Abstract
RNA interference (RNAi) is an eco-friendly strategy for pest management, with double-stranded RNA (dsRNA) as the core functional component. In this study, three RNAi target genes (Ubx, wupA and Dpp) with strong lethal effects on Apolygus lucorum were screened via microinjection. The 7-day cumulative mortalities were 56.67 ± 3.33% for dsUbx, 94.44 ± 1.11% for dswupA and 92.22 ± 1.11% for dsDpp. We optimized dsRNA sequences by removing conserved sequences in non-target organisms based on homology alignment and off-target risk analysis. The optimized fragments dswupA-OTE and dsDpp-OTE still exhibited high insecticidal activity, with 7-day cumulative mortalities of 77.78 ± 2.94% and 70.00 ± 1.93%, respectively. We also evaluated the effects of dsRNA length and target sites on RNAi efficiency and screened potent short dsRNA fragments. Novel artificially recombinant dsRNAs were constructed by assembling effective short fragments from different genes, which retained strong insecticidal activity despite shorter sequence length. This study verifies the feasibility of multi-target recombinant dsRNA for pest control and provides a theoretical basis for developing multi-gene RNAi technologies against A. lucorum.
1 Introduction
RNA interference (RNAi) is a conserved post-transcriptional gene silencing mechanism triggered by double-stranded RNA (dsRNA), and has emerged as a promising tool for sustainable pest management. (). Its agricultural feasibility has been demonstrated by several commercial products, such as the transgenic maize MON87411 in 2017 and the sprayable dsRNA biopesticide Ledprona and Vadescana in 2023 and 2025, respectively (–). In 2026, the Institute for the Control of Agrochemicals (ICAMA) under China’s Ministry of Agriculture and Rural Affairs issued a public notice indicating its intention to approve the country’s first RNA pesticide. These successful cases lay a solid foundation for the commercialization of RNAi-based pest control technologies. However, the successful application of RNAi still relies on continuous discovery of efficient target genes and optimization of dsRNA delivery parameters, especially for pests that are not adequately controlled by conventional approaches.
dsRNA length and target sequence position are two key parameters that profoundly influence RNAi efficiency, and their effects have been extensively documented across different insect species, highlighting the need for systematic optimization for each target pest. dsRNA length markedly affects RNAi efficiency, with long dsRNAs generally exhibiting stronger silencing than siRNAs (), though optimal length varies among species (). In Drosophila, 400–540 bp dsRNAs effectively silenced cyclin E, whereas 200–300 bp fragments were weak and 50–100 bp inactive (), and the minimum efficient length in S2 cells was 211 bp (). In Manduca sexta, a 2222 bp dsRNA gave higher mortality (56.8%) than a 259 bp one (47.8%) (). However, short dsRNAs (<40 nt) can also be effective via oral delivery (), 21 bp injection silenced a salivary gene in aphids (), and 15–25 bp siRNAs silenced two termite genes (). Thus, dsRNA length should be optimized per gene considering efficiency and off-target risks. Target sequence position also modulates RNAi performance: fragments covering the 3′ region of V-ATPase E were more active in Nilaparvata lugens (), whereas in A. lucorum different regions of JHEH showed comparable effects () indicating species- and gene-dependent influences of target position.
In addition to optimizing dsRNA design parameters, multi-target combination strategies have been developed to overcome the limited efficacy and biosafety concerns of single-gene dsRNAs. By fusing short effective fragments from multiple essential genes, this approach simultaneously disrupts several key pathways, achieving high mortality at low doses with reduced off-target effects (). For example, fusion dsRNAs targeting 3–6 salivary protein genes in aphids caused 60% mortality in Myzus persicae, markedly higher than the 28–38% from single-gene dsRNAs (). In M. persicae and Bemisia tabaci, two fusion constructs (dsAbd-A-Rpl27a-H3 and dsScr-Abd-A-H3) achieved peak mortalities of 59.08% and 45.33%, respectively, with low off-target risk to the predator Propylaea japonica (). In A. lucorum, a dual-target dsRNA against ECR-A and Tre-1 delivered with SPc nanocarriers gave 83% nymph mortality upon spray application, significantly exceeding single-target treatments (). These findings support the multi-target strategy as a promising direction for RNAi-based pest control.
The mirid bug Apolygus lucorum (Hemiptera: Miridae) is a polyphagous pest that infests over 200 host plants, including cotton, fruit trees and vegetables (, ). In cotton fields, the widespread cultivation of Bacillus thuringiensis (Bt) transgenic crops has effectively suppressed lepidopteran pests but provides poor control against hemipterans due to the lack of functional Bt receptors (, ). Consequently, A. lucorum has become a dominant pest, cause abscission or malformation of leaves, flowers and fruits (). The management for A. lucorum still relies heavily on chemical insecticides, which have led to resistance development and environmental concerns (, ). Therefore, novel eco-friendly strategies are urgently needed. Previous studies have explored RNAi‐based control of A. lucorum by targeting genes involved in metabolism or stress responses, and have achieved moderate lethal effects (–). For example, microinjection-based RNAi screens in A. lucorum have identified multiple lethal targets (e.g., Alucβ-actin, V-ATPase subunits, AlLIM, and Al6), with Alucβ-actin giving the highest mortality (82.32%), AlLIM yielding 38–81% mortality, and silencing Al6 significantly reducing feeding, weight, and survival. However, several critical gaps remain, specifically that the influence of dsRNA design parameters (fragment length and target sequence position) on RNAi efficiency has not been optimized for A. lucorum despite their known species-dependent variability, and that single-target dsRNAs often confer limited mortality whereas multi-target combination strategies that simultaneously silence multiple essential genes may offer improved efficacy.
