homogeneity of variance. Non-normally distributed quantitative data were analyzed using the Mann-Whitney U test for intergroup differences. Categorical variable data were described using case counts and compared between groups using the chi-square test, with pairwise comparisons performed using Least Significant Difference (LSD) test. A significance level of P < 0.05 was considered statistically significant.

The characteristics of the enrolled patients were summarized in Table 1 . The median age of the 64 transplant patients was 46 years (range: 15–69 years). Patients were categorized into two groups based on whether CMV reactivation occurred during the follow-up period: the CMV reactivation group (n = 28) and the CMV-negative group (n = 36). No significant differences were observed between the two groups regarding age, gender, hematopoietic cell transplantation-specific comorbidity index (HCT-CI), underlying hematologic diseases, transplant methods, donor sources, or the incidence of chronic GvHD ( Table 1 ). However, disparities were noted in the rates of acute GvHD and non-CMV herpesvirus (NCH) reactivation, with the CMV reactivation group experiencing more cases of grade II to IV acute GvHD and NCH reactivation. Specifically, the percentages of EBV reactivation (EBV DNA > 1×10⁴ IU/mL) were 71.4% and 22.2% in the CMV reactivation group and CMV-negative group, respectively (P < 0.001, Table 1 ). The reactivation rates of HSV1, HHV6B, and VZV exhibited no significant differences between the two groups ( Table 1 ).

To investigate alterations in γδ T cells among HSCT patients in response to CMV reactivation, we initially compared the levels and subset compositions of circulating γδ T cells between CMV-negative patients and those with initial viremia during CMV reactivation. Flow cytometry analysis of γδ T cells and their subsets is depicted in Figure 1A . Results revealed that the proportion of γδ T cells to total CD3⁺ T cells in the CMV reactivation group was significantly higher compared to that in the CMV-negative group (8.473% ± 6.240% vs. 3.060% ± 2.118%, P < 0.01). Further analysis of the γδ T cell subset composition unveiled that in the CMV-negative group, the majority of γδ T cells expressed Vδ2, with Vδ2^neg γδ T cells constituting approximately 39.96% ± 25.75% of total γδ T cells. Conversely, in the CMV reactivation group, there was an inversion in the Vδ2^pos to Vδ2^neg ratio, with a significantly higher proportion of Vδ2^neg γδ T cells, accounting for 88.68% ± 17.14% of total γδ T cells. The difference in the proportion of Vδ2^neg γδ T cells to total γδ T cells between the two groups was statistically significant (P < 0.001, Figure 1B ), suggesting an association between CMV reactivation and the expansion of γδ T cells, particularly the Vδ2^neg subset.

Analysis of HSCT patients with CMV^neg/EBV⁺ (n = 12), CMV^neg/BKV⁺ (n = 23), and CMV^neg/HHV6A/B⁺ (n = 8) revealed that, in contrast to the negative control group, these patients showed no significant increase in peripheral blood γδ T cell levels and no notable changes in the proportion of Vδ2⁺ to Vδ2^neg ( Figure 1B ). Another group of patients with reactivation of both CMV and EBV (CMV⁺/EBV⁺, n = 9) was evaluated, and their levels and constitution of γδ T cell were comparable to those of patients with only CMV reactivation ( Figure 1C ).

To further clarify the association between CMV reactivation and γδ T cells expansion, we compared the levels and subset compositions of γδ T cells before and during DNAemia in HSCT patients (n = 19). The median interval between sampling before DNAemia and DNAemia confirmation was 5 days (range 3~14 days). Figure 2A illustrates changes in γδ T cells in three CMV reactivation patients, representative of the nineteen patients, before and at the onset of DNAemia. The proportion of γδ T cells to total CD3⁺ T cells in these patients’ blood increased significantly from 2.10% ± 1.59% before DNAemia to 4.91% ± 3.24% at the time of CMV DNAemia (P < 0.01, Figure 2B ). Moreover, Vδ2^neg γδ T cells expanded significantly, escalating from 27.3% ± 13.6% to 63.0% ± 21.8% of total γδ T cells (P < 0.01, Figure 2B ).

We conducted continuous monitoring from viremia onset to DNAemia clearance in a subset of patients with refractory CMV infection (n = 6). These patients were sampled 4–6 times during the observation period, with a median interval of 6 days between each of the two adjacent analyses (range 3–10 days). The median duration from the last positive sampling and the negative sampling was 7 days (range: 4–12 days). The levels of plasma CMV DNA load compared to γδ T cells and Vδ2^neg γδ T cells at different sampling time points in a representative patient are shown in Figure 3A . Figure 3B demonstrates that γδ T cell levels, particularly Vδ2^neg γδ T cells, swiftly increased with CMV DNAemia duration of in these refractory patients. However, even after DNAemia clearance, γδ T cells persisted at a high level, with Vδ2^neg cells still predominating. Figure 3C shows the corresponding plasma CMV DNA loads at different γδ T cell analysis time points.

To elucidate whether alterations in γδ T cells following CMV reactivation coincide with changes in their differentiation status, we categorized total γδ T cells into distinct subsets based on the expression of CD27 and CD45RA markers (26). These subsets included the Naive (CD45RA⁺CD27⁺), Central Memory (CM, CD45RA^negCD27⁺), Effector Memory (EM, CD45RA^negCD27^neg), and Effector Memory CD45RA⁺ cells (EMRA, CD45RA⁺CD27^neg) as depicted in Figure 4A .

