Larvae of P. japonica were sourced from a commercial sod farm near Murfreesboro, TN and collected in April 2022. Larvae used for midgut assays were maintained by placing them in individual cells of ice cube trays and fed with carrot strips. In July 2022, field collected, adult female P. japonica used in the dsRNA feeding trials were shipped overnight from Michigan State University. The beetles were maintained in a container with sifted soil and fed on a diet of crape myrtle (Lagerstroemia indica) and rose (Rosa spp.) flowers. Female and male beetles were separated based on the morphology of the tibial spur and only insects that were free of obvious morphological defects or injuries were used in experiments (5).

To form the BAPCs, two monomeric peptides, bis(Ac-FLIVI)-K-K₄-CONH₂ and bis(Ac-FLIVIGSII)-K-K₄-CONH₂, were synthesized using solid phase peptide synthesis as previously described by Avila et al. (2018) (25). These peptides are referred to as H5 and H9, respectively, after the number of residues in the hydrophobic branches. After synthesis, dried peptide was dissolved in trifluoroethanol (TFE). Concentration of each peptide was determined by measuring the absorbance of phenylalanine and subsequently dividing that value by two to account for the two phenylalanine residues per peptide. The two peptides were then mixed in equimolar ratios to create a 1mM final stock. TFE was then evaporated off using a FreeZone2.5 and refrigerated Centrivap Concentrator vacuum system (LabConco). BAPCs were assembled by adding 1 mL nuclease-free water and allowing the solution to sit at room temperature for 5 min, followed by an incubation at 4°C for at least 1 hr. At room temperature, the peptides spontaneously assemble into a bilayer and fuse, and the shift to 4°C slows the fusing of complexes and locks the BAPCs in a size range of 50-250 nm. At room temperature, the peptides spontaneously assemble into a bilayer and fuse, and the shift to 4°C slows the fusing of complexes and locks the BAPCs in a size range of 50-250 nm. BAPC-dsRNA complexes were formed by mixing the appropriate concentration of BAPCs with 1μg dsRNA and allowing the mixture to sit for 15 min at room temperature.

To form rhodamine-labelled BAPCs (Rh-BAPCs), half of the bis (Ac-FLIVI)-K-K₄-CONH₂ component was substituted with the same peptide labeled with the N-hydroxysuccinimide ester of rhodamine B covalently attached to the ϵ-amino group of the C-terminus lysine (bis (Ac-FLIVI)-K-K₃-K(Rh)-CONH₂). This resulted in a final molar ratio of 1 H9: 0.5 H5: 0.5 Rh-H5. Rh-BAPC-dsRNA complex were formed as described for unlabeled BAPC-dsRNA complexes.

BAPCs and BAPC–dsRNA complexes were suspended in a buffer simulating midgut pH, then size was measured via DLS using the Zetasizer Nano ZS (Malvern Instruments Ltd., Westborough, MA). A 500μM stock of BAPCs was prepared following the protocol previously described. BAPCs were then complexed with 1 µg of dsRNA if needed, and the BAPCs or BAPC-dsRNA complexes were transferred to phosphate buffered saline solution (pH = 7.4). Samples were incubated at room temperature for 5-10 minutes prior to analysis, and all DLS measurements were performed in triplicates. For the gel retardation assay, BAPC-dsRNA complexes of 20μM and 60μM BAPCs complexed with 1μg dsRNA were assembled and incubated in pH 7.4 buffer as described above. Following, complexes were mixed with RNA gel loading dye (Invitrogen, Waltham, MA) at a 1:1 ratio. Samples were then resolved onto a 2% agarose gel composed of 1× MOPS buffer and SYBR green stain, then electrophoresed at 100 V for 30 min. Control wells containing 1 μg of dsRNA only and BAPC concentrations of 20µM and 60 µM without dsRNA were included. The gel was imaged using ImageQuant LAS 4000 (GE Healthcare, Pittsburgh, PA, USA).

