Abstract
Brucellosis is a zoonotic disease caused by Brucella species. Its pathogenesis is closely associated with bacterial evasion of macrophage-mediated killing, induction of a pro-inflammatory cytokine storm, and immune-mediated pathological damage. Accumulating evidence indicates that Codonopsis pilosula polysaccharides (CPPS) inhibit inflammatory signaling, enhance macrophage phagocytosis, and exert immunomodulatory effects across multiple organs. However, the therapeutic potential of CPPS in brucellosis remains largely unexplored. This study aimed to investigate the effects of CPPS on the inflammatory response induced by Brucella outer membrane protein 19 (OMP19). In vivo, CPPS significantly alleviated tissue damage and simultaneously downregulated the expression of high mobility group box 1 protein (HMGB1), E-cadherin, and paxillin. In vitro, CPPS inhibited SYK/FAK/AKT phosphorylation, PKC activation, and WNT-1 signaling pathway transduction. Additionally, CPPS modulated the cytokine profile by downregulating pro-inflammatory cytokines (TNF-α, IL-6) while increasing the level of the anti-inflammatory cytokine IL-10. Furthermore, CPPS decreased the expression levels of E-cadherin and paxillin and reduced the intracellular calcium ion (Ca2+) concentration. ATP2A1 was identified as a key differentially expressed gene through transcriptome sequencing. Knockdown experiments further confirmed that CPPS exerts anti-inflammatory effects by regulating ATP2A1. Collectively, CPPS attenuates the inflammatory response in macrophages induced by OMP19 via regulating ATP2A1 to modulate cell adhesion and calcium signaling
1 Introduction
Brucellosis is a globally prevalent zoonotic chronic infectious disease caused by Brucella spp, clinically characterized by undulant fever, arthritis, reproductive system disorders (e.g., abortion, orchitis), and organ abscess formation (). With more than 500,000 cases reported annually worldwide, the Inner Mongolia Autonomous Region of China is recognized as a high-risk endemic area, posing a significant public health threat that warrants urgent research attention (–). Brucella is a Gram-negative bacterium that is aerobic to microaerophilic and facultatively intracellular. Its pathogenicity mainly derives from its ability to evade host immune defenses and persist within phagocytes, such as macrophages and dendritic cells (DCs), as well as placental trophoblast cells (, ). Key virulence factors of Brucella include lipopolysaccharide (LPS), type IV secretion system (T4SS), and outer membrane proteins (OMPs). Brucella manipulates immune signaling by secreting effector proteins via the T4SS, which promotes adhesion, internalization, intracellular transport, and replication within host cells (–). Among these factors, OMPs play multifaceted roles in pathogenesis: (i) mediating adhesion to host cells and facilitating intracellular replication, and (ii) modulating host immune responses to promote immune evasion and persistent infection (, ). Among them, OMP19 is highly conserved, and lipidated OMP19 is consistently expressed in all Brucella species (). Studies have shown that OMP19 can significantly alter the secretion patterns of cytokines and chemokines (), inducing markedly higher TNF-α and IL-6 production compared with OMP10 and OMP28, both in vitro and in vivo ().
Adhesion of Brucella to host cells is a pivotal step in infection, with specific molecular interactions determining bacterial intracellular fate and influencing disease progression (). This process triggers tyrosine phosphorylation of adhesome proteins such as focal adhesion kinase (FAK), Src kinase, paxillin, and p130Cas, which are integral to the integrin signaling pathway and regulate cell adhesion, migration, and proliferation (). FAK enhances phagocytosis by coordinating macrophage migratory behavior and adhesion turnover, thereby facilitating target engulfment (, ). Protein kinase C (PKC), a family of serine/threonine kinases, participates in diverse signaling pathways related to cell proliferation, differentiation, and transcriptional regulation, and certain isoforms also regulate adhesion and migration (). Classical PKC activation requires synergistic calcium ion (Ca2+) and diacylglycerol (DAG) signaling (). Similarly, the WNT-1 signaling pathway stabilizes β-catenin binding to adhesion proteins, strengthens intercellular junctions, and influences cytoskeletal reorganization (, ). Existing studies have confirmed that ATP2A1 is simultaneously involved in the regulation of cell adhesion and calcium signaling pathways ().
Macrophages, as central effectors of innate immunity, are both the primary target cells of Brucella and critical regulators of host defense. They eliminate pathogens through adhesion molecule-mediated migration and phagocytosis and activate adaptive immunity via antigen presentation (–). Following invasion through the skin, mucosa, or gastrointestinal tract, Brucella are phagocytosed by local macrophages, which subsequently migrate to regional lymph nodes to establish primary foci of infection (). Brucella evade immune clearance by interacting with macrophage surface receptors via lipid rafts, thereby inhibiting phagocytosis and preventing phagolysosomal fusion ().
In recent years, immunomodulatory compounds derived from traditional Chinese medicine (TCM) have emerged as promising strategies for combating intracellular bacterial infections. CPPS, the primary bioactive components of Codonopsis pilosula, exhibit multiple immunomodulatory properties (). CPPS modulate cytokine secretion, inhibit MAPK and NF-κB activation, enhance macrophage phagocytosis and bacterial killing, and suppress the growth of Escherichia coli (E. coli) (). They also promote IL-1β secretion from macrophages and elevate serum IL-1β levels in mice, exerting immune-enhancing effects (). Moreover, CPPS ameliorates inflammation in both the intestine and lungs, as demonstrated by improved phagocytic function of mouse alveolar macrophages in COPD models, reduced IL-6, IL-8, and TNF-α levels, and improved systemic inflammatory status (). CPPS also protects immune organs from injury in cyclophosphamide-induced immunosuppression models (). Collectively, these findings indicate that CPPS restores macrophage function and protects immune organs, demonstrating broad immunomodulatory capabilities. However, whether CPPS exerts similar effects in Brucella infection-induced inflammatory responses remains unknown. Therefore, this study aimed to investigate the role of CPPS in OMP19-induced inflammatory responses using cell and mouse models of Brucella infection.
2 Materials and methods
2.1 Experimental animals
Thirty-six female BALB/C mice (6–8 weeks old, 20–22 g) were purchased from SPF Biotechnology Spectrum Laboratory Animal Center (Beijing, China). Animals were housed at 22 ± 2 °C under specific pathogen-free conditions with a 12 h light/dark cycle and were provided autoclaved food and purified water ad libitum. All experimental procedures were approved by the Animal Ethics Committee of Inner Mongolia Medical University (approval ID: YKD202503042).