To address these gaps, we selected four key genes that are integral to insect development and signaling pathways: Ubx (Ultrabithorax), which represses wing-related genes and activates haltere-specific genes (–); wupA, encoding troponin critical for muscle development (, ); Dpp (Decapentaplegic), involved in embryonic patterning, appendage differentiation and oogenesis (–); and PP1, a serine/threonine phosphatase with diverse regulatory functions (). These genes have not been previously examined as RNAi targets in A. lucorum, and their essential roles suggest that their knockdown could cause strong deleterious effects. In addition, we designed dsRNAs of varying lengths and targeting different regions of these genes to determine the optimal design for maximal silencing. We also constructed a fused dsRNA combining effective fragments from multiple targets to test whether a multi-target approach could produce synergistic mortality.
2 Materials and methods
2.1 Test insects
A. lucorum were collected from the experimental field of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences in Langfang, Hebei Province. The insects were reared in plastic containers (20 × 10 × 6 cm³) with corn and kidney beans as food. Rearing conditions were set at 27 ± 1 °C, relative humidity of 60 ± 5%, and a photoperiod of 15 h light: 9 h dark (L:D = 15:9). Healthy third-instar nymphs were used in all experiments.
2.2 Screening and sequence analysis of target genes
Four key genes associated with insect development, namely PP1, Ubx, wupA and Dpp, were selected in this study. Their nucleotide sequences were retrieved from the NCBI database with the following accession numbers: PP1 (XM_014431150.1), Ubx (XM_024359729.1), Dpp (NM_164488.2) and wupA (MH001571.1). All sequences were aligned against the transcriptome data of A. lucorum established in our laboratory. The GFP gene (GenBank Accession No.U76561) was used as the negative control.
2.3 Prediction of off-target sequences
Referring to the criteria described by Kulkarni et al. (), a continuous 19 bp homologous region between dsRNA and mRNA of non-target organisms was defined as an off-target site. Accordingly, sequences containing continuous 19 bp identical fragments with genes from non-target organisms were regarded as potential off-target sequences in this study.
2.4 Total RNA extraction and cDNA synthesis
Whole adults of A. lucorum (3–5 individuals) were collected, and total RNA was extracted using Trizol reagent (Invitrogen, USA) following the manufacturer’s protocols. RNA integrity was assessed via 1% agarose gel electrophoresis, while concentration and purity were determined using a NanoDrop 2000 spectrophotometer. First-strand cDNA was synthesized from 1 μg of total RNA with the RevertAid First Strand cDNA Synthesis Kit (Fermentas, USA). The obtained cDNA was stored at −20 °C for subsequent use.
2.5 Preparation and sequence optimization of dsRNA templates
Specific primers were designed using Premier 5.0 software based on the sequences of PP1, Ubx, wupA and Dpp from A. lucorum. Target fragments were amplified by PCR using the synthesized cDNA as the template. The PCR products were purified by gel extraction, ligated into the pEASY-Blunt vector (TransGen Biotech, Beijing), and transformed into Escherichia coli Trans1-T1 competent cells. Positive clones were selected and verified by sequencing. Referring to the criteria established for Drosophila melanogaster by Kulkarni et al. (), continuous identical sequences of 19 bp or longer between dsRNA and genes of non-target organisms were defined as potential off-target sites. The original dsRNA target sequences of Ubx, wupA and Dpp were subjected to blastn searches in the NCBI database. Homology with other organisms, especially beneficial non-target species, was manually analyzed and recorded. Regions containing continuous identical sequences longer than 19 bp shared with non-pest organisms were identified as risky sites and removed. By contrast, regions homologous only to other pest species, designated as universal target site, were retained. After optimization, new target fragments including wupA-OTE, Dpp-OTE and a series of Ubx-ss fragments were obtained.
2.6 Preparation of templates with T7 promoter and dsRNA synthesis
PCR amplification was performed using sequence-verified plasmids as templates and specific primers containing the T7 promoter sequence (TAATACGACTCACTATAGGGAGA). The total volume of each PCR reaction was 200 μL with 2× Easy Taq Mix applied. Amplified products were purified via phenol-chloroform extraction, air-dried and resuspended in RNase-free water to serve as templates for in vitro dsRNA synthesis. dsRNA was synthesized in vitro following the protocols of the MEGAscript T7 Transcription Kit (Ambion, USA). An 800 μL reaction system containing template DNA, NTP mix, reaction buffer and T7 enzyme mixture was incubated in a metal bath at 37 °C for 4 h or overnight. Subsequently, the products were purified by phenol-chloroform extraction and ethanol precipitation. After drying, the pellets were dissolved in an appropriate volume of RNase-free water. The integrity and concentration of dsRNA were examined by 1% agarose gel electrophoresis and NanoDrop spectrophotometry. Qualified dsRNA samples were stored at −80 °C for subsequent experiments.