Due to availability of only five known mRNA sequences of P. japonica in NCBI database, we chose peritrophin, one of the available sequences, as a target for RNAi. Peritrophins play key protective roles during food processing in feeding life stages, growth, and development of larvae. To synthesize dsRNA, first total RNA was extracted from the gut tissue of P. japonica using a commercially available TRIzol reagent. After purification of total RNA, the RNA was reverse transcribed to cDNA using SuperScript II First-Strand Synthesis System, and the genomic DNA was removed by DNase I treatment (Invitrogen). The synthesized cDNA was then used as a template for the amplification of the peritrophin gene segment using following primers; forward primer: GCTGGTACCTACTTCAATCC, reverse primer: CATACAACCTGCATCTTCGG. Both primers were designed manually to amplify the peritrophin gene segment of ~300 bps with T7 promoter sequence flanking at 5’ end of both primer sequences. Upon amplification and purification of T7 flanked peritrophin DNA, sense and antisense RNA strands were synthesized separately as per manufacturer protocol using TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific™, Carlsbad, CA, USA). After transcription, the sense and antisense single-stranded RNA (ssRNA) were purified using LiCl precipitation, quantified using nanodrop and resuspended in duplex buffer (Integrated DNA Technologies Inc., USA). For annealing, both RNA strands were mixed in 1:1 molar ratio and annealed as recommended by the supplier. The quality of dsRNA was verified by 1% agarose gel electrophoresis and using a Nanodrop technique. In addition, we synthesized dsRNA sequence non-specific to P. japonica and used as a non-specific control.

One day prior to the experiment, 120 adult female beetles were randomly selected from a container and transferred to a plastic cup (Dart, Mason, MI) and deprived of food for 24 hr prior to feeding. Whatman GF/A filter papers (25 mm diam., Cytivia life sciences, Marlborough, MA) were cut into quarters and pinned between two 5 x 5 mm pieces of transparency film (Tri-state Visual Products, Highland Heights, KY) using stainless steel insect pins. Each filter paper quarter was treated with 40 µL of a 1 M sucrose solution and allowed to dry for 12 hr prior to applying the treatment to promote adult beetles feeding. Adult P. japonica will feed on filter papers amended with 1 M sucrose (31). Upon drying, filter papers for seven different treatment groups and 15 biological replicates were prepared by applying 40 µL of BAPC-dsRNA complexes.

On day 0, 100 food-deprived beetles were selected for the survivorship assay. Individuals were tested for vigor by flipping them on their dorsum and used only if they could right themselves within 5 min. Selected beetles were then transferred into an individual wax-bottomed plastic cup and randomly assigned to one of the seven treatments. Three extra beetles were randomly selected, deprived of food for 24 hr and their midgut tissues were isolated and preserved in TRIzol to assess effect of starvation on peritrophin gene expression. Once the beetles were transferred to wax-lined cups, filter paper quarters with BAPC complexes were placed inside and all beetles were transferred into a growth chamber at 25 ± 0.5° C. Beetles were allowed to feed until a treatment group had consumed either an average of 2/3 (66%) of the filter paper or 24 hr whichever occurred first. Post feeding, all filter papers were replaced with leaf disks (20 mm diam.) taken from freshly collected Virginia creeper (Parthenocissus quinquefolia) foliage, followed by replacement of these leaf disks daily until day 6. Until the end of experimental protocol or observed mortality, beetles were tested daily for vigor as previously described. Beetles that failed to vigor response were considered dead and eliminated from the study. Three beetles from each group were selected at random and dissected to isolate gut tissue for RNA extraction and analysis.

On day 7, a second dose of respective treatments was administered to surviving beetles through filter papers using the same methodology as described above. Data on survivorship was collected every 24 hr until day 14. Filter paper consumption was calculated using Image-J (32) by collecting the filter papers quarters after both doses. The area of filter paper after the assays was measured then a percentage of area consumed was calculated based on the initial area. The initial area was the average of six filter paper quarters not provided to beetles.