2.2 Mice model
Thirty-six female BALB/C mice (6–8 weeks old, 20–22 g) were randomly assigned to six groups (n = 6 mice per group) [unst: control, CPPS-treated groups (100 and 300 mg·kg-1), OMP19-treated group (5 mg·kg-1), and CPPS+OMP19-treated groups (100 and 300 mg·kg-1 CPPS were pre-injected intraperitoneally for 1 h, followed by 5 mg·kg-1 OMP19)], whereas mice in the control group were treated with PBS. After one week, pentobarbital sodium was administered via intraperitoneal injection at a dose of 150–200 mg·kg-1 (prepared as a 1% w/v solution; 0.3-0.4 ml was injected for a 20 g mouse). Following deep anesthesia, euthanasia was performed by cervical dislocation. Uterine tissues were collected and preserved in 4% paraformaldehyde, with a portion stored at -80 °C. The concentration of CPPS used in this study was based on previous studies (, , ).
2.3 OMP19 extraction and purification method
The Brucella OMP19 gene (GenBank: U35742) was synthesized (Gene-Optimal, Shanghai, China) and cloned into the pET-28a vector (). The recombinant plasmid pET-28a-OMP19 was transformed into E. coli BL21 (DE3) by heat shock (42 °C, 90 s). Transformants were inoculated at a 1:100 dilution into LB medium containing 100 μg/ml kanamycin (MedChemExpress, USA) and cultured at 37 °C with shaking until OD600 reached 0.6 (). Recombinant OMP19 expression was induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG, MedChemExpress, USA) at 20 °C for 20 h with shaking.
Cells were harvested and lysed in buffer (60 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, pH 8.0), followed by sonication in an ice bath (250 W, 10 s on/10 s off, total 4 min). The lysate was centrifuged at 8,000 × g for 45 min at 4 °C, and the His-tagged OMP19 in the supernatant was purified by immobilized metal affinity chromatography (IMAC) using a 1 ml Ni-NTA Superflow cartridge (Bestchrom, Shanghai, China), which was equilibrated and washed with the same lysis buffer.
Protein concentration and characterization were confirmed by A280 quantification, 12% SDS-PAGE, and Western blotting with HRP-conjugated anti-His Tag monoclonal antibodies.
2.4 Transcriptome sequencing and analysis
2.4.1 RNA extraction, library construction, and sequencing
Peritoneal macrophages isolated from BALB/C mice were pretreated with CPPS (Solarbio, SR8560, China) for 12 h and subsequently stimulated with OMP19 for 12 h. Total RNA was extracted using TRIzol reagent and assessed using Qubit 3.0 and Agilent 5300 (RIN > 7.0). Two micrograms of RNA were purified, fragmented, and reverse transcribed into double-stranded cDNA. Following end repair, A-tailing, adapter ligation, and PCR amplification, a strand-specific library with an insert size of 400 ± 50 bp was constructed and sequenced on the NovaSeq™ X Plus platform with 150 bp paired-end reads.
2.4.2 Bioinformatics analysis
Raw reads were filtered to remove low-quality sequences and adapter contamination using Cutadapt (v1.9). High-quality, clean data were obtained after quality control using FastQC (v0.11.9) and deposited in the NCBI GEO/SRA database.
2.5 Cell extraction and cultivation
Three days before the isolation of peritoneal macrophages, BALB/C mice were intraperitoneally injected with 2 mL of 3% thioglycolate medium (BD Biosciences, 225620, Sparks, MD, USA). Peritoneal macrophages were collected by lavage of the peritoneal cavity with endotoxin-free phosphate-buffered saline (PBS) (Servicebio, G4202, China), followed by centrifugation at 2376 × g for 5 min at 4 °C. The cells were cultured at 37 °C in 5% CO2 in RPMI 1640 medium (Gibco, C11875500BT, China) supplemented with 10% fetal bovine serum (FBS) (ExCell Bio, FSD500, China). The cells (2 × 106 cells per well) were seeded into 6-well culture plates in 1 mL of fresh culture medium and washed three times with PBS before infection or stimulation. The isolation and purification procedures of macrophages from peritoneal lavage fluid were performed strictly according to the experimental methods described in the cited literature. No additional cell sorting or special purification techniques were adopted in this study ().
2.6 Western blotting
Mouse peritoneal macrophages were treated with 50 µg·mL-1 CPPS for 12 h, followed by stimulation with 5 µg·mL-1 OMP19 for 8 h. Total protein was extracted using cell lysis buffer (Servicebio, G2002, China) supplemented with phosphatase inhibitors (Beyotime, P1045, China). The cells were resuspended in 50 µL of lysis buffer, incubated on ice for 5 min, scraped, and centrifuged at 13,684 × g for 10 min at 4 °C.
A total of 40 µg of protein was quantified using the Enhanced BCA Protein Assay kit (Beyotime, P0398L, China) and separated by 12% SDS-PAGE (Solarbio, P1204, China). The proteins were transferred to PVDF membranes (Immobilon, ISEQ00010, Germany) using a Bio-Rad electroblotting system. The membranes were blocked with 5% non-fat milk (Becton, Dickinson and Company, 232100, USA) for 3.5 h at room temperature. Primary antibodies against β-actin (Affinity, Cat. No. AF7018, China), AKT (Proteintech, 10176-2-AP, China), SYK (Proteintech, 14858-1-AP, China), FAK (Affinity, AF6397, China), ERK (Affinity, AF0155, China), PKC (Affinity, AF6197, China), WNT-1 (Proteintech, 27935-1-AP, China), paxillin (Affinity, AF6332, China), E-cadherin (Affinity, BF0219, China), phospho-AKT (P-AKT) (Cell Signaling Technology, 4060T, USA), phospho-ERK (P-ERK) (Affinity, AF1015, USA), phospho-SYK (P-SYK) (Cell Signaling Technology, 2710T, USA), and phospho-FAK (P-FAK) (Affinity, AF3398, USA) were used.
Primary antibodies were diluted as follows: AKT at 1:3000, β-actin at 1:3000, and all other antibodies at 1:1000, using the antibody dilution buffer provided by Beyotime (China). The membranes were incubated with primary antibodies overnight at 4 °C and washed three times with TBST for 10 min each. After washing, the membranes were incubated with a secondary antibody (Affinity, S0001, China) at a dilution of 1:3000 for 1 h, followed by three additional washes with TBST, each for 10 min. Protein bands were visualized using enhanced chemiluminescence (Beyotime, P0018S, China) on PVDF membranes. All Western blot experiments were explicitly repeated independently three times.