2.7 Microinjection of dsRNA and phenotype observation
The synthesized dsRNA was diluted to working concentrations with RNase-free water. A concentration of 5 μg/μL was used for routine screening, while four concentration gradients (0.5, 1, 3 and 5 μg/μL) were set for the artificially recombinant sequence Udw. Uniform third-instar nymphs were lightly anesthetized with CO2 and placed ventral side up on a 1% agarose gel plate. A total volume of 41.4 nL dsRNA solution was injected into the intersegmental membrane between the first abdominal segment and thorax using a Nanoliter 2010 microinjector (World Precision Instruments, USA). Each treatment contained 30 nymphs with three biological replicates. Nymphs injected with equal concentrations of dsGFP served as the control group. After injection, the insects were transferred to Petri dishes lined with moist filter paper, fed with fresh corn kernels and reared under the original laboratory conditions. Nymph mortality was recorded daily for seven consecutive days, and the cumulative mortality as well as relative mortality were calculated accordingly.
2.8 Strategy for construction of recombinant Udw dsRNA
Through preliminary screening of highly lethal small fragments targeting the three genes Ubx, Dpp and wupA, four potent lethal small fragments were obtained, namely Ubx-ss-1, Dpp-ss-2, wupA-ss-1 and wupA-ss-2. Since wupA-ss-1 and wupA-ss-2 are adjacent fragments with overlapping sequences, they were collectively designated wupA-ss-12 in this study. Subsequently, the three fragments were concatenated in the order of Ubx-ss-1 (511–585 bp, 75 bp in length), Dpp-ss-2 (730–794 bp, 65 bp in length) and wupA-ss-12 (206–327 bp, 122 bp in length). The resulting fused sequence was named Udw, with a total length of 262 bp. The junction sites of this construct were annotated against the NCBI reference sequence.
The target fragment was synthesized by Sangon Biotech. The synthetic fragment was cloned into the pEASY-Blunt vector (TransGen Biotech, Beijing, China), followed by transformation into Trans1-T1 competent cells. Positive clones were screened and verified via Sanger sequencing. Sequencing-confirmed plasmids were used as templates for PCR amplification with specific primers appended with the T7 promoter sequence (TAATACGACTCACTATAGGGAGA). The 200 μL PCR system was prepared using 2× Easy Taq Mix. Amplified products were purified by phenol-chloroform extraction, vacuum-dried, and dissolved in RNase-free water to serve as templates for in vitro dsRNA synthesis. In vitro transcription of dsRNA was performed following the manufacturer’s instructions of the MEGAscript T7 Transcription Kit (Ambion, USA). An 800 μL reaction system containing template DNA, NTP mix, reaction buffer and T7 enzyme mix was incubated at 37 °C in a metal bath for 4 h or overnight. After transcription, the dsRNA products were purified via phenol-chloroform extraction and ethanol precipitation, air-dried, and resuspended in an appropriate volume of RNase-free water. The integrity and concentration of dsRNA were examined by 1% agarose gel electrophoresis and NanoDrop spectrophotometry, and qualified dsRNA aliquots were stored at −80 °C for subsequent use.
2.9 Data statistics and analysis
Raw experimental data were organized using Microsoft Excel and statistically analyzed with GraphPad Prism. Student’s t-test was applied to assess significant differences (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns indicates no significant difference). All data in figures are presented as Mean ± standard error of the mean (SEM).
3 Results and analysis
3.1 Screening of target genes
To screen effective RNAi target genes for the control of A. lucorum, dsRNA fragments targeting PP1 (308 bp), Ubx (336 bp), wupA (310 bp) and Dpp (358 bp) were separately delivered into third-instar nymphs via microinjection, with dsGFP as the control. Cumulative mortality was recorded daily for seven consecutive days. The results are shown in Figure 1. The 7-day cumulative mortality of nymphs injected with dsUbx was 56.67 ± 3.33%, which was significantly higher than that of the control group (P < 0.05). Treatments with dswupA and dsDpp produced strong lethal effects, with cumulative mortalities reaching 94.44 ± 1.11% and 92.22 ± 1.11%, respectively, both showing extremely significant differences compared with the control (P < 0.001). By contrast, the 7-day cumulative mortality in the dsPP1 treatment group was only 40.00 ± 1.92%, with no significant difference from the control.
Figure 1
3.2 Off-target analysis of RNAi target fragments in A. lucorum
Homology searches were performed on the dsRNA regions of Ubx, wupA and Dpp via the NCBI database. Sequences containing continuous identical fragments longer than 19 bp shared with non-target organisms were defined and recorded as off-target sites. Sites homologous exclusively to pest species were designated as universal target site and marked in green in the figure. By contrast, sites that could cause off-target effects on non-pest organisms were defined as risky sites and marked in red, with the names of corresponding non-pest species labeled in red font. As shown in Supplementary Appendix 1. The detailed information of the species is shown in Supplementary Table 1, three risky sites were identified in the Ubx fragment, located at 586–614 bp, 656–692 bp and 730–838 bp. Sequences at these sites shared high homology with diverse non-target organisms, including ants such as Pseudomyrmex gracilis and Wasmannia auropunctata, fish including Labrus bergylta, bees such as Bombus terrestris and Osmia bicornis. One universal target site (345–436 bp) and one risky site (447–494 bp) were detected in wupA. The universal target site shared homology with Thrips palmi. The risky site was homologous to multiple insect pests, including Plutella xylostella, Amyelois transitella, Manduca sexta, Loxostege sticticalis, Dendroctonus ponderosae, Thrips palmi and Frankliniella occidentalis. For the Dpp fragment, two universal target site were found at 755–806 bp and 820–848 bp, which were homologous to aphid species including Sipha flava, Melanaphis sacchari and Diuraphis noxia, as well as Cimex lectularius. One risky site (935–953 bp) was also identified, with homologous sequences present in fish such as Centropristis striata and Cololabis saira, and birds including Malurus melanocephalus, Prinia subflava and Ficedula albicollis.