Total RNA was isolated from adult P. japonica gut tissue with TRIzol Reagent (TRIzol (Ambion, Inc., Carlsbad, CA, USA). RNA concentration was measured using nanodrop and quality was evaluated using 260/280 and 260/230 ratio. cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA) according to manufacturer instructions and used as a template for the RT-qPCR. Each RT-qPCR sample contained 10 µL of synthesized cDNA, 0.8 µL of each primer (10 μM forward and reverse), 0.9 µL of nuclease free ddH2O, and 12.5 µL of Perfecta Sybr Green Supermix (Quanta Biosciences, Gaithersburg, MD, USA); totaling 25 µL. All reactions were performed using SYBR Green Master Mix and amplified under the following cycling conditions: beginning cycle at 95°C, 40 cycles at 95°C for denaturation, followed with 30 s at 65°C for annealing and extension, and ending with generation of a melting curve consisting of a single peak to rule out non-specific product and primer dimer formations. Each treatment group contained three biological replicates and two technical replicates. The expression levels of peritrophin and the number of transcripts per sample was estimated based on the Ct value. Due to unavailability of housekeeping gene sequences in P. japonica, we used β-actin gene sequence from the closely related species Oryctes rhinoceros (Coleoptera: Scarabaeidae) to design primers and used as an internal loading control. Generated cDNA was then used to quantify changes in gene expression levels among different treatment groups by RT-qPCR. The expression levels of the genes were determined by 2−ΔΔCt* proportional calculation method. (The fold changes in peritrophin transcript levels relative to the β-actin). For statistical analysis, we performed a one-way ANOVA with Tukey’s post-test to evaluate differences between treatment group P < 0.05.

To elucidate if transcytosis was involved in the translocation of BAPCs through midgut epithelium cells, live third instar P. japonica larvae were dissected to isolate the midgut tissues. The preparation for assays in the Ussing chamber have been described in our previous work (29). Larvae used in this assay were stored in a fridge at 4°C for 48 hr prior to dissections to stabilize the gut tissues. Incisions were made along the lateral-medial line of the larvae from the anterior to the posterior using corneal scissors. Insect pins were then used to secure the integument onto the dissection tray and expose the digestive tract. Incisions were performed on the midgut by making lateral-medial incisions anteriorly from the third gastric caecum. The tissues were then isolated from the body, rinsed with insect physiological solution described previously (29), and immediately mounted onto a modified 0.01 cm² slide. Dissected midgut tissue from larvae was inserted into a tissue holder slide which was placed inside of a Ussing chamber. This chamber creates an ex vivo gut environment through which transport of molecules across tissue may be studied. Buffer containing rhodamine dye labelled BAPCs was added to the luminal side of the tissue, and transcellular transport was determined by measuring rhodamine dye fluorescence on luminal as well as hemolymph side at discrete time points. Dissections were conducted with meticulous effort to avoid tissue punctures and to conserve orientation of the tissue relative to the lumen and the hemolymph.

After mounting, slides were slotted into the two-sided chamber, where tissues were then perfused with 3 mL of lumen or hemolymph buffer according to tissue orientation (29). To study the effect of inhibiting endocytosis on the transport of BAPC-dsRNA complexes, three replicate tissues were pre-incubated with 10µM chlorpromazine (CPZ) for 30 min before the addition of Rh-BAPC-dsRNA complexes. A final concentration of 50 µM Rh–BAPCs with or without 1 µg dsRNA was then added to the lumen side. Tissues were exposed for a period of 120 min, after which fluorescence was read using a BioTek Cytation 3 plate reader (λex = 544 nm; λem = 576 nm). Change in relative fluorescence over time was plotted to visualize the transport of Rh-BAPCs due to transcytosis. Fluorescence was measured in arbitrary fluorescence units (AFU’s). To account for the variability of relative fluorescence between replicates, data were normalized using proportions.

Data analysis and plots were done using GraphPad Prism (version 8.0.0 for Windows, GraphPad Software, San Diego, California USA). To estimate the sample size in the survivorship assay, we employed the “resource equation method” (33). For survival curves we used the Log Rank Test. For the gene expression analysis, consumption of filter papers, and DLS experiments, we used one-way ANOVA using Tukey as post-test. Transcytosis experiments were analyzed using two-way ANOVA and Tukey as post-test. An alpha level of P<0.05 was used for all analyses.

Males often perform less consistently in feeding assays relative to females because their behavior is more directed toward mating (31). Thus, we included adult females exclusively to evaluate the efficiency of the BAPCs to deliver dsRNA targeting peritrophin through feeding. As described in the methods section, the BAPC-dsRNA complexes were applied on filter-paper containing sucrose, a common phagostimulant used in P. Japonica assays (34, 35). The potential of BAPCs to deliver dsRNA in P. japonica was evaluated through survival assay and gene expression analysis.