2.7 Quantitative real-time PCR
Cell RNA extractions followed the Axygen RNA kit manufacturer’s instructions (Axygen Scientific, UE-MN-MS-RNA-250, USA). Cells were resuspended in lysis buffer and centrifuged at 13,684 × g, followed by RNA extraction as per the manufacturer’s instructions (A260/A280 value in the range of 1.9-2.0). The extracted RNA was reverse transcribed into cDNA using the PrimeScript™ RT Master Mix Kit (Vazyme, R223-01, China). The expression levels of TNF-α, IL-6, IL-10, CXCL-10, MIP-1α, and CD40 relative to β-actin mRNA were measured using qPCR. Primers were designed based on sequence information obtained from NCBI (National Center for Biotechnology Information) and are listed in Table 1. The primers were synthesized by Sangon. For qPCR, the following conditions were used: initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 30 s using the ABI QuantStudio™ 7 system. The qPCR procedures adhered to MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) standards. To reduce variation between datasets, the arithmetic mean was calculated for the control and treatment groups, with three parallel samples per group, and the relative quantification (RQ) values were determined using the 2-ΔΔCt method. All qPCR experiments were explicitly repeated independently three times.
Table 1
| Primer name | Forward (5’-3′) | Reverse (5′-3′) | Gen Bank accession No. |
|---|---|---|---|
| TNF-α | CTTCTCATTCCTGCTTGTG | ACTTGGTGGTTTGCTACG | XM_021163844.1 |
| IL-6 | TTCTTGGGACTGATGCTG | CTGGCTTTGTCTTTCTTGTT | XM_021149735.1 |
| IL-10 | GGTTGCCAAGCCTTATCGTA | ACCTGCTCCACTGCCTTGCT | NM_010548.2 |
| CXCL10 | CAGTGAGAATGAGGGCCATAGG | CGGATTCAGACATCTCTGCTCAT | XM_021161764.2 |
| CD40 | ACACAGGTAGAAACCCCAGG | GTAATGTACCCCGTGTGTGC | NM_170702.2 |
| MIP-1α | GCTCCCAGCCAGGTGTCATTTT | AAGACTCTCAGGCATTCAGTTCCAG | NM_011337.2 |
| β-actin | CGTTGACATCCGTAAAGACC | TAGGAGCCAGAGCAGTAATC | NM_007393.5 |
Primer messages of qPCR.
2.8 Hematoxylin-eosin staining
Female BALB/C mice were randomly divided into 6 groups (n = 6 per group): control group, CPPS alone treatment groups (100 and 300 mg·kg-1), OMP19 model group (5 mg·kg-1), and CPPS pretreatment combined with OMP19 groups (intraperitoneal injection of 100 or 300 mg·kg-1 CPPS 1 h in advance, followed by administration of 5 mg·kg-1 OMP19). Mice in the control group received an equal volume of PBS via intraperitoneal injection. After one week, mice were euthanized, and uterine tissues were harvested. Tissues were fixed overnight in 4% paraformaldehyde at 4 °C, dehydrated in a graded ethanol series, embedded in paraffin, and sectioned at 6 μm. Sections were stained with H&E. Pathological alterations in uterine tissues were examined using an Axio Scan Z1 slide scanner (Zeiss, Germany). Four high-magnification fields of view were selected for each H&E-stained section.
At present, there is no universally recognized and unified histological scoring or grading system specifically applied to endometrial tissues in pathological studies. Therefore, a self-established semi-quantitative grading standard was adopted in this study to comprehensively evaluate the histopathological changes of the endometrium. All evaluation indicators were formulated based on the typical pathological injury characteristics of uterine tissues and included three core observation dimensions. First, the structural integrity of endometrial luminal epithelial cells was observed under a high-power microscope, and the occurrence and severity of cellular vacuolar degeneration were evaluated. Second, the structural integrity of glandular epithelial cells in both the functional layer and basal layer of the endometrium was synchronously assessed, and the positive rate and distribution range of vacuolar degeneration in glandular epithelial cells were statistically analyzed. Third, the infiltration degree of inflammatory immune cells in the endometrial stroma was quantitatively determined, including macrophages, eosinophils, neutrophils, basophils, and lymphocytes. Notably, no obvious inflammatory immune cell infiltration was detected in the blank control group. Accordingly, the evaluation criterion for elevated immune cell infiltration was defined as the histologically visible presence of infiltrated immune cells relative to the blank control.
2.9 Immunofluorescence assay
Mouse uterine tissues were embedded in paraffin and cut into 6 μm sections. Antigen retrieval was performed by heating the sections in 0.01 M citrate buffer (pH 6.0) at 95-98 °C for 20 min, followed by natural cooling to room temperature. Thereafter, sections were deparaffinized in xylene, rehydrated through a graded ethanol series, and rinsed twice with pre-chilled PBS (4 °C) for 5 min each. Sections were blocked with 3% bovine serum albumin (BSA) in PBS at room temperature for 4 h. Subsequently, sections were incubated overnight at 4 °C in the dark with HMGB1 (Affinity, AF7020, China) primary antibody diluted 1:100 in PBS containing 3% BSA. After incubation, sections were washed twice with PBST for 10 min each, then incubated with Alexa Fluor 488-conjugated secondary antibody (Affinity, S0018, China) at room temperature for 1 h, followed by three washes with PBST for 5 min each. Finally, all samples were observed and imaged using a ZEISS confocal microscope under identical imaging parameters, and grayscale distribution values were analyzed accordingly.
2.10 Macrophage intracellular Ca2+ detection
Mouse primary peritoneal macrophages were cultured in serum-free medium using 6-well plates at a concentration of 2 × 106 cells. Macrophages were pretreated with CPPS (50 µg·mL-1) for 12 h, followed by stimulation with OMP19 (5 µg·mL-1) for an additional 12 h. Subsequently, the culture medium was aspirated, and the cells were gently rinsed once with PBS. Fluo-4 staining solution (1 mL per well in 6-well plates) (Beyotime, S1061S, China) was applied to cover the cell monolayer. Incubation was performed for 30 min at 37 °C, protected from light. The cells were then washed 1–3 times with PBS or HBSS after incubation. Fluorescence signals were quantified using an inverted fluorescence microscope (Fluo-4 AM emits green fluorescence, Ex/Em = 490/525 nm) with consistent exposure settings across samples.
2.11 Immunohistochemistry in uterine tissue
The expression levels of E-cadherin and paxillin in mouse endometrial tissue were detected by IHC (n = 6 per group). Briefly, sections were deparaffinized, rehydrated, and subjected to antigen retrieval, followed by blocking with normal serum. The samples were then incubated overnight at 4 °C with primary antibodies against E-cadherin and paxillin (1:200). After washing, the sections were incubated with appropriate secondary antibodies (1:500) (Affinity, S0001, China) at room temperature for 1 h. Immunoreactivity was visualized using a DAB chromogenic substrate, and nuclei were counterstained with hematoxylin. The signal intensity of yellow staining in mouse endometrial tissue was quantified using the H-score calculation software integrated into the Aipathwell platform.