3.3 Insecticidal activity verification of the longest fragments of candidate genes after removing risky sites
Ubx, wupA and Dpp were selected for subsequent experiments. After the risky sites were deleted, the longest remaining fragments of Ubx, wupA and Dpp were 75 bp (511–585 bp), 241 bp (206–446 bp) and 282 bp (653–934 bp), respectively. Since wupA-OTE (241 bp) and Dpp-OTE (282 bp) were longer than 200 bp, their RNAi effects were verified firstly. As shown in Figure 2, the 7-day cumulative mortality of Apolygus lucorum reached 77.78 ± 2.94% (P < 0.001) and 70.00 ± 1.93% (P < 0.001) after injection with dswupA-OTE and dsDpp-OTE, respectively. Both values were extremely significantly higher than that of the control group, indicating that the optimized fragments retained strong insecticidal activity. After off-target analysis of Ubx, only three short sequences remained following the removal of risky sites, with lengths of 75 bp, 41 bp and 37 bp. All of them were shorter than 100 bp, so no further verification was performed for long fragments of Ubx.
Figure 2
3.4 Effects of dsRNA length and target position on RNAi efficiency
To explore the effects of dsRNA length and target position on RNAi efficiency and screen effective short dsRNA fragments, Dpp-OTE (282 bp) and wupA-OTE (241 bp) were further divided into two types of fragments: s-type fragments (100–150 bp) and ss-type fragments (30–90 bp). As shown in Figure 3, for the Dpp gene, two s-type fragments dsDpp-s-1 (135 bp) and dsDpp-s-2 (140 bp) caused significant mortality in Apolygus lucorum. Their 7-day cumulative mortalities were 58.89 ± 2.94% (P < 0.01) and 62.22 ± 2.94% (P < 0.001), respectively. By contrast, the 7-day cumulative mortalities of the groups treated with dsDpp-s-3 and dsDpp-s-4 were 38.89 ± 2.94% and 44.44 ± 1.11%, showing no significant difference compared with the dsGFP control group (38.89 ± 1.11%). For the wupA gene, the 7-day cumulative mortalities of nymphs injected with dswupA-s-1 (135 bp) and dswupA-s-2 (132 bp) reached 67.78 ± 2.94% (P < 0.0001) and 70.00 ± 0.00% (P < 0.001), respectively. The mortality of the dswupA-s-3 treatment group was 45.55 ± 2.22%, which was not significantly different from the control group (38.89 ± 1.11%).
Figure 3
As shown in Figure 4, the effective regions covered by Dpp-s-1 and Dpp-s-2 were further divided into ss-type fragments. Only dsDpp-ss-2 (65 bp) exhibited significant insecticidal activity, with a 7-day cumulative mortality of 55.56 ± 2.94% (P < 0.05). The 7-day cumulative mortalities of dsDpp-ss-1 and dsDpp-ss-3 were 48.89 ± 4.01% and 42.22 ± 2.94%, respectively, both showing no significant difference compared with the dsGFP control group (36.67 ± 1.93%). After the effective region of the wupA gene was truncated into ss-type fragments, both dswupA-ss-1 (66 bp) and dswupA-ss-2 (66 bp) retained prominent insecticidal effects. Their 7-day cumulative mortalities were 56.67 ± 3.85% (P < 0.01) and 52.22 ± 1.11% (P < 0.01). The mortality of the dswupA-ss-3 treatment group was 41.11 ± 1.11%, which was not significantly different from the control group (34.44 ± 2.94%). Three dsRNA fragments were designed based on the remaining sequences of Ubx, namely Ubx-ss-1 (511–585 bp, 75 bp), Ubx-ss-2 (615–655 bp, 41 bp) and Ubx-ss-3 (693–729 bp, 37 bp). The highest 7-day mortality of 47.78 ± 1.11% (P < 0.01) was observed in the dsUbx-ss-1 group. The 7-day cumulative mortalities of the dsUbx-ss-2 and dsUbx-ss-3 groups were 35.56 ± 1.11% and 34.44 ± 1.11%, respectively, with no significant difference relative to the dsGFP control (34.44 ± 1.11%).
Figure 4
3.5 Construction and insecticidal efficacy evaluation of artificial recombinant multi-target dsRNA (Udw)
Based on the screening results of effective short dsRNA fragments, Ubx-ss-1 (75 bp), Dpp-ss-2 (65 bp) and wupA-ss-12 (122 bp, assembled by connecting wupA-ss-1 and wupA-ss-2) were artificially concatenated to generate a novel recombinant dsRNA of 262 bp, designated as Udw. BLAST analysis confirmed no additional off-target sites in this recombinant sequence.
As shown in Figure 5, dsUdw was diluted to four concentrations: 0.5 μg/μL, 1 μg/μL, 3 μg/μL and 5 μg/μL, named dsUdw-a, dsUdw-b, dsUdw-c and dsUdw-d respectively. These constructs were injected into third-instar nymphs of A. lucorum, with dsGFP serving as the control. Cumulative mortality was recorded daily for seven consecutive days. The 7-day cumulative mortalities of the four treatment groups were 64.44 ± 2.94% (P < 0.001), 66.67 ± 1.93% (P < 0.001), 67.78 ± 4.01% (P < 0.001) and 72.22 ± 2.94% (P < 0.001). Mortality increased gradually with rising dsRNA concentration, while no significant difference was observed among treatment groups.