We delivered two doses of BAPC-dsRNA complexes through feeding on day 0 and day 7, allowing them to feed on the treatment up to 24 hr ( Figures 1A, B ). Subsequently, we monitored all beetles daily for mortality up to 14 days (normal life span of adult P. japonica is 30-45 days). Survivorship by 14 days was only 33% in insects fed on diets containing 1 μg dsRNA+60 μM BAPCs (t_{1/2 =} 7 _d). On the other hand, 60% and 53% survivorship were observed at 14 days in beetles fed only dsRNA and untreated control groups, respectively. This difference in survivorship was not significant as determined by a log-rank test (Day 7: P= 0.12 & Day 14: P = 0.6, df= 1). Feeding of beetles on a diet of non-specific (non-peritrophin) dsRNA or with lower BAPCs concentration (1 μg dsRNA+ 20 μM BAPCs) also had no effect on survival (t_{1/2 =} 14 _d) ( Figure 1C ).

Consumption of filter papers vary greatly among individuals within same treatment group, therefore the average dosage delivered would be lower than provided. We calculated surface area of filter paper consumed as a proxy for dose ingested within 24 hr before being replaced with a diet of Virginia creeper leaf discs. On average, 38% of the filters were consumed across treatments, with an average of 22% of the filter paper consumed in the control dsRNA treatment ( Supplementary Figure 1 ) (P<0.01, F = 3.087, Dfn =6, Dfd=139). Thus, less than 1 μg of dsRNA dose is sufficient to induce significant knockdown effects when delivered with the aid of an effective concentration of BAPCs.

We quantified the peritrophin transcript levels by RT-qPCR analysis to confirm that dsRNA induced gene silencing in the targeted gene. Ingestion of 20 μM BAPCs+ 1 μg dsRNA resulted in a 30-fold decrease in peritrophin gene expression, which was significantly different (P<0.05, F= 6.840, Dfn= 4, Dfd= 10) from the dsRNA alone group. Similarly, 60 μM BAPCs+ 1 μg dsRNA had the greatest gene silencing rate, with knockdown of expression by approximately 34-fold relative to non-treated control group ( Figure 2 ). Although, quantification of the mRNA transcripts is congruent with the trends observed in the survivorship study, our results support the concept of BAPCs nanoparticles acting as dsRNA stabilizer, and cellular uptake enhancer. Furthermore, we also analyzed the integrity of the BAPCs formulations by measuring the size in a buffered solution with a pH similar to the P. japonica midgut (pH=7.4) (5).

From a biophysical perspective, the stability or integrity of nanoparticles is used to describe the preservation of a particular nanostructure property (i.e., size). We assessed BAPCs stability by incubating in buffer of pH 7.4 using dynamic light scattering (DLS), According with Figure 3A , the BAPCs–dsRNA complexes displayed a size ranging between 250 to 350 nm, a size that is consistent with our previously reported DLS measurements performed in distilled water (29). BAPCs (60 μM) not associated with dsRNA exhibited a significant (F = 10.45, P= 0.0002, Dfn=3, Dfd=20) smaller hydrodynamic diameters than the BAPC-dsRNA complexes, confirming that the association of dsRNA increases the size of the BAPCs or causes BAPCs to cluster together. Furthermore, these results indicate that the complexes do not dissociate or aggregate in the buffered solution, proving structure stability in a pH environment consistent with the gut of P. japonica adults. Although multiple variables can play a role in nanoparticle stability inside the midgut, the pH is critical since it can lead to variation in nanoparticle charge and oxidation state. Regarding nuclease degradation of dsRNA, studies performed in mammalian cells support the notion that BAPCs protect dsRNA against nuclease degradation (29, 36). Target sites of RNAs might no longer be accessible to the catalytic core of RNases after the association with the BAPCs surface (37). It is important to mention that nucleases exclusively affect the dsRNA structure and not BAPCs. The downregulation of the peritrophin transcript levels also support the notion of nuclease protection conferred by BAPCs.