Our findings revealed that in the peripheral blood γδ T cell population of CMV reactivation patients, the proportion of Naive cells to total γδ T cells was significantly lower compared to the CMV-negative group, while the proportion of EMRA cells significantly increased. However, there were no statistically significant differences in the proportions of CM and EM cells between the two groups ( Figure 4B ). Further examination of CD27 and CD45RA expression patterns in different γδ T cell subsets, specifically in Vδ2^neg γδ T cells and Vδ2⁺ γδ T cells, revealed distinct trends. In the CMV-negative group, Naive cells predominated in the Vδ2^neg γδ T cell subset. However, in the CMV reactivation group, this subset exhibited a clear shift toward EM and EMRA phenotype ( Figure 4C ). Conversely, Vδ2^pos γδ T cells in the CMV-negative group primarily exhibited CM and Naive phenotypes. In the CMV reactivation group, while a notable increase in EM and EMRA cells was observed in 5 patients, the proportion of EM and EMRA cells did not reach significant difference between the CMV-negative and CMV-reactivation groups ( Figure 4D ). These findings suggest a pivotal role of Vδ2^neg γδ T cells in the immune response against CMV infection.

To assess the impact of CMV reactivation on the clonal expansion of proliferated Vδ2^neg γδ T cells in patients, we conducted complementary-determining region (CDR3) spectratyping analysis of the TCR-δ1 and TCR-δ2 chain repertoire, as previously reported (10). The complexity of the TCR-δ chain repertoire was evaluated by counting the total number of peaks in each histogram. As a control, analyses were initially performed on seropositive (n=10) and seronegative (n=2) healthy donors. Representative profiles of monoclonal (1 peak), oligoclonal (2–6 peaks), and polyclonal (7 or more peaks) distributions are depicted in Figure 5A . Seronegative healthy donors exhibited diverse CDR3 profiles for Vδ1, displaying numerous peaks indicative of various CDR3 length rearrangements. Conversely, seropositive healthy donors showed a range of polyclonal (three cases), oligoclonal, (five cases) and monoclonal (two cases) expansions in Vδ1 cells. Notably, Vδ2 cells displayed comparable polyclonal TCR repertoires in both seropositive and seronegative donors.

In recipients, the reconstituted TCR repertoires of Vδ1 T cells from CMV-reactivated patients (CMV⁺, n = 13) during the CMV activation phase showed similar clonal restriction to those from non-activated patients (CMV^-, n = 18) at matched post-transplant time points. Furthermore, both CMV⁺ and CMV^- recipients exhibited greater clonal restriction in their Vδ1 TCR repertoire compared to healthy donors. Over time, the diversity of TCR repertoires in Vδ1⁺ T cells increased in CMV^- patients, but not in CMV⁺ patients. Two months after DNAemia conversion, the CDR3 diversity of Vδ1 T cells was significantly lower in CMV⁺ recipients than in CMV- recipients at the same time after transplantation ( Figure 5B ). Regarding recipient Vδ2^pos T cells, the diversity of their CDR3 profiles progressively increased over time after transplantation, regardless of CMV reactivation. There was no significant difference in the diversity of Vδ2⁺ T cell TCR profiles between CMV-positive and CMV-negative patients at matched time points ( Figure 5C ). These results suggest that peripheral expansion of Vδ2^neg γδ T cells is clonally restricted during CMV reactivation in patients undergoing allo-HSCT.

To explore the response of γδ T cells to CMV-infected cells in vitro, freshly isolated γδ T cells from three HSCT recipients without CMV reactivation were co-cultured with CMV-infected or non-infected MRC5 for several days. The results unveiled that CMV-infected cells significantly spurred the expansion of Vδ2^neg γδ T cells and their secretion of IFN-γ in comparison to uninfected cells. Moreover, CMV-infected MRC5 cells notably amplified IFN-γ secretion by Vδ2^neg cells, while little such effect was observed within Vδ2^pos cells ( Figure 6A ).

Furthermore, cytotoxicity assays revealed that Vδ2^neg cells from both seropositive donors and CMV reactivation recipients displayed specific cytotoxicity against CMV-infected fibroblasts, but not against uninfected ones ( Figure 6B ). In contrast, Vδ2⁺ γδ T cells did not exhibit cytotoxicity against CMV-infected cells ( Supplementary Figure 1 ). These results unequivocally underscore the anti-CMV capabilities of Vδ2^neg T cells, distinguishing them from Vδ2pos T cells.

To clarify the involvement of NKG2D and NKG2C in Vδ2^neg γδ T cells’ response to CMV-infected MRC5 cells, Vδ2^neg γδ T cells from 5 CMV reactivation recipients were evaluated the expression of NKG2D and NKG2C. In accordance with previous reports (9, 25), NKG2D demonstrated consistent surface expression on the surface of all five cases ( Supplementary Figure 2 ). In contrast, NKG2C is barely expressed in Vδ2^neg cells. These findings suggest that NKG2C might not play a significant role in the recognition of CMV-infected cells by γδ T cells. Further investigation into the role of NKG2D in cell lysis involved co-culturing Vδ2^neg γδ T-cell lines with CMV-infected fibroblasts in the presence or absence of blocking anti-TCRγ/δ and anti-NKG2D antibodies. Surprisingly, blocking TCRγ/δ and NKG2D, either separately or in combination, led to a decrease in IFN-γ production by T cells ( Figure 7A ). However, the specific lysis of CMV-infected targets by cultured γδ T cells remained unaffected by blocking antibodies ( Figure 7B ).