Figure 5
The fragment with the highest lethal effect (dsUdw-d, 5 μg/μL) was further compared with other dsRNAs at the same concentration, including off-target optimized fragments (dswupA-OTE, dsDpp-OTE), the most potent s-type fragments (dsDpp-s-2, dswupA-s-2) and the most active ss-type fragments (dsDpp-ss-2, dswupA-ss-1, dsUbx-ss-1). Relative mortality (the difference in mortality between treatment and control groups) was used as the evaluation index. The lethal dynamics comparison revealed that dsUdw-d exhibited significantly higher mortality than all single-gene dsRNAs on the 2nd and 3rd days post injection and reached a peak value of 45.55 ± 2.22% on the 3rd day, indicating a faster insecticidal rate (Figure 5).
4 Discussion
This study aimed to develop RNA interference (RNAi)-based green control technology for A. lucorum, a major agricultural pest. Through target gene screening, off-target risk optimization, and fragment refinement, we successfully constructed an artificially recombinant dsRNA, designated Udw, which exhibits high insecticidal efficacy, enhanced biosafety, and a faster action speed.
Two target genes, wupA and Dpp, were identified via microinjection, both achieving mortality rates over 90% against A. lucorum, consistent with their essential roles in insect growth and development. Fishilevich et al. () reported that feeding dsRNA of wupA to Diabrotica virgifera at 500 ng/cm² resulted in 94.6% mortality, accompanied by destruction of striated muscle fiber structure, impaired locomotion, and inhibited development. In addition, RNAi-mediated silencing of wupA may disrupt Malpighian tubule function (). The Dpp gene plays a vital role in wing formation, with functions that vary across species. In Drosophila melanogaster, Dpp loss-of-function leads to incomplete or missing wing veins (). Similarly, Dpp is highly expressed in both forewings and hindwings of Athalia rosae, and its suppression causes complete loss of wing veins (); In Precis coenia, Dpp participates in the formation of wing spots and veins. Disruption of Dpp function also results in wing malformation in Nilaparvata lugens (). The strong lethal phenotypes indicate that wupA and Dpp are ideal candidate targets for RNAi. Furthermore, Ubx was identified as another effective target, with a mortality rate above 50%; Ubx mutations in Tribolium castaneum cause abnormal elytron morphology (); In contrast, silencing PP1 produced no significant lethal effect in our study, differing from a previous report on Halyomorpha halys in which over 70% mortality was achieved with 1 μg dsRNA (). We suggest that the discrepancy may result from interspecific variation in RNAi efficiency, differences in injection dosage (approximately 0.2 μg in the present study), or the in vivo stability of dsRNA (). These results underscore the necessity of empirical validation when applying RNAi targets across different insect species.
Systematic off-target analysis of target fragments was performed, an essential prerequisite for the field application of RNAi-based biopesticides. Following the criterion that continuous sequence matches of >19 bp may trigger off-target effects (), we precisely removed risky sites homologous to non-target organisms—particularly vertebrates and beneficial insects—via BLAST alignment. The optimized fragments wupA-OTE and Dpp-OTE retained potent insecticidal activity while showing improved biosafety. Notably, we defined broad-spectrum target sites that share homology exclusively with other agricultural pests, including aphids, Thrips palmi, and bed bugs, and these sequences were intentionally retained. This finding provides valuable structural elements and theoretical support for developing broad-spectrum RNAi products against multiple pest species. However, fragments that aligned with both non-target organisms and pests were also considered off-target and were excluded. Therefore, rigorous scrutiny is required in evaluating broad-spectrum target sites to ensure that selected fragments possess broad-spectrum potential while maintaining relative specificity and safety. In addition, because the cleavage specificity of dsRNA differs among organisms, even if an off-target site or a broad-spectrum target site exists, it may not be functional in practical applications if the corresponding siRNA cannot be generated by Dicer processing. Nevertheless, attention should remain on the potential off-target risks of broad-spectrum target sites to beneficial organisms.
We thoroughly investigated the effects of dsRNA length and target position on RNAi efficiency. Distinct silencing efficiency was observed among dsRNA fragments derived from different regions of the same gene. For instance, dsDpp-s-1 and dsDpp-s-2 exhibited prominent insecticidal activity, whereas dsDpp-s-3 and dsDpp-s-4 showed no obvious effect. Li et al. () designed three dsRNA fragments targeting the V-ATPase E gene of N. lugens and found that fragments covering the 3’-coding and non-coding regions exerted the highest silencing efficiency, whereas those located in the 5’-coding region worked poorly. Tusun et al. () constructed three dsRNA fragments targeting different regions of the JHEH gene in A. lucorum, and all significantly reduced the survival of third-instar nymphs. In general, insecticidal activity declined as dsRNA length decreased from 300–360 bp to 30–90 bp, which is consistent with the conclusion that long dsRNA fragments possess higher efficacy in Drosophila cell lines (). Nevertheless, several short fragments shorter than 100 bp, such as dsDpp-ss-2 (65 bp) and dswupA-ss-1 (66 bp), still maintained high lethal activity. These effective short dsRNAs are favorable for reducing synthesis costs and minimizing potential off-target risks. In addition, some ss-class short fragments shorter than 100 bp retained remarkable lethal activity in this study, while other fragments of the same length showed no obvious RNAi effects. Such differences may be closely related to the local secondary structure of target mRNAs and the cleavage preference of Dicer enzymes (, ).