2.12 The calcium ion chelator BAPTA-AM
Following a 1 h pretreatment with 100 µM BAPTA-AM (MCE, HY-100545, China), mouse peritoneal macrophages were sequentially treated with 50 µg·mL-1 CPPS for 12 h and stimulated with 5 µg·mL-1 OMP19 for 8 h. The expression level of E-cadherin protein was then determined using Western blot analysis.
2.13 Culture of THP-1 cells and ATP2A1 gene knockdown
THP-1 cells were seeded into 6-well plates at a density of 2 × 106 cells/mL, and siRNA transfection was performed after cell adherence. siRNA (Sangon Biotech, 113195091, China) and Lipofectamine 2000 (Thermo Fisher Scientific, 11668019, USA) were diluted separately with Opti-MEM medium (Thermo Fisher Scientific, 31985070, USA), incubated at room temperature for 5 min, then mixed thoroughly and incubated for an additional 20 min to form transfection complexes. The culture medium was replaced with Opti-MEM, and the complexes were added to a final volume of 2 mL. After 24 h of incubation, the medium was replaced with complete medium for subsequent treatment at a final concentration of 20 nmol/L.
2.14 Data analysis
Data are expressed as the mean ± standard deviation (mean ± SD). Statistical analyses were performed using GraphPad Prism 9. The normality of distribution was assessed by the Shapiro-Wilk test, and homogeneity of variance was evaluated using the Brown-Forsythe test. One-way or two-way analysis of variance (ANOVA) was applied for comparisons among multiple groups, followed by Bonferroni or Tukey post hoc multiple comparison tests as indicated in the figure legends; non-normally distributed data were analyzed using the non-parametric Kruskal-Wallis test. Effect size (Cohen’s d) was calculated for key pairwise comparisons. A P value ≤ 0.05 was considered statistically significant.
3 Results
3.1 Effects of CPPS on OMP19-induced uterine inflammation and HMGB1 expression
The inhibitory effects of CPPS on inflammation were investigated in vivo. Mice were preconditioned with CPPS (at doses of 100 or 300 mg·kg-1 body weight; n = 6) via intraperitoneal injection; after 1 h, they were treated with an intraperitoneal dose of OMP19 (5 mg·kg-1). OMP19 exposure induced uterine epithelial cell vacuolar degeneration and prominent neutrophil infiltration. Both doses of CPPS (100 mg·kg-1 and 300 mg·kg-1) reduced the extent of this blister-like degeneration in uterine epithelial cells and decreased the number of neutrophils induced by OMP19 (Figure 1A). To assess CPPS-mediated tissue repair, uterine HMGB1 expression was analyzed. We showed that CPPS significantly suppressed OMP19-induced HMGB1 upregulation (P < 0.001, Figure 1B), suggesting its role in modulating HMGB1-associated inflammatory responses and tissue damage.
Figure 1
3.2 Transcriptome analysis
To elucidate the mechanism by which CPPS alleviates OMP19-induced tissue injury and inflammation, mouse peritoneal macrophages were used in this study, and differentially expressed genes were screened and analyzed via transcriptome sequencing (RNA-seq). Transcriptomic profiling revealed 261 upregulated and 65 downregulated genes in the CPPS+OMP19 group compared to the OMP19 group (Figure 2A). KEGG pathway analysis of differentially expressed genes (DEGs, Figure 2C) identified significant enrichment in cellular adhesion pathways (e.g., focal adhesion including SYK FAK, AKT signaling) and calcium signaling (e.g., Ca2+ influx regulators, including ERK, PKC, WNT-1). Among the top 20 DEGs (Figure 2B), we further screened and identified ATP2A1 as the core upstream regulatory gene. This gene is involved in both cell adhesion and Ca²+ influx, and was therefore selected for further in-depth investigation.
Figure 2
3.3 Effect of CPPS on the expression of inflammatory cytokines, chemokines, and macrophage activation in OMP19-induced macrophages
To elucidate the immunomodulatory effects of CPPS in macrophages induced by OMP19, we examined the expression levels of inflammatory cytokines (TNF-α, IL-6, and IL-10), chemokines (MIP-1α and CXCL-10), and co-stimulatory molecules (CD40) using RT-qPCR. Our results showed that OMP19 significantly induced the expression of inflammation-related cytokines TNF-α, IL-6, CXCL-10, MIP-1α, and CD40 in macrophages compared with the control group (P < 0.001). In contrast, CPPS significantly suppressed this OMP19-induced upregulation (P < 0.001, Figures 3A, C, D). In addition, OMP19 significantly decreased the expression of the anti-inflammatory cytokine IL-10 in macrophages (P < 0.001), whereas CPPS upregulated the OMP19-induced expression of IL-10 (P < 0.05, Figure 3B). These results suggest that CPPS may inhibit excessive macrophage activation, thereby alleviating inflammatory responses.
Figure 3
3.4 CPPS down-regulated the expression of E-cadherin and paxillin in OMP19-induced endometrial tissue
To further elucidate the expression levels and localization of E-cadherin and paxillin, immunohistochemical (IHC) analysis was performed on mouse endometrial tissue. As shown in Figure 4, the results demonstrated specific expression of E-cadherin and paxillin in both luminal and glandular epithelial cells of the endometrium, with positive signals indicated by yellow staining. Notably, OMP19 treatment significantly upregulated the expression of both E-cadherin and paxillin (P < 0.05). In contrast, CPPS administration markedly reduced the expression of E-cadherin and paxillin in mouse endometrial tissue.
Figure 4
3.5 CPPS down-regulated the expression of E-cadherin and paxillin in macrophages induced by OMP19
To investigate the potential effects of CPPS on OMP19-mediated regulation of macrophage adhesion molecule expression, E-cadherin and paxillin protein levels were analyzed by Western blot. As shown in Figure 5, OMP19 stimulation significantly upregulated the expression levels of E-cadherin and paxillin in macrophages (P < 0.001), demonstrating its role in promoting macrophage adhesive capacity. In contrast, CPPS treatment markedly attenuated the OMP19-induced upregulation of these adhesion molecules compared with OMP19 alone (P < 0.001). These data indicate that CPPS counteracts OMP19-mediated enhancement of macrophage adhesion.