To elucidate the dsRNA binding capacity of BAPCs at concentrations used for the survivorship assay, we evaluated their electrophoretic mobility in a 2% RNA agarose gel. Our results indicated that association of dsRNA with the BAPCs surface led to a decreased migration of dsRNA that was dependent on BAPC concentration ( Figure 3B ). The formulation with the highest BAPCs concentration (60 μM) displayed a barely visible band, suggesting that all added dsRNA has firmly adhered to the BAPCs surface, which resulted in a poor interaction with the dye SYBR green. However, lower concentrations of BAPCs yielded a more visible dsRNA band, indicating more availability for SYBR green binding due to a weaker interaction of BAPCs and dsRNA. As expected, BAPCs not complexed with dsRNA showed no signal in the well.

The alimentary tract of adult and 3^rd instar larval stages of P. japonica have only been described in separate publications with supporting hand illustrations (38, 39) respectively. More recent photo images of the digestive tract of neonate and 3^rd instar grubs have been published (40). Here, for the first time we present comparative images of the 3^rd instar larval and adult alimentary tracts juxtaposed to highlight the morphological differences (Gryphax^® Series Avior microscope camera, Jenoptic, Jena, Germany). These images confirm previous descriptions (38, 41) stating the adult midgut is narrower in width relative to the larval midgut. Through the many dissections for the reported experiments, we noted less tissue strength of the adult gut leading to those tissues tearing and shearing more easily than the larval midgut tissues ( Figures 4A, B ). The width and sensitivity of the adult midgut tissue was an obstacle to study BAPC-dsRNA complexes cellular uptake and transport across gut tissue. Consequently, only the larval midgut tissues were used to study these mechanisms in P. japonica. For larval dissections, we used the third gastric caecum to delineate between midgut and hindgut tissues ( Figure 4A ).

BAPCs and BAPC-dsRNA complexes transport across the gut tissue was assessed with the help of Ussing chamber ( Figures 5A, B ). Both formulations are actively transported across the gut tissue, with around 50% reduction in rhodamine fluorescence on luminal compartment ( Figure 5C ). However, BAPCs complexed with dsRNA slows significantly(P<0.05, F= 5.841, Dfn=2, Dfd=6). the rate of transcellular transport compared to only BAPCs ( Figure 5D ). A plausible reason for the diminished transport can be related to the binding of the negatively charged dsRNA to the surface of BAPCs. The dsRNA association blocks a portion of the positively charged lysine residues exposed on the BAPCs surface thus becoming less cationic, and reducing cellular uptake by epithelial cells (42) ( Figure 5 ).

To assess the role of endocytosis on the uptake of BAPC-dsRNA complexes, gut tissue was pre-incubated for 30 min with chlorpromazine, an inhibitor of clathrin-mediated endocytosis. Clathrin-mediated endocytosis is one of the major pathways by which cells transport extracellular cargo from outside the cell membrane to the interior via the formation of clathrin-coated endocytic vesicles. Following CPZ addition, Rh-BAPC-dsRNA complexes were added to luminal side, and the relative change in rhodamine fluorescence was measured as described earlier. As Rh-BAPCs are taken up from the luminal side, it is expected that fluorescence of this compartment will decrease. Subsequently, movement via transcytosis will deposit endocytosed Rh-BAPCs to the hemolymph compartment, increasing its fluorescence over time (29). Treatment of gut tissue with endocytic inhibitor abrogated BAPC-dsRNA uptake from luminal side with no change in rhodamine fluorescence up to 2h ( Figure 5C ). Similarly, there was no significant increase in rhodamine fluorescence was observed on hemolymph side ( Figure 5D ). It is also expected that a fraction of BAPCs or BAPCs-dsRNA remain trapped within the P. japonica gut cells, particularly in endosomal vesicles such as endosomes and lysosomes (43–45). Retrograde transport is also possible and has been documented for other nanoparticles (45). In other words, only some of the material that enters cells will undergo transcytosis.

Overall, these results indicate that cellular uptake of BAPCs and BAPC-dsRNA complexes is mediated by clathrin coated endocytic vesicle. Nonetheless, cellular uptake is a complex process and potentially other mechanisms can also be involved in the uptake of BAPCs formulations.