The core innovation of this study lies in the construction of a multi-target recombinant dsRNA Udw by concatenating effective short fragments from different genes. Compared with single-target dsRNAs, Udw has two remarkable advantages. Firstly, it achieves a faster insecticidal speed. The relative mortality of Udw-treated nymphs was significantly higher than all single-gene groups on days 2 and 3 post-injection and reached the peak on day 3. This may be because Udw simultaneously interferes with three independent and critical physiological processes to accelerate mortality: Ubx (regulating morphological development), Dpp (signal transduction), and wupA (muscle contraction). Secondly, Udw shows high dosage sensitivity. Even at a 10-fold diluted concentration (0.5 μg/μL), it still caused over 64% mortality. This allows lower application dosage in field conditions, thereby cutting production costs and alleviating environmental residue. Furthermore, the multi-target strategy can theoretically delay the development of pest resistance caused by mutation of a single target gene ().
In summary, this study provides a promising candidate fragment Udw for the control of A. lucorum. More importantly, we established a complete technical workflow covering target screening, biosafety optimization and functional validation, and proposed a novel design strategy for multi-target recombinant dsRNA. These findings lay a solid theoretical foundation and offer new perspectives for developing efficient, safe, economical and fast-acting RNAi pesticides. However, all current experiments were conducted via microinjection under laboratory conditions. Further research including feeding and spray bioassays, as well as field and greenhouse evaluations on control efficacy and non-target organism safety, is required in follow-up studies.
Statements
Data availability statement
The original contributions presented in the study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.
Author contributions
JL: Conceptualization, Validation, Investigation, Writing – review & editing, Writing – original draft, Data curation, Methodology. QG: Writing – original draft, Methodology, Conceptualization, Data curation, Writing – review & editing, Investigation, Validation. RH: Writing – original draft, Data curation, Investigation. MZ: Investigation, Writing – original draft, Data curation. GW: Supervision, Writing – review & editing. BY: Supervision, Writing – review & editing, Conceptualization, Funding acquisition, Project administration, Resources.
Funding
The author(s) declared that financial support was received for this work and/or its publication. Innovation Program of Chinese Academy of Agricultural Sciences (CAAS-CSCB-202402); Agricultural Science and Technology Innovation Program (ASTIP).
Conflict of interest
The authors declared that this work was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Generative AI statement
The author(s) declared that generative AI was not used in the creation of this manuscript.
Any alternative text (alt text) provided alongside figures in this article has been generated by Frontiers with the support of artificial intelligence and reasonable efforts have been made to ensure accuracy, including review by the authors wherever possible. If you identify any issues, please contact us.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/finsc.2026.1912427/full#supplementary-material
References
1
HeBChuYYinMMüllenKAnCShenJ. Fluorescent nanoparticle delivered dsRNA toward genetic control of insect pests. Adv Mater. (2013) 25:4580–4. doi: 10.1002/adma.201301201
2
HeadGPCarrollMWEvansSPRuleDMWillseARClarkTLet al. Evaluation of SmartStax and SmartStax PRO maize against western corn rootworm and northern corn rootworm: efficacy and resistance management. Pest Manag. Sci. (2017) 73:1883–99. doi: 10.1002/ps.4554
3
PallisSAlyokhinAManleyBRodriguesTBarnesENarvaK. Effects of low doses of a novel dsRNA-based biopesticide (Calantha) on the Colorado potato beetle. J Econ. Entomol. (2023) 116:456–61. doi: 10.1093/jee/toad034
4
MerkJAnastasiMMcGruddyRManleyBFeldenALesterPJ. Longevity and foraging performance of honey bees treated with an RNAi-based Varroa destructor biopesticide. Sci Rep. (2026) 16:8208. doi: 10.1038/s41598-026-38557-w
5
DaiHMaLWangJJiangRWangZFeiJ. Knockdown of ecdysis-triggering hormone gene with a binary UAS/GAL4 RNA interference system leads to lethal ecdysis deficiency in silkworm. Acta Biochim Biophys Sin (Shanghai). (2008) 40:790–5. doi: 10.1093/abbs/40.9.790
6
BolognesiRRamaseshadriPAndersonJBachmanPClintonWFlannaganRet al. Characterizing the mechanism of action of double-stranded RNA activity against western corn rootworm (Diabrotica virgifera virgifera LeConte). PloS One. (2012) 7:e47534. doi: 10.1371/journal.pone.0047534
7
HammondSMBernsteinEBeachDHannonGJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. (2000) 404:293–6. doi: 10.1038/35005107
8
SalehMCvan RijRPHekeleAGillisAFoleyEO'FarrellPHet al. The endocytic pathway mediates cell entry of dsRNA to induce RNAi silencing. Nat Cell Biol. (2006) 8:793–802. doi: 10.1038/ncb1439
9
BurkeWGKaplanogluEKolotilinIMenassaRDonlyC. RNA interference in the tobacco hornworm, Manduca sexta, using plastid-encoded long double-stranded RNA. Front Plant Sci. (2019) 10:313. doi: 10.3389/fpls.2019.00313
10
WhyardSSinghADWongS. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem Mol Biol. (2009) 39:824–32. doi: 10.1016/j.ibmb.2009.09.007
11
MuttiNSParkYReeseJCReeckGR. RNAi knockdown of a salivary transcript leading to lethality in the pea aphid, Acyrthosiphon pisum. J Insect Sci. (2006) 6:1–7. doi: 10.1673/031.006.3801
12
ZhouXOiFMScharfME. Social exploitation of hexamerin: RNAi reveals a major caste-regulatory factor in termites. Proc Natl Acad Sci USA. (2006) 103:4499–504. doi: 10.1073/pnas.0508866103
13
LiJChenQLinYJiangTWuGHuaH. RNA interference in Nilaparvata lugens (Homoptera: Delphacidae) based on dsRNA ingestion. Pest Manag. Sci. (2011) 67:852–9. doi: 10.1002/ps.2124
14
TusunALiMLiangXYangTYangBWangG. Juvenile hormone epoxide hydrolase: a promising target for hemipteran pest management. Sci Rep. (2017) 7:789. doi: 10.1038/s41598-017-00907-0
15
YangLQinCYChenYWangZGChenRYNiuJet al. Fusion dsRNA in targeting salivary protein genes enhance the RNAi-based aphid control. Pestic. Biochem Physiol. (2023) 197:105645. doi: 10.1016/j.pestbp.2023.105645
16
XuQQShangFFengSYXieQPZhangWWangZGet al. Design the fusion double-strand RNAs to control two global sap-sucking pests. Pestic. Biochem Physiol. (2024) 205:106114. doi: 10.1016/j.pestbp.2024.106114
17
QiaoHJiangQZhaoJXiaoLZhu-SalzmanKXuDet al. Nano-delivery platform with strong protection and efficient delivery: preparation of self-assembled RNA pesticide with dual RNAi targets against Apolygus lucorum. J Nanobiotechnol. (2025) 23:93. doi: 10.1186/s12951-025-03155-x
18
LuYHQiuFFengHQLiHBYangZCWyckhuysKAGet al. Species composition and seasonal abundance of pestiferous plant bugs (Hemiptera: Miridae) on Bt cotton in China. Crop Prot. (2008) 27:465–72. doi: 10.1016/j.cropro.2007.07.017
19
LuYWuKWyckhuysKAGGuoY. Overwintering hosts of Apolygus lucorum (Hemiptera: Miridae) in northern China. Crop Prot. (2010) 29:1026–33. doi: 10.1016/j.cropro.2010.03.017
20
TabashnikBEBrévaultTCarrièreY. Insect resistance to Bt crops: lessons from the first billion acres. Nat Biotechnol. (2013) 31:510–21. doi: 10.1038/nbt.2597
21
CarrièreYCrickmoreNTabashnikBE. Optimizing pyramided transgenic Bt crops for sustainable pest management. Nat Biotechnol. (2015) 33:161–8. doi: 10.1038/nbt.3099
22
ZhangLLuYLiangG. A method for field assessment of plant injury elicited by the salivary proteins of Apolygus lucorum. Entomol. Exp Appl. (2013) 149:292–7. doi: 10.1111/eea.12125
23
LuYWuKJiangYGuoYDesneuxN. Widespread adoption of Bt cotton and insecticide decrease promotes biocontrol services. Nature. (2012) 487:362–5. doi: 10.1038/nature11153
24
WuKLiWFengHGuoY. Seasonal abundance of the mirids, Lygus lucorum and Adelphocoris spp. (Hemiptera: Miridae) on Bt cotton in northern China. Crop Prot. (2002) 21:997–1002. doi: 10.1016/S0261-2194(02)00080-7
25
LiuFYangBZhangADingDWangG. Plant-mediated RNAi for controlling Apolygus lucorum. Front Plant Sci. (2019) 10:64. doi: 10.3389/fpls.2019.00064
26
LiangSLuoJAlariqiMXuZWangAZafarMNet al. Silencing of a LIM gene in cotton exhibits enhanced resistance against Apolygus lucorum. J Cell Physiol. (2021) 236:5921–36. doi: 10.1002/jcp.30281
27
DongYZhangWJinYShenDXiaA. Apolygus lucorum effector Al6 promotes insect feeding performance on soybean plants: RNAi analysis and feeding behaviour study with electrical penetration graph. Insect Mol Biol. (2023) 32:1–10. doi: 10.1111/imb.12808
28
WeatherbeeSDHalderGKimJHudsonACarrollS. Ultrabithorax regulates genes at several levels of the wing-patterning hierarchy to shape the development of the Drosophila haltere. Genes Dev. (1998) 12:1474–82. doi: 10.1101/gad.12.10.1474
29
ShashidharaLSAgrawalNBajpaiRBharathiVSinhaP. Negative regulation of dorsoventral signaling by the homeotic gene Ultrabithorax during haltere development in Drosophila. Dev Biol. (1999) 212:491–502. doi: 10.1006/dbio.1999.9341
30
MohitPMakhijaniKMadhaviMBBharathiVLalASirdesaiGet al. Modulation of AP and DV signaling pathways by the homeotic gene Ultrabithorax during haltere development in Drosophila. Dev Biol. (2006) 291:356–67. doi: 10.1016/j.ydbio.2005.12.022
31
HershBMNelsonCEStollSJNortonJEAlbertTJCarrollSB. The UBX-regulated network in the haltere imaginal disc of D. melanogaster. Dev Biol. (2007) 302:717–27. doi: 10.1016/j.ydbio.2006.11.011
32
BarbasJAGalceranJKrah-JentgensIde la PompaJLCanalIPongsOet al. Troponin I is encoded in the haplolethal region of the Shaker gene complex of Drosophila. Genes Dev. (1991) 5:132–40. doi: 10.1101/gad.5.1.132