Figure 5
3.6 CPPS inhibited the inward flow of Ca2+ in macrophages induced by OMP19
Ca2+, as a key second messenger, mediates the formation and maintenance of intercellular adhesion junctions by regulating calmodulin dimerization (). The effect of CPPS on OMP19-induced intracellular Ca2+ flux in macrophages was analyzed using the Fluo-4 AM fluorescent probe (Figure 6, P < 0.001). Macrophages were pretreated with CPPS (50 µg·mL-1) for 12 h, followed by stimulation with OMP19 (5 µg·mL-1) for 12 h. As shown in Figure 6, OMP19 stimulation induced a significant increase in intracellular calcium flux, as quantified by Fluo-4 AM fluorescence and evidenced by elevated fluorescence intensity (P < 0.001). CPPS pretreatment effectively restored calcium levels to baseline, demonstrating its regulatory capacity in macrophage calcium homeostasis.
Figure 6
3.7 BAPTA-AM reversed the inhibitory impact of CPPS on cell adhesion function
BAPTA-AM, a well-known membrane-permeable Ca2+ chelator, prevents cell injury by alleviating intracellular calcium overload (). To investigate whether CPPS regulates the expression of E-cadherin by modulating Ca2+ influx and thereby affects macrophage adhesion, BAPTA-AM was used for verification. The results showed that the expression level of E-cadherin in the BAPTA-AM pretreatment group was significantly higher than that in the CPPS and OMP19 combined treatment group (P < 0.01, Figure 7), indicating that BAPTA-AM pretreatment reversed CPPS-induced downregulation of E-cadherin protein expression. These findings further demonstrate that CPPS most likely inhibits E-cadherin-mediated cell adhesion by reducing calcium ion levels in macrophages.
Figure 7
3.8 CPPS inhibited the activation of signaling pathways in macrophages induced by OMP19
To investigate the effect of CPPS on OMP19-induced macrophage adhesion function, we examined the activation levels of the SYK/AKT/FAK, ERK, PKC, and WNT-1 signaling pathways. The results showed that CPPS significantly downregulated the phosphorylation levels of SYK/AKT/FAK at the corresponding time points in OMP19-stimulated cells (as shown in Figure 8A), suggesting that CPPS may hinder the cell adhesion process. At 15 and 30 min after OMP19 stimulation, ERK phosphorylation was significantly upregulated compared with the control group. In contrast, the CPPS-pretreated OMP19-stimulated group exhibited a marked downregulation of ERK phosphorylation compared with the OMP19-stimulated group (Figure 8A). These results suggest that CPPS may reduce the expression of macrophage inflammatory factors by inhibiting activation of the ERK signaling pathway. Figure 8B shows that the CPPS-pretreated OMP19-stimulated group exhibited significant downregulation of PKC and WNT-1 activation compared with the group stimulated with OMP19 alone. Classical PKC activation requires Ca2+ co-signaling, and these results are consistent with those obtained for Ca2+ influx (Figure 6).
Figure 8
3.9 Effects of ATP2A1 knockdown on the CPPS-mediated attenuation of OMP19-induced inflammatory activation and upregulation of E-cadherin and paxillin expression in THP-1 cells
ATP2A1 encodes sarcoplasmic/endoplasmic reticulum calcium ATPase 1 (SERCA1), a key regulator responsible for the reuptake of cytoplasmic Ca2+ into the endoplasmic reticulum, which plays a vital role in maintaining cellular calcium homeostasis (, ). Western blotting and RT-qPCR were performed to detect the expression level of ATP2A1 (Figure 9A). CPPS treatment significantly upregulated ATP2A1 expression in macrophages, which was consistent with the transcriptome sequencing results. To further elucidate the molecular mechanism by which ATP2A1 regulates immune responses in macrophages, siRNA-mediated knockdown assays were conducted for subsequent functional verification. RT-qPCR results (Figure 9B) revealed that OMP19 stimulation markedly upregulated the mRNA levels of TNF-α and IL-6 while downregulating IL-10 expression. CPPS treatment significantly reduced the elevated TNF-α and IL-6 levels and restored the suppressed IL-10 expression (P < 0.01). Following ATP2A1 knockdown, CPPS failed to further inhibit OMP19-induced upregulation of TNF-α and IL-6 and could not reverse the decrease in IL-10 expression, resulting in a complete loss of its anti-inflammatory effects. Meanwhile, Western blotting showed (Figure 9C) that following ATP2A1 knockdown, CPPS could not decrease OMP19-induced downregulation of E-cadherin and paxillin expression. These results confirm that the immunomodulatory effects of CPPS depend on ATP2A1-mediated regulation of cellular calcium homeostasis.
Figure 9
4 Discussion
HMGB1 is a late-stage pro-inflammatory mediator that is released in various models of cell death and injury, and it plays a critical role in mediating inflammation triggered by cell death-associated responses (). Brucella infection of trophoblasts has been shown to trigger HMGB1 release into the extracellular space (), contributing to tissue injury in reproductive organs (). In this study, CPPS significantly reduced OMP19-induced HMGB1 expression in uterine tissue, suggesting its ability to mitigate HMGB1-driven inflammatory damage. Similar anti-inflammatory effects of CPPS have been reported in LPS- and E. coli-induced lung injury models (), supporting a broader protective role against inflammatory tissue injury.
Since CPPS can alleviate OMP19-mediated uterine injury in mice, mouse peritoneal macrophages were selected as the research object for transcriptome sequencing to further elucidate the regulatory mechanism of CPPS. Transcriptomic profiling revealed that CPPS modulated gene expression patterns enriched in focal adhesion and calcium signaling pathways, suggesting functional reprogramming of macrophages under inflammatory challenge. Although E-cadherin is a classic epithelial marker, accumulating evidence has demonstrated that it regulates macrophage fusion, multinucleated giant cell formation, and participates in macrophage adhesion and migration (, ). Meanwhile, paxillin also mediates cellular adhesion, migration, and cytoskeletal remodeling (, 46). Therefore, the expression alterations of these molecules in this study mainly reflect changes in macrophage adhesion rather than epithelial tissue remodeling. Furthermore, the present study confirms that CPPS can significantly inhibit OMP19-induced upregulation of adhesion molecules such as E-cadherin and paxillin and alleviate excessive intracellular Ca2+ influx. Elrashedy et al. showed that Omp25 and Omp31 can promote bacterial adhesion and intracellular invasion (). Thus, the downregulation of adhesion molecules by CPPS may effectively limit the colonization of Brucella in macrophages.
Admittedly, OMP19 stimulation cannot represent the entire inflammatory process of Brucella-infected macrophages, which is a limitation of this study. In the future, live Brucella will be used to further investigate the regulatory effects of CPPS, thereby enhancing its translational value in the clinical treatment of Brucella infection. ATP2A1, as a core member of the endoplasmic reticulum Ca2+-ATPase family, is essential for maintaining cellular Ca2+ homeostasis (–50). Intracellular Ca2+ flux plays a dual role in host defense. Moderate Ca2+ increases promote phagosome-lysosome fusion and pathogen clearance (51), whereas sustained calcium overload can impair mitochondrial function, reduce ATP and ROS production, and exacerbate inflammation via NF-κB and NLRP3 activation (52, 53). OMP19 markedly increased macrophage Ca2+ influx in this study, potentially contributing to excessive inflammatory activation. CPPS normalized calcium levels, suggesting its ability to prevent calcium-mediated macrophage dysfunction. BAPTA-AM reversed the inhibitory effect of CPPS on cell adhesion function, supporting a mechanism involving modulation of Ca2+-dependent adhesion processes. After knockdown of ATP2A1, the anti-inflammatory effect of CPPS was completely abolished, and it failed to reverse the OMP19-induced downregulation of adhesion molecule expression.
At the signaling level, CPPS inhibited OMP19-induced phosphorylation of SYK, FAK, AKT, and ERK, all of which contribute to adhesion complex assembly and inflammatory mediator production (, , 55). Additionally, CPPS suppressed PKC activation and WNT-1 expression, pathways known to integrate calcium signaling and cytoskeletal reorganization (, ). By targeting multiple nodes in these signaling cascades, CPPS may simultaneously restrain excessive adhesion and downregulate pro-inflammatory outputs. CPPS suppressed pro-inflammatory factors (TNF-α, IL-6, CXCL-10, and MIP-1α) while enhancing anti-inflammatory IL-10 production. Similar to Ganoderma lucidum polysaccharides, which reduce the secretion levels of TNF-α and IL-6 in mouse liver (56), CPPS also exerts anti-inflammatory effects against OMP19-mediated inflammation. This may suggest that polysaccharides derived from traditional Chinese medicine generally possess anti-inflammatory properties.
This study has several limitations. Pharmacokinetic analysis of CPPS was not performed, and its in vivo metabolic profile and accumulation characteristics remain unclear. Intraperitoneal injection was adopted in animal experiments, which differs greatly from oral administration in clinical practice. Thus, the experimental dosage cannot be directly extrapolated, and the safe clinical dosage and administration frequency in humans require further investigation.
5 Conclusion
CPPS mitigates OMP19-induced uterine injury by modulating macrophage adhesion and calcium-dependent signaling. Specifically, CPPS suppresses excessive Ca2+ influx, downregulates E-cadherin and paxillin expression, and inhibits SYK/FAK/AKT and ERK phosphorylation, while attenuating PKC and WNT-1 activation. These effects collectively reduce pro-inflammatory cytokine production and enhance anti-inflammatory IL-10 expression, thereby limiting tissue damage. Further ATP2A1 knockdown experiments demonstrated that the effects of CPPS in alleviating OMP19-induced inflammatory responses are dependent on the regulation of ATP2A1 expression.
Statements
Data availability statement
The data presented in the study are deposited in the GEO repository, accession number GSE314097.
Ethics statement
This animal experiment was approved by the Medical Ethics Committee of Inner Mongolia Medical University (Approval No.: YKD202503042). All experimental procedures strictly complied with relevant ethical guidelines. The study was conducted in accordance with the local legislation and institutional requirements. No potentially identifiable images or data are presented in this study.
Author contributions
XW: Writing – original draft, Data curation. ZYZ: Writing – review & editing, Conceptualization. NZ: Data curation, Writing – review & editing. ZZh: Writing – review & editing, Data curation. XQ: Data curation, Writing – review & editing. XZ: Formal Analysis, Writing – review & editing. ZG: Methodology, Writing – review & editing. WZ: Writing – review & editing, Methodology. KL: Project administration, Writing – original draft. YS: Conceptualization, Writing – review & editing.
Funding
The author(s) declared that financial support was received for this work and/or its publication. This work was supported by Inner Mongolia Medical University Doctoral Start-up Fund Project (No. YKD2024BSQD021). National Natural Science Foundation of Inner Mongolia (No. 2023QN08051), and Inner Mongolia Medical University general project (No. YKD2023MS026).
Conflict of interest
The author(s) declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
References
1
JiangO'CallaghanDing. Brucellosis in China: history, progress and challenge. Infect Dis Poverty. (2020) 9:55. doi: 10.1186/s40249-020-00673-8. PMID:
2
PappasPapadimitriouAkritidisChristouTsianos. The new global map of human brucellosis. Lancet Infect Dis. (2006) 6:91–9. doi: 10.1016/s1473-3099(06)70382-6. PMID:
3
LiangLiuYangWangLiGuoet al. Spatiotemporal distribution of human brucellosis in Inner Mongolia, China, in 2010-2015, and influencing factors. Sci Rep. (2021) 11:24213. doi: 10.1038/s41598-021-03723-9. PMID:
4
LaineScottArenas-Gamboa. Human brucellosis: Widespread information deficiency hinders an understanding of global disease frequency. PloS NeglTrop Dis. (2022) 16:e0010404. doi: 10.1371/journal.pntd.0010404. PMID:
5
GłowackaŻakowskaNaylorNiemcewiczBielawska-Drózd. Brucella - virulence factors, pathogenesis and treatment. Pol J Microbiol. (2018) 67:151–61. doi: 10.21307/pjm-2018-029. PMID:
6
GopalakrishnanDimriMYatooPriyaGopinathet al. Virulence factors, intracellular survivability and mechanism of evasion from host immune response by brucella: an overview. J Anim Plant Sci. (2016) 26:1542–55.
7
MarchesiniSperaComerci. The 'ins and outs' of Brucella intracellular journey. Curr Opin Microbiol. (2024) 78:102427. doi: 10.1016/j.mib.2024.102427. PMID:
8
JiaoZhouLiXiaoLiZenget al. The mechanism of facultative intracellular parasitism of brucella. Int J Mol Sci. (2021) 22(7):3673. doi: 10.3390/ijms22073673. PMID:
9
LinLiLiShenDuZhenget al. The Brucella Effector Protein BspF Regulates Apoptosis through the Crotonylation of p53. Microorganisms. (2023) 11(9):2322. doi: 10.3390/microorganisms11092322. PMID:
10
MuruganNandiMazumdarJoshiNandiniNamaniet al. Outer membrane protein 25 of Brucella suppresses TLR-mediated expression of proinflammatory cytokines through degradation of TLRs and adaptor proteins. J Biol Chem. (2023) 299:105309. doi: 10.1016/j.jbc.2023.105309. PMID:
11
WeiZhangWangBaiWangYanget al. Beyond survival to domination: Brucella's multilayered strategies for evading host immune responses. Front Microbiol. (2025) 16:1608617. doi: 10.3389/fmicb.2025.1608617. PMID:
12
RenYangYangZhangRongHuanget al. Brucella outer membrane lipoproteins 19 and 16 differentially induce interleukin-18 response or pyroptosis in human monocytic cells. J Infect Dis. (2021) 224:2148–59. doi: 10.1093/infdis/jiab272. PMID:
13
García SamartinoDelpinoPott GodoyDi GenaroPasquevichZwerdlinget al. Brucella abortus induces the secretion of proinflammatory mediators from glial cells leading to astrocyte apoptosis. Am J Pathol. (2010) 176:1323–38. doi: 10.2353/ajpath.2010.090503. PMID:
14
ImParkJungKimYoo. Comparative analysis of immune responses to outer membrane antigens OMP10, OMP19, and OMP28 of brucella abortus. Jpn J Infect Dis. (2018) 71:197–204. doi: 10.7883/yoken.JJID.2017.019. PMID:
15
LopezGuaimasCzibenerUgalde. A genomic island in Brucella involved in the adhesion to host cells: Identification of a new adhesin and a translocation factor. Cell Microbiol. (2020) 22:e13245. doi: 10.1111/cmi.13245. PMID:
16
RobertsonJacquemetByronJonesWarwoodSelleyet al. Defining the phospho-adhesome through the phosphoproteomic analysis of integrin signaling. Nat Commun. (2015) 6:6265. doi: 10.1038/ncomms7265. PMID:
17
PeiHouFengLiSuZhanget al. Equine β-defensin 1 regulates cytokine expression and phagocytosis in S. aureus-infected mouse monocyte macrophages via the Paxillin-FAK-PI3K pathway. Int Immunopharmacol. (2023) 123:110793. doi: 10.1016/j.intimp.2023.110793. PMID:
18
BachmannSkripkaWeißenbruchWehrle-HallerBastmeyer. Phosphorylated paxillin and phosphorylated FAK constitute subregions within focal adhesions. J Cell Sci. (2022) 135(7):258764. doi: 10.1242/jcs.258764. PMID:
19
FoghMulthauptCouchman. Protein kinase C, focal adhesions and the regulation of cell migration. J Histochem Cytochem. (2014) 62:172–84. doi: 10.1369/0022155413517701. PMID:
20
JiangQianHawesWalsh. A domain with homology to neuronal calcium sensors is required for calcium-dependent activation of diacylglycerol kinase alpha. J Biol Chem. (2000) 275:34092–9. doi: 10.1074/jbc.M004914200. PMID:
21
XueChuShiZengLuLi. Wnt signaling pathways in biology and disease: mechanisms and therapeutic advances. Signal Transduct Target Ther. (2025) 10:106. doi: 10.1038/s41392-025-02142-w. PMID:
22
ZhengZhangYangCuiSunLianget al. MicroRNA-200c impairs uterine receptivity formation by targeting FUT4 and α1,3-fucosylation. Cell Death Differ. (2017) 24:2161–72. doi: 10.1038/cdd.2017.136. PMID:
23
DongRZhangFXWuXYNiZKWuHZLiuML. Mechanism of ATP2A1 affecting proliferation, migration, and immune infiltration in colorectal cancer [in Chinese]. J Hainan Med Univ. (2024) 30:769–778. doi: 10.13210/j.cnki.jhmu.20240313.001
24
HuangXuLinZhou. An updated overview of lipid-regulated immunobiology in macrophages. Acta Biochim Biophys Sin (Shanghai). (2026) 58:137–55. doi: 10.3724/abbs.2025239. PMID:
25
SilvaCorreia-Neves. Neutrophils and macrophages: the main partners of phagocyte cell systems. Front Immunol. (2012) 3:174. doi: 10.3389/fimmu.2012.00174. PMID:
26
TannerArthurWright. Macrophage activation, chronic inflammation and gastrointestinal disease. Gut. (1984) 25:760–83. doi: 10.1136/gut.25.7.760. PMID:
27
GaoZhangJingFengLiYang. The structural characterization and immune modulation activities comparison of Codonopsis pilosula polysaccharide (CPPS) and selenizing CPPS (sCPPS) on mouse in vitro and vivo. Int J Biol Macromol. (2020) 160:814–22. doi: 10.1016/j.ijbiomac.2020.05.149. PMID:
28
GongZhangGuCaoMaoYaoet al. Codonopsis pilosula polysaccharides attenuate Escherichia coli-induced acute lung injury in mice. Food Funct. (2022) 13:7999–8011. doi: 10.1039/d2fo01221a. PMID:
29
ShiBZHuJRLiPXuK. Immunomodulatory effects of Codonopsis pilosula polysaccharides on Ana-1 macrophages and mice [in Chinese]. Biotechnol Bull. (2019) 35(06):114–118. doi: 10.13560/j.cnki.biotech.bull.1985.2018-0889
30
ChuLiuQiuZengBaoShu. Effects of Astragalus and Codonopsis pilosula polysaccharides on alveolar macrophage phagocytosis and inflammation in chronic obstructive pulmonary disease mice exposed to PM2.5. Environ Toxicol Pharmacol. (2016) 48:76–84. doi: 10.1016/j.etap.2016.10.006. PMID:
31
LiJuWenZuoWangZhanget al. Screening of codonopsis radix polysaccharides with different molecular weights and evaluation of their immunomodulatory activity in vitro and in vivo. Molecules. (2022) 27(17):5454. doi: 10.3390/molecules27175454. PMID:
32
QinRenLinSongLiMaet al. Effects of selenizing codonopsis pilosula polysaccharide on macrophage modulatory activities. J Microbiol Biotechnol. (2016) 26:1358–66. doi: 10.4014/jmb.1601.01094. PMID:
33
MengXuChangQiuHuWuet al. Extraction, characterization and anti-inflammatory activities of an insulin-type fructan from Codonopsis pilosula. Int J Biol Macromol. (2020) 163:1677–86. doi: 10.1016/j.ijbiomac.2020.09.117. PMID:
34
GolchinMollayiMohammadiEskandarzade. Serodiagnosis of human brucellosis by an indirect ELISA test using recombinant outer membrane protein 19 kDa (rOMP19) as an antigen. BMC Bio/Technol. (2023) 23:46. doi: 10.1186/s12896-023-00817-2. PMID:
35
GolchinMollayiMohammadiEskandarzade. Development of a diagnostic indirect ELISA test for detection of Brucella antibody using recombinant outer membrane protein 16 kDa (rOMP16). Vet Res Forum. (2022) 13:387–91. doi: 10.30466/vrf.2021.524590.3141. PMID:
36
WuLiuMaoFengYaoBaiet al. Prostaglandin E2 Regulates Activation of Mouse Peritoneal Macrophages by Staphylococcus aureus through Toll-Like Receptor 2, Toll-Like Receptor 4, and NLRP3 Inflammasome Signaling. J Innate Immun. (2019) 12(2):154–169. doi: 10.1159/000499604. PMID:
37
HunterSawaEdlundObrink. Evidence for regulated dimerization of cell-cell adhesion molecule (C-CAM) in epithelial cells. Biochem J. (1996) 320:847–53. doi: 10.1042/bj3200847. PMID:
38
FuFanZhouZhaoHe. Elimination of intracellular calcium overload by BAPTA-AM-loaded liposomes: A promising therapeutic agent for acute liver failure. ACS Appl Mater Interfaces. (2019) 11:39574–85. doi: 10.1021/acsami.9b13690. PMID:
39
ChemalyTronconeLebeche. SERCA control of cell death and survival. Cell Calcium. (2017) 69:46–61. doi: 10.1016/j.ceca.2017.07.001. PMID:
40
JinKimWillertKlein-RodewaldGarcia-DominguezMosqueiraet al. Ebf factors and MyoD cooperate to regulate muscle relaxation via Atp2a1. Nat Commun. (2014) 5:3793. doi: 10.1038/ncomms4793. PMID:
41
MantonicoDe LeoQuiliciColleyDe MarchisCrippaet al. The acidic intrinsically disordered region of the inflammatory mediator HMGB1 mediates fuzzy interactions with CXCL12. Nat Commun. (2024) 15:1201. doi: 10.1038/s41467-024-45505-7. PMID:
42
XiaoLiGuoZengShuaiGuoet al. Inflammatory mechanism of brucella infection in placental trophoblast cells. Int J Mol Sci. (2022) 23(21):13417. doi: 10.3390/ijms232113417. PMID:
43
Oliveira. Host immune responses and pathogenesis to brucella spp. Infection. Pathogens. (2021) 10(3):288. doi: 10.3390/pathogens10030288. PMID:
44
BrooksGlogauerMcCulloch. An overview of the derivation and function of multinucleated giant cells and their role in pathologic processes. Am J Pathol. (2019) 189:1145–58. doi: 10.1016/j.ajpath.2019.02.006. PMID:
45
Van den BosscheLaouiNaessensSmitsHokkeStijlemanset al. E-cadherin expression in macrophages dampens their inflammatory responsiveness in vitro, but does not modulate M2-regulated pathologies in vivo. Sci Rep. (2015) 5:12599. doi: 10.1038/srep12599. PMID:
46
ChoiZarenoDigmanGrattonHorwitz. Cross-correlated fluctuation analysis reveals phosphorylation-regulated paxillin-FAK complexes in nascent adhesions. Biophys J. (2011) 100:583–92. doi: 10.1016/j.bpj.2010.12.3719. PMID:
47
ElrashedyNayelSalamaSalamaHasan. Bioinformatics approach for structure modeling, vaccine design, and molecular docking of Brucella candidate proteins BvrR, OMP25, and OMP31. Sci Rep. (2024) 14:11951. doi: 10.1038/s41598-024-61991-7. PMID:
48
SasakiTakaseKoebisAibaTakahashiYamauchiet al. MCARE enhances SERCA1 activity in fast-twitch muscle to maintain calcium handling and muscle integrity. Nat Commun. (2025) 17:629. doi: 10.1038/s41467-025-67358-4. PMID:
49
XuVan Remmen. The SarcoEndoplasmic Reticulum Calcium ATPase (SERCA) pump: a potential target for intervention in aging and skeletal muscle pathologies. Skelet Muscle. (2021) 11:25. doi: 10.1186/s13395-021-00280-7. PMID:
50
ZhangChenZhangGupteHamilton. The role of calcium signaling in melanoma. Int J Mol Sci. (2022) 23(3):1010. doi: 10.3390/ijms23031010. PMID:
51
PradhanRaj AbrahamShrivastavaMukhopadhyay. Calcium signaling commands phagosome maturation process. Int Rev Immunol. (2019) 38:57–69. doi: 10.1080/08830185.2019.1592169. PMID:
52
Adam-ViziStarkov. Calcium and mitochondrial reactive oxygen species generation: how to read the facts. J Alzheimers Dis. (2010) 20 Suppl 2:S413–26. doi: 10.3233/jad-2010-100465. PMID:
53
KuznetsovMargreiterAusserlechnerHagenbuchner. The complex interplay between mitochondria, ROS and entire cellular metabolism. Antioxidants (Basel). (2022) 11(10):1995. doi: 10.3390/antiox11101995. PMID:
54
CoopmanDoBarthBowdenHayesBasyuket al. The Syk tyrosine kinase suppresses Malignant growth of human breast cancer cells. Nature. (2000) 406:742–7. doi: 10.1038/35021086. PMID:
55
LucasLuoStow. ERK1/2 in immune signaling. Biochem Soc Trans. (2022) 50:1341–52. doi: 10.1042/bst20220271. PMID:
56
ZhangFengWangJiaZhang. Characterization and hepatoprotections of Ganoderma lucidum polysaccharides against multiple organ dysfunction syndrome in mice. Oxid Med Cell Longev. (2021) 2021:9703682. doi: 10.1155/2021/9703682. PMID:
Summary
Keywords
ATP2A1, Brucella outer membrane protein 19, calcium signaling, cell adhesion, Codonopsis pilosula polysaccharides, uterine damage
Citation
Wang X, Zhou Z, Zhang N, Zhang Z, Qi X, Zhang X, Gong Z, Zhong W, Liu K and Shen Y (2026) Codonopsis pilosula polysaccharide attenuates the inflammatory response in macrophages induced by Brucella abortus outer membrane protein 19 via regulating ATP2A1 to modulate cell adhesion and calcium signaling. Front. Immunol. 17:1831002. doi: 10.3389/fimmu.2026.1831002
Received
15 March 2026
Revised
10 May 2026
Accepted
15 May 2026
Published
02 June 2026
Volume
17 - 2026
Edited by
Namita Rout, Tulane University, United States
Reviewed by
Sridhar Kavela, Chaitanya (Deemed to be University), India
M. Saminathan, Indian Veterinary Research Institute (IVRI), India
Updates
Copyright
© 2026 Wang, Zhou, Zhang, Zhang, Qi, Zhang, Gong, Zhong, Liu and Shen.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Yuan Shen, shenyuan0911@163.com; Kun Liu, liukun8066340@163.com
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.