33
BarbasJAGalceranJTorrojaLPradoAFerrúsA. Abnormal muscle development in the heldup3 mutant of Drosophila melanogaster is caused by a splicing defect affecting selected troponin I isoforms. Mol Cell Biol. (1993) 13(3):1433–39. doi: 10.1128/mcb.13.3.1433-1439.1993
34
IrishVFGelbartWM. The decapentaplegic gene is required for dorsal-ventral patterning of the Drosophila embryo. Genes Dev. (1987) 18:868–79. doi: 10.1101/gad.1.8.868
35
MorimuraSMavesLChenYHoffmannFM. decapentaplegic overexpression affects Drosophila wing and leg imaginal disc development and wingless expression. Dev Biol. (1996) 177:136–51. doi: 10.1006/dbio.1996.0151
36
TwomblyVBlackmanRKJinHGraffJMPadgettRWGelbartWM. The TGF-beta signaling pathway is essential for Drosophila oogenesis. Development. (1996) 1225:1555–65. doi: 10.1242/dev.122.5.1555
37
YoshidaSSoustelleLGiangrandeAUmetsuDMurakamiSYasugiTet al. DPP signaling controls development of the lamina glia required for retinal axon targeting in the visual system of Drosophila. Development. (2005) 132:4587–98. doi: 10.1242/dev.02040
38
RangarajanRCourvoisierHGaulU. Dpp and Hedgehog mediate neuron-glia interactions in Drosophila eye development by promoting the proliferation and motility of subretinal glia. Mech Dev. (2001) 108:93–103. doi: 10.1016/S0925-4773(01)00501-9
39
BollenMPetiWRagusaMJBeullensM. The extended PP1 toolkit: designed to create specificity. Trends Biochem Sci. (2010) 35:450–8. doi: 10.1016/j.tibs.2010.03.002
40
KulkarniMMBookerMSilverSJFriedmanAHongPPerrimonNet al. Evidence of off-target effects associated with long dsRNAs in Drosophila melanogaster cell-based assays. Nat Methods. (2006) 3:833–8. doi: 10.1038/nmeth935
41
FishilevichEBowlingAJFreyMLFWangPHLoWRangasamyMet al. RNAi targeting of rootworm Troponin I transcripts confers root protection in maize. Insect Biochem Mol Biol. (2019) 104:20–9. doi: 10.1016/j.ibmb.2018.09.006
42
CoastGM. The influence of neuropeptides on Malpighian tubule writhing and its significance for excretion. Peptides. (1998) 19:469–80. doi: 10.1016/s0196-9781(97)00461-0
43
SotillosSde CelisJF. Regulation of decapentaplegic expression during Drosophila wing veins pupal development. Mech Dev. (2006) 123:241–51. doi: 10.1016/j.mod.2005.12.002
44
MatsudaSYoshiyamaNKünnapuu-VulliJHatakeyamaMShimmiO. Dpp/BMP transport mechanism is required for wing venation in the sawfly Athalia rosae. Insect Biochem Mol Biol. (2013) 43:466–73. doi: 10.1016/j.ibmb.2013.02.008
45
LiXLiuFWuCZhaoJCaiWHuaH. Decapentaplegic function in wing vein development and wing morph transformation in brown planthopper, Nilaparvata lugens. Dev Biol. (2019) 449:143–50. doi: 10.1016/j.ydbio.2019.02.016
46
BennettRLBrownSJDenellRE. Molecular and genetic analysis of the Tribolium Ultrabithorax ortholog, Ultrathorax. Dev Genes Evol. (1999) 209:608–19. doi: 10.1007/s004270050295
47
Meyering-VosMMüllerA. RNA interference suggests sulfakinins as satiety effectors in the cricket Gryllus bimaculatus. J Insect Physiol. (2007) 53:840–8. doi: 10.1016/j.jinsphys.2007.04.003
48
GarbuttJSBellésXRichardsEHReynoldsSE. Persistence of double-stranded RNA in insect hemolymph as a potential determiner of RNA interference success: evidence from Manduca sexta and Blattella germanica. J Insect Physiol. (2013) 59:171–8. doi: 10.1016/j.jinsphys.2012.05.013
49
HoehenerCHugINowackiM. Dicer-like enzymes with sequence cleavage preferences. Cell. (2018) 173:234–247.e237. doi: 10.1016/j.cell.2018.02.029
50
PatzelVRutzSDietrichIKöberleCScheffoldAKaufmannSH. Design of siRNAs producing unstructured guide-RNAs results in improved RNA interference efficiency. Nat Biotechnol. (2005) 23:1440–4. doi: 10.1038/nbt1151
51
ZhangJKhanSAHasseCRufSHeckelDGBockR. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science. (2015) 347:991–4. doi: 10.1126/science.1261680
Summary
Keywords
Apolygus lucorum, artificially recombinant dsRNA, dsRNA optimization, off-target effect, RNAi-based insect resistance technology
Citation
Luo J, Guo Q, Hu R, Zhang M, Wang G and Yang B (2026) Screening, optimization and artificial recombination of dsRNA fragments for RNAi-mediated pest resistance in Apolygus lucorum. Front. Insect Sci. 6:1912427. doi: 10.3389/finsc.2026.1912427
Received
18 June 2026
Revised
25 July 2026
Accepted
31 July 2026
Published
18 August 2026
Volume
6 - 2026
Edited by
Kong Chen, University of Science and Technology of China, China
Reviewed by
Wanjing Wu, Shanghai Jiaotong University, China
Yong Yan, University of Science and Technology of China, China
Updates
Copyright
© 2026 Luo, Guo, Hu, Zhang, Wang and Yang.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
*Correspondence: Bin Yang, yangbin@caas.cn
†These authors have contributed equally to this work
Disclaimer
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher.