<?xml version="1.0" encoding="UTF-8" standalone="no"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd"> 
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="2.3" xml:lang="EN">
<front>
<journal-meta>
<journal-id journal-id-type="publisher-id">Front. Mar. Sci.</journal-id>
<journal-title>Frontiers in Marine Science</journal-title>
<abbrev-journal-title abbrev-type="pubmed">Front. Mar. Sci.</abbrev-journal-title>
<issn pub-type="epub">2296-7745</issn>
<publisher>
<publisher-name>Frontiers Media S.A.</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.3389/fmars.2023.1195016</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Marine Science</subject>
<subj-group>
<subject>Original Research</subject>
</subj-group>
</subj-group>
</article-categories>
<title-group>
<article-title>The involvement of antioxidant, stress, and immune-related genes in the responsive mechanisms of common carp (<italic>Cyprinus carpio</italic>) to hypersalinity exposure</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Ahmed</surname>
<given-names>Hassan</given-names>
</name>
<xref ref-type="aff" rid="aff1">
<sup>1</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/78104"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Bakry</surname>
<given-names>Karima A.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Abdeen</surname>
<given-names>Ahmed</given-names>
</name>
<xref ref-type="aff" rid="aff3">
<sup>3</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/629396"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>El bahgy</surname>
<given-names>Halla E. K.</given-names>
</name>
<xref ref-type="aff" rid="aff4">
<sup>4</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1182170"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Abdo</surname>
<given-names>Mohamed</given-names>
</name>
<xref ref-type="aff" rid="aff5">
<sup>5</sup>
</xref>
<xref ref-type="aff" rid="aff6">
<sup>6</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/2121295"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name>
<surname>Imbrea</surname>
<given-names>Florin</given-names>
</name>
<xref ref-type="aff" rid="aff7">
<sup>7</sup>
</xref>
<xref ref-type="author-notes" rid="fn001">
<sup>*</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Fericean</surname>
<given-names>Liana</given-names>
</name>
<xref ref-type="aff" rid="aff8">
<sup>8</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Elshemy</surname>
<given-names>Mona A.</given-names>
</name>
<xref ref-type="aff" rid="aff9">
<sup>9</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Ibrahim</surname>
<given-names>Samah F.</given-names>
</name>
<xref ref-type="aff" rid="aff10">
<sup>10</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1398321"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Shukry</surname>
<given-names>Mustafa</given-names>
</name>
<xref ref-type="aff" rid="aff11">
<sup>11</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/853590"/>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Baloza</surname>
<given-names>Samar H.</given-names>
</name>
<xref ref-type="aff" rid="aff12">
<sup>12</sup>
</xref>
</contrib>
<contrib contrib-type="author">
<name>
<surname>Emeish</surname>
<given-names>Walaa F. A.</given-names>
</name>
<xref ref-type="aff" rid="aff2">
<sup>2</sup>
</xref>
<uri xlink:href="https://loop.frontiersin.org/people/1942359"/>
</contrib>
</contrib-group>
<aff id="aff1">
<sup>1</sup>
<institution>Department of Physiology, Faculty of Veterinary Medicine, South Valley University</institution>, <addr-line>Qena</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff2">
<sup>2</sup>
<institution>Department of Fish Diseases, Faculty of Veterinary Medicine, South Valley University</institution>, <addr-line>Qena</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff3">
<sup>3</sup>
<institution>Department of Forensic Medicine and Toxicology, Faculty of Veterinary Medicine, Benha University</institution>, <addr-line>Toukh</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff4">
<sup>4</sup>
<institution>Department of Veterinary Hygiene and Management, Faculty of Veterinary Medicine, Benha University</institution>, <addr-line>Toukh</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff5">
<sup>5</sup>
<institution>Department of Animal Histology and Anatomy, School of Veterinary Medicine, Badr University in Cairo (BUC)</institution>, <addr-line>Badr City</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff6">
<sup>6</sup>
<institution>Department of Anatomy and Embryology, Faculty of Veterinary Medicine, University of Sadat City</institution>, <addr-line>Sadat City</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff7">
<sup>7</sup>
<institution>Department of Crop Sciences, University of Life Sciences &#x201c;King Mihai I&#x201d; from Timisoara</institution>, <addr-line>Timi&#x15f;oara</addr-line>, <country>Romania</country>
</aff>
<aff id="aff8">
<sup>8</sup>
<institution>Department of Biology and Plant Protection, Faculty of Agriculture. University of Life Sciences &#x201c;King Michael I&#x201d; from Timi&#x15f;oara</institution>, <addr-line>Timi&#x219;oara</addr-line>, <country>Romania</country>
</aff>
<aff id="aff9">
<sup>9</sup>
<institution>Department of Clinical Pathology, Faculty of Veterinary Medicine, Benha University</institution>, <addr-line>Toukh</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff10">
<sup>10</sup>
<institution>Department of Clinical Sciences, College of Medicine, Princess Nourah bint Abdulrahman University</institution>, <addr-line>Riyadh</addr-line>, <country>Saudi Arabia</country>
</aff>
<aff id="aff11">
<sup>11</sup>
<institution>Department of Physiology, Faculty of Veterinary Medicine, Kafrelsheikh University</institution>, <addr-line>Kafrelsheikh</addr-line>, <country>Egypt</country>
</aff>
<aff id="aff12">
<sup>12</sup>
<institution>Genetic and Genetic Engineering, Animal Wealth Development Department, Faculty of Veterinary Medicine, Benha University</institution>, <addr-line>Toukh</addr-line>, <country>Egypt</country>
</aff>
<author-notes>
<fn fn-type="edited-by">
<p>Edited by: Ahmed H. El-Sappah, Zagazig University, Egypt</p>
</fn>
<fn fn-type="edited-by">
<p>Reviewed by: Qudratullah Kalwar, Chinese Academy of Agricultural Sciences, China; Josef Vel&#xed;&#x161;ek, University of South Bohemia, Czechia; Yaru Yang, Yibin University, China</p>
</fn>
<fn fn-type="corresp" id="fn001">
<p>*Correspondence: Hassan Ahmed, <email xlink:href="mailto:hassan-younes@vet.svu.edu.eg">hassan-younes@vet.svu.edu.eg</email>; Ahmed Abdeen, <email xlink:href="mailto:ahmed.abdeen@fvtm.bu.edu.eg">ahmed.abdeen@fvtm.bu.edu.eg</email>; Florin Imbrea, <email xlink:href="mailto:florin_imbrea@usab-tm.ro">florin_imbrea@usab-tm.ro</email>
</p>
</fn>
</author-notes>
<pub-date pub-type="epub">
<day>02</day>
<month>06</month>
<year>2023</year>
</pub-date>
<pub-date pub-type="collection">
<year>2023</year>
</pub-date>
<volume>10</volume>
<elocation-id>1195016</elocation-id>
<history>
<date date-type="received">
<day>27</day>
<month>03</month>
<year>2023</year>
</date>
<date date-type="accepted">
<day>11</day>
<month>05</month>
<year>2023</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#xa9; 2023 Ahmed, Bakry, Abdeen, El bahgy, Abdo, Imbrea, Fericean, Elshemy, Ibrahim, Shukry, Baloza and Emeish</copyright-statement>
<copyright-year>2023</copyright-year>
<copyright-holder>Ahmed, Bakry, Abdeen, El bahgy, Abdo, Imbrea, Fericean, Elshemy, Ibrahim, Shukry, Baloza and Emeish</copyright-holder>
<license xlink:href="http://creativecommons.org/licenses/by/4.0/">
<p>This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.</p>
</license>
</permissions>
<abstract>
<p>Salinity stress is one of the marked influencing factors on the ecophysiology of aquaculture and is considered an important reason for the retreat of the fish industry. The current study is an endeavor to elucidate the molecular mechanisms that underlie the response to salinity stress in common carp. Fish (Average weight 5 &#xb1; 2 g) were randomly distributed into two groups; the 1<sup>st</sup> is a control was exposed to tap water (0.2 ppt salinity) and the 2<sup>nd</sup> is a treated was exposed to hypersalinity (10 ppt salinity) for five days. Serum biochemical indicators including total protein, albumin, globulins, A/G ratio, blood glucose, cortisone, Na<sup>+</sup>, K<sup>+</sup>, and Cl<sup>-</sup> levels were evaluated. Besides, Tumor necrosis factor-&#x3b1;, interleukin-1&#x3b2;, corticotropin-releasing hormone, and catalase enzyme mRNA expression levels were assessed in lymphoid and immunocompetent organs (liver and spleen) and osmoregulatory organs (kidney and gills) by using Real-time qPCR. Hypersalinity adversely affected the biochemical markers; total protein, albumin, and globulins decreased significantly; however, blood glucose, serum cortisol, and sodium markedly increased in fish exposed to hypersalinity compared with the control. In addition, from the molecular point of view, all the evaluated genes were upregulated at a high expression rate in the liver compared with other studied organs after the salinity challenge. On the contrary, hypersalinity modulated the expression of immune-related genes (Tumor necrosis factor-&#x3b1; and interleukin-1&#x3b2;) in the kidney and spleen and upregulated corticotropin-releasing hormone mRNA in all studied organs except gills. In conclusion, the obtained data clarified the molecular and biochemical mechanisms of salinity stress on the liver, kidney, spleen, and gills. Furthermore, it strongly suggests the implication of neural, endocrine, and immune systems in the responsive mechanisms to the salinity stress in carp.</p>
</abstract>
<kwd-group>
<kwd>salinity stress</kwd>
<kwd>oxidative damage</kwd>
<kwd>
<italic>TNF-&#x3b1;</italic>
</kwd>
<kwd>
<italic>IL-1&#x3b2;</italic>
</kwd>
<kwd>
<italic>CRH</italic>
</kwd>
<kwd>catalase</kwd>
</kwd-group>
<contract-sponsor id="cn001">Princess Nourah Bint Abdulrahman University<named-content content-type="fundref-id">10.13039/501100004242</named-content>
</contract-sponsor>
<counts>
<fig-count count="6"/>
<table-count count="2"/>
<equation-count count="0"/>
<ref-count count="67"/>
<page-count count="12"/>
<word-count count="5673"/>
</counts>
<custom-meta-wrap>
<custom-meta>
<meta-name>section-in-acceptance</meta-name>
<meta-value>Aquatic Physiology</meta-value>
</custom-meta>
</custom-meta-wrap>
</article-meta>
</front>
<body>
<sec id="s1" sec-type="intro">
<label>1</label>
<title>Introduction</title>
<p>Aquaculture is one of the world&#x2019;s fastest-growing industries as 50% of fish production yield is achieved by fish farms (<xref ref-type="bibr" rid="B23">Fitzsimmons et&#xa0;al., 2015</xref>). However, the fish farming industry is facing a considerable challenge, in particular, water salinity and the scarcity of freshwater (<xref ref-type="bibr" rid="B21">FAO, 2003</xref>). This is owing to water shortage and climate changes including temperature elevation, which directly impacts water evaporation and, subsequently, higher salinity concentrations. Besides, the freshwater ecosystem is polluted by anthropogenic salts derived from industrial and agricultural waste (<xref ref-type="bibr" rid="B58">Velasco et&#xa0;al., 2019</xref>). In addition, salinity has a marked impact on the ecophysiology of fish and is considered an essential ecological factor in the retreat of the fish industry. Moreover, salinity change is the main cause of deleterious effects on physiological hormones and enzyme activities, reflecting fish bioactivity and survival (<xref ref-type="bibr" rid="B10">Cao et&#xa0;al., 2022</xref>). Furthermore, hypersalinity stress is considered the harshest aquatic environment disturbing the physiological functions of growth performance, metabolic rate, food intake, and hormonal stimulation in aquaculture (<xref ref-type="bibr" rid="B27">Gonzalez, 2012</xref>).</p>
  <p>Common carp (<italic>Cyprinus Carpio</italic>) is a stenohaline freshwater fish with a low endurance ability to salinity. Salinity is one of the common causes of ecosystem disturbance and physiological homeostasis imbalance, ending in high mortalities of carp due to osmotic shock (<xref ref-type="bibr" rid="B20">Evans and K&#xfc;ltz, 2020</xref>). Research has shown that when salinity is elevated, homeostasis is achieved by increasing the concentrations of Na+ and K+ in the blood, and there is enhanced activity of gills Na<sup>+</sup>/K<sup>+</sup> ATPase (<xref ref-type="bibr" rid="B45">Salati et&#xa0;al., 2011</xref>). Moreover, Alkhshali and Al-Hilalli (2019) reported increases in RBCs, HB, PCV, and WBCs in common carp in response to steady elevations in the salt concentrations (from 5 to 10 to 15 g/L) as a physiological response to environmental salinity perturbations (<xref ref-type="bibr" rid="B3">Al-Khshali and Al Hilali, 2019</xref>). In addition, the chronic salinity change contributes to the disturbance of liver function in common carp (Alkhshali and Al-Hilalli, 2019). The adverse effect of salt stress was extended to general performance in common carp as it reduced food intake and growth rates with unfavorable effects on survivability after that, with depletion of both muscle and liver glycogen ending with energy expenditure (<xref ref-type="bibr" rid="B50">Sharma et&#xa0;al., 2020</xref>). Furthermore, drastic salinity change has been associated with oxidative stress and the production of reactive oxygen species (ROS) in fish accompanied by suppressed immune functions and antioxidant defense abilities (<xref ref-type="bibr" rid="B33">Kim and Kang, 2015</xref>).</p>
<p>Exposure to salinity stress is associated with genetic response and the modulation of gene expression in hypersalinity tolerance. For instance, the function of <italic>Na+/K+ ATPase</italic> (NKA) has been studied in the gill and kidney of multiple species of fish including silver catfish (<xref ref-type="bibr" rid="B38">Marx et&#xa0;al., 2022</xref>), Nile tilapia (<italic>Oreochromis niloticus</italic>) (<xref ref-type="bibr" rid="B40">Mohamed et&#xa0;al., 2021</xref>), Japanese eel (<xref ref-type="bibr" rid="B54">Tang et&#xa0;al., 2012</xref>), Senegalese sole (<xref ref-type="bibr" rid="B4">Armesto et&#xa0;al., 2015</xref>), and pufferfish (<italic>Tetraodon nigroviridis</italic>) (<xref ref-type="bibr" rid="B61">Wang et&#xa0;al., 2017</xref>). Since <italic>NKA</italic> is in the gills, increased expression of NKA in gills after 14 days of exposure to 10 ppt saline is probably the result of the excretion of ions that flow into the body across the thin epithelia of the gills. Also, aquaporins are water channels that play a key role in water transportation in hypersalinity exposure. The gene expression of aquaporin 3 is upregulated in gills 6 days after transfer from 5 ppt to 30 ppt saline in pufferfish. Moreover, the change in environmental salinity (10 and 25%) enhanced immune response by the elevation of mRNA expression profiles of cytokine genes <italic>IL-1&#x3b2;, IL-6, IL-10</italic>, and <italic>TNF-&#x3b1;</italic> in coastal fish Scatophagus argus (<xref ref-type="bibr" rid="B37">Lu et&#xa0;al., 2022</xref>).</p>
<p>As an adaptive and hemostasis response from the fish against salinity challenge, antioxidant enzymes, immunostimulants (pro-inflammatory cytokines), stress hormones, and non-specific immunity are elevated (<xref ref-type="bibr" rid="B55">Tapia-Paniagua et&#xa0;al., 2011</xref>). Therefore, evaluating these parameters in fish is an appropriate marker for measuring the potential influence of higher salinity exposure on innate immunity and antioxidant tolerance (<xref ref-type="bibr" rid="B47">Saurabh and Sahoo, 2008</xref>).</p>
<p>The hypothesis of the current study is to explore the molecular and biochemical mechanism by which the common carp respond to the hypersalinity and change in ecosystem. Furthermore, it is expected that the fish being studied brings about the change in the disturbed environment through homeostasis by modulating the gene expression of proinflammatory cytokines (<italic>TNF</italic> and <italic>IL-1&#x3b2;</italic>), <italic>stress hormones (<italic>CRH</italic>) and antioxidants (<italic>CAT</italic>) in the</italic> osmoregulatory and immune organs, mainly the liver, kidney, spleen, and gills. In addition, the molecular mechanism that explains the adaptation of common carp to hypersalinity is elusive; therefore, the present study is designed to bridge the gap between hypersalinity and homeostasis through molecular and biochemical mechanisms.</p>
<p>Although many studies have manipulated the effect of hypersalinity on common carp, molecular analysis is still elusive. The current study is conducted to figure out the ability of common carp &#x2013; depending on their economic importance &#x2013; to acclimate to hypersalinity, especially in the harshest change in ecosystem conditions such as freshwater salinization, pollution, and water scarcity problems</p>
<p>Subsequently, the current study endeavors to investigate the physiological mechanisms depending on the molecular and biochemical aspects in the rescue of the disturbed ecosystem due to the change in environmental salinity. The biochemical markers including total protein, albumin, globulins, A/G ratio, blood glucose, cortisone, Na<sup>+</sup>, K<sup>+</sup>, and Cl<sup>-</sup> levels were identified. Furthermore, the mRNA expression of pro-inflammatory cytokines (<italic>TNF</italic> and <italic>IL-1&#x3b2;</italic>), corticotropin-releasing hormone (<italic>CRH</italic>; a stress hormone), and catalase enzyme (<italic>CAT</italic>; an antioxidant marker) were assessed in the gills, liver, kidney, and spleen.</p>
</sec>
<sec id="s2" sec-type="materials|methods">
<label>2</label>
<title>Materials and methods</title>
<sec id="s2_1">
<label>2.1</label>
<title>Fish management</title>
<p>Common carp (<italic>Cyprinus carpio</italic>) were obtained from a commercial fish farm with an average weight of (5 &#xb1; 2 g). The fish were acclimated for 3 weeks under laboratory conditions in the Department of Fish Diseases and Aquatic Laboratory of the Faculty of Veterinary Medicine, South Valley University, Qena, Egypt, in accordance with the guidelines on the care and use of experimental animals for scientific purposes set by South Valley University. During the acclimation period, the water temperature was kept at 22&#xb0;C, the dissolved oxygen at 6.1 &#xb1; 0.5 mg/L, and the pH at 7.1. The fish were fed a commercial diet (<xref ref-type="table" rid="T1">
<bold>Table&#xa0;1</bold>
</xref>) twice daily at 3% of their body weight, maintained on a 12 h:12 h light/dark cycle, and reared in a porcelain tank re-circulation system (260 &#xd7; 65 &#xd7; 70 cm) provided with pump aeration and filled with fresh dechlorinated water (salinity = 0.2 ppt).</p>
<table-wrap id="T1" position="float">
<label>Table&#xa0;1</label>
<caption>
<p>Formulation and proximate composition of basal diets.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">S</th>
<th valign="middle" align="center">Ingredient</th>
<th valign="middle" align="center">g/100 g</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">1</td>
<td valign="top" align="left">Yellow corn</td>
<td valign="top" align="left">34.9</td>
</tr>
<tr>
<td valign="top" align="left">2</td>
<td valign="top" align="left">Vegetable bean meal</td>
<td valign="top" align="left">28.6</td>
</tr>
<tr>
<td valign="top" align="left">3</td>
<td valign="top" align="left">Fish meal</td>
<td valign="top" align="left">17.0</td>
</tr>
<tr>
<td valign="top" align="left">4</td>
<td valign="top" align="left">Wheat bran</td>
<td valign="top" align="left">9.3</td>
</tr>
<tr>
<td valign="top" align="left">5</td>
<td valign="top" align="left">Vegetable oils</td>
<td valign="top" align="left">6.5</td>
</tr>
<tr>
<td valign="top" align="left">6</td>
<td valign="top" align="left">Mineral mixture</td>
<td valign="top" align="left">1.7</td>
</tr>
<tr>
<td valign="top" align="left">7</td>
<td valign="top" align="left">Vitamin mixture</td>
<td valign="top" align="left">1.0</td>
</tr>
<tr>
<td valign="top" align="left">8</td>
<td valign="top" align="left">Ground limestone</td>
<td valign="top" align="left">0.7</td>
</tr>
<tr>
<td valign="top" align="left">9</td>
<td valign="top" align="left">Bone meal</td>
<td valign="top" align="left">0.3</td>
</tr>
</tbody>
</table>
</table-wrap>
</sec>
<sec id="s2_2">
<label>2.2</label>
<title>Experimental design</title>
<p>The fish were randomly distributed into two experimental groups (18 fish for each) and stocked in six fiberglass aquaria (60 &#xd7; 30 &#xd7; 40 cm) containing 120 L (six fish per tank in triplicates) of dechlorinated tap water.</p>
<p>One control group was kept in dechlorinated tap water (salinity = 0.2 ppt) and another salinity-exposed group was reared at 10 ppt for 5 days. The salinity is obtained by mixing an adequate amount of commercial-grade NaCl with dechlorinated tap water. Water salinity levels were gradually raised in the experimental tanks by adding NaCl to water at 3 g/l daily until reaching the proposed levels of salinity and the concentration was selected after the preliminary test run using a salinometer to determine salinity concentrations (Thermo Electron corporation model Orion 150 A+).</p>
<p>The water quality indices (temperature, pH, dissolved oxygen, and nitrite) were checked daily during the study using Martini Instruments Model 201/digital to detect the temperature, dissolved oxygen, salinity, and pH. The total ammonia level was detected calorimetrically using a HI-83303&#x2013;02 Aquaculture Multi-parameter Photometer (Woonsocket, RI, USA). The aquarium was kept at 20 &#xb1; 1&#xb0;C under natural light cycle conditions. The fish were fed twice a day with commercial floating powder feed containing 45% protein at a feeding rate of 3% of their body weight. During the experimental period, fish were checked twice a day for uncommon clinical symptoms and mortality rates (<xref ref-type="bibr" rid="B17">Emeish, 2019</xref>).</p>
</sec>
<sec id="s2_3">
<label>2.3</label>
<title>Sample collection</title>
<p>Fish were euthanized using 0.033 mL/L eugenol (<xref ref-type="bibr" rid="B28">Ham&#xe1;&#x10d;kov&#xe1; et&#xa0;al., 2006</xref>) (clove oil) on the 5th day after exposure to salinity stress. Blood samples were collected in Eppendorf tubes from the caudal vein by severing the tail and centrifuging at 3000 rpm for 15 min. The collected sera were stored at -20&#xb0;C until they were used in biochemical assays. The liver, kidney, spleen, and gills (30 mg/organ) were collected from control and salinity-exposed groups and stored in RNA later (Omega BIO-TEK, GA, USA) at &#x2212;80&#xb0;C until quantitative qPCR gene expression analysis.</p>
</sec>
<sec id="s2_4">
<label>2.4</label>
<title>Biochemical assessment</title>
<p>All biochemical parameters were monitored spectrophotometrically according to standard methods using commercial laboratory kits. Serum total proteins, albumin, sodium, and potassium chloride kits (Spectrum, Egyptian Company for Biotechnology, Obour City, Egypt) were used. Globulin level (g/dl) was calculated mathematically by subtracting albumin from the total protein value. In addition, blood glucose levels in whole blood samples were checked using the Gluco Dr. auto blood glucose monitoring system and gold-plated test strips (All Medicus Co., Ltd., Germany) following the manufacturer&#x2019;s description. All biochemical parameters were carried out by using T80 UV/VIS spectrophotometer (PG Instruments, UK). Serum cortisol levels were measured using enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer&#x2019;s instructions (#CAN-C-270; Diagnostics Biochem Canada Inc., Canada). A cortisol assay was done by a microplate reader (Infinite 50, M&#xe4;nnedorf, Switzerland) at a wavelength of 450 nm according to the manufacturer&#x2019;s instructions.</p>
</sec>
<sec id="s2_5">
<label>2.5</label>
<title>Gene transcription</title>
<p>Total RNA was extracted from the liver, kidney, spleen, and gill tissues using RNeasy<sup>&#xae;</sup> Mini kit (QIAGEN, Germany) following the manufacturer&#x2019;s instructions, and the quantity of the RNA was estimated by using Nanophotometer (NanoDrop Technologies, Wilmington, USA). For cDNA synthesis, 1&#x3bc;g of each RNA sample was reverse transcribed to cDNA in the Vetiti&#x2122; 96 Well Thermal Cycler, according to the instructions using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, MA, USA).</p>
<p>RNA expressions of <italic>TNF-&#x3b1;</italic>, <italic>IL-1&#x3b2;</italic>, <italic>CRH</italic>, and <italic>CAT</italic> mRNA were measured using a real-time qRT-PCR. The cDNA products were amplified using the HERA<sup>PLUS</sup> SYBR<sup>&#xae;</sup> Green qPCR Kit (Willowfort, England), utilizing a Stratagene Mx3005p<sup>&#xae;</sup> real-time qPCR detection system (Agilent Technologies, MA, USA). Each 20 &#x3bc;L reaction mixture contained 10 &#x3bc;L Sybr Green Master Mix, 1.5 &#x3bc;L cDNA, the gene-specific primers (0.5 &#x3bc;M each), and 1 &#x3bc;L of each primer (10 &#x3bc;M of forward and reverse) of the proposed genes (<xref ref-type="table" rid="T2">
<bold>Table&#xa0;2</bold>
</xref>), and the volume was completed up to 20 &#x3bc;L with sterile nuclease-free PCR grade water, and no template PCR control was included. The cycling conditions were the initial enzyme activation step at 95&#xb0;C/3 min followed by 40 cycles of 95&#xb0;C for 10 s and 60&#xb0;C for 1 min. To confirm the amplification of specific products, cycles were continued to check the melting curve.</p>
<table-wrap id="T2" position="float">
<label>Table&#xa0;2</label>
<caption>
<p>The forward and reverse primers for targeted genes.</p>
</caption>
<table frame="hsides">
<thead>
<tr>
<th valign="middle" align="left">Gene</th>
<th valign="middle" align="left">Forward primer (5&#x2032;-3&#x2032;)</th>
<th valign="middle" align="left">Reverse primer (5&#x2032;-3&#x2032;)</th>
<th valign="middle" align="left">Accession No</th>
<th valign="middle" align="left">References</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left">
<italic>CRH</italic>
</td>
<td valign="top" align="left">CATCCGGCTCGGTAACAGAA</td>
<td valign="top" align="left">CCAACAGACGCTGCGTTAACT</td>
<td valign="top" align="left">AJ317955</td>
<td valign="top" align="left">(<xref ref-type="bibr" rid="B7">Bernier et&#xa0;al., 2012</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>CAT</italic>
</td>
<td valign="top" align="left">AGACGACACCCATCGCTGTTCG</td>
<td valign="top" align="left">AAGGTCCCAGTTGCCCTCATCG</td>
<td valign="top" align="left">GQ376154.1</td>
<td valign="top" align="left">(<xref ref-type="bibr" rid="B26">Ghelichpour et&#xa0;al., 2019</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>IL-1&#x3b2;</italic>
</td>
<td valign="top" align="left">AAGGAGGCCAGTGGCTCTGT</td>
<td valign="top" align="left">CCTGAAGAAGAGGAGGCTGTCA</td>
<td valign="top" align="left">AB010701.1</td>
<td valign="top" align="left">(<xref ref-type="bibr" rid="B52">Sunarto and Mccoll, 2015</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>TNF-&#x3b1;</italic>
</td>
<td valign="top" align="left">GAGCTTCACGAGGACTAATAGACAGT</td>
<td valign="top" align="left">CTGCGGTAAGGGCAGCAATC</td>
<td valign="top" align="left">JF957372.1</td>
<td valign="top" align="left">(<xref ref-type="bibr" rid="B52">Sunarto and Mccoll, 2015</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>&#x3b2;-actin</italic>
</td>
<td valign="top" align="left">GATTCGCTGGAGATGATGCT</td>
<td valign="top" align="left">GATGGGGTACTTCAGGGTCA</td>
<td valign="top" align="left">M24113</td>
<td valign="top" align="left">(<xref ref-type="bibr" rid="B49">Schyth et&#xa0;al., 2006</xref>)</td>
</tr>
<tr>
<td valign="top" align="left">
<italic>EF1&#x3b1;</italic>
</td>
<td valign="top" align="left">GGAGCCCAGCACAAACATG</td>
<td valign="top" align="left">TTACCCTCCTTGCGCTCAAT</td>
<td valign="top" align="left">AF485331</td>
<td valign="top" align="left">(<xref ref-type="bibr" rid="B41">Mr&#xe1;z, 2012</xref>)</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn>
<p>
<italic>CRH</italic>, corticotropin-releasing factor; <italic>IL-1&#x3b2;</italic>, interleukin-1beta; <italic>TNF-&#x3b1;</italic>, tumor necrosis factor-alpha; <italic>CAT</italic>, catalase; <italic>EF1&#x3b1;</italic>, elongation factor1-alpha.</p>
</fn>
</table-wrap-foot>
</table-wrap>
<p>Each sample was normalized to the expression level of the housekeeping genes Beta-Actin (<italic>&#x3b2;-actin</italic>) and Elongation Factor 1-&#x3b1; (<italic>EF1&#x3b1;</italic>) to correct for differences in template input and reverse transcriptase efficiencies. All reactions were assayed in duplicate on triplicate samples, and the threshold cycle (Ct) value was obtained from the automatic setting on the Mx3005p<sup>&#xae;</sup> real-time qPCR detection system and calculated. The fold change of target gene expression in a target sample relative to a reference sample, normalized to a reference gene. The relative gene expression was calculated using the 2<sup>&#x2212;&#x394;&#x394;Ct</sup> method (<xref ref-type="bibr" rid="B36">Livak and Schmittgen, 2001</xref>).</p>
</sec>
<sec id="s2_6">
<label>2.6</label>
<title>Statistical analysis</title>
<p>All data were analyzed with GraphPad Prism software (GraphPad 8.0.1 Software, San Diego, CA, USA) using the student&#x2019;s <italic>t-test</italic>. Data were expressed as the mean &#xb1; standard error, with significant differences defined as p &lt; 0.05. RStudio (R version 4.0.2) was used to generate the correlation heatmap between variables, clustering heatmap among different treatments, and the variable important projection. The current data were validated for normality and homogeneity of variance using the Shapiro-Wilk normality test and the Kolmogorov-Smirnov normality test.</p>
</sec>
</sec>
<sec id="s3" sec-type="results">
<label>3</label>
<title>Results</title>
<sec id="s3_1">
<label>3.1</label>
<title>The effect of salinity on mortality records</title>
<p>The mortality rate was recorded in the 0.2 and 10 ppm salinity-exposed fish during the experimental period. Fish exposed to 0.2 ppm groups survived during the experimental period with a mortality rate of 0%; however, those challenged with 10 ppm disclosed different mortality rates; for instance, the death percentage on the 3rd day was 11.11%, was 16.66% on the 4th day, and was 33.33% on the 5th day, as shown in <xref ref-type="fig" rid="f1">
<bold>Figure&#xa0;1</bold>
</xref>. These data suggest the existence of a negative impact of hypersalinity medium on fish survival rate.</p>
<fig id="f1" position="float">
<label>Figure&#xa0;1</label>
<caption>
<p>Mortality rates of experimental fish after 5 days&#x2019; exposure to 0.2 and 10 ppt salinity.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1195016-g001.tif"/>
</fig>
</sec>
<sec id="s3_2">
<label>3.2</label>
<title>The effect of salinity on biochemical indices</title>
<p>The hypersalinity-exposed fish denoted significant (P &lt; 0.05) decreases in the serum levels of total protein, albumin, and globulins when compared with the corresponding control, as depicted in <xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2A&#x2013;C</bold>
</xref>, respectively. Conversely, the A/G ratio elevated non-significantly after salinity exposure compared with control fish (<xref ref-type="fig" rid="f2">
<bold>Figure&#xa0;2D</bold>
</xref>). Furthermore, blood glucose and serum cortisol levels markedly (P &lt; 0.05) increased after exposure to salinity stress when compared with control (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2E, F</bold>
</xref>, respectively). As a response to the change in the salinity environment, circulating Na<sup>+</sup>, K<sup>+</sup>, and Cl<sup>-</sup> exhibited remarkable (P &lt; 0.05) increases compared with the corresponding controls (<xref ref-type="fig" rid="f2">
<bold>Figures&#xa0;2G-I</bold>
</xref>, respectively). These findings proposed the effect of salinity exposure on the biochemical parameters measured in this study.</p>
<fig id="f2" position="float">
<label>Figure&#xa0;2</label>
<caption>
<p>Biochemical analysis in common carp after exposure to 0.2 and 10 ppt salinity. <bold>(A)</bold> Serum total protein level (g/dl). <bold>(B)</bold> Serum albumin level (g/dl). <bold>(C)</bold> Serum level of globulins (g/dl). <bold>(D)</bold> A/G ratio (%). <bold>(E)</bold> Blood glucose level (mg/dl). <bold>(F)</bold> Serum cortisol level (&#xb5;g/dl). <bold>(G)</bold> Serum level of sodium (mmol/l). <bold>(H)</bold> Serum level of potassium (mmol/l). <bold>(I)</bold> Serum level of chloride (mmol/l). Data are expressed as mean &#xb1; SEM. *P &lt; 0.05 vs. control group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1195016-g002.tif"/>
</fig>
</sec>
<sec id="s3_3">
<label>3.3</label>
<title>The effect of salinity on stress, inflammation, and antioxidant gene expressions</title>
<p>
<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref> shows the expression of the studied genes in liver tissue after exposure to 0.2 (Control) and 10 ppt for 5 days. The liver in salinity-exposed fish presented a marked (P &lt; 0.05) upregulation of <italic>TNF-&#x3b1;</italic>, <italic>IL-1&#x3b2;</italic>, <italic>CRH</italic>, and <italic>CAT</italic> mRNA expression levels when compared with the control. Furthermore, the kidney and spleen of common carp exposed to salinity 10 ppt revealed dramatic (P &lt; 0.05) upregulations of <italic>TNF-&#x3b1;</italic>, <italic>IL-1&#x3b2;</italic>, and <italic>CRH</italic> mRNA expression in comparison to controls. However, both organs revealed slightly increased mRNA expressions of antioxidant markers (<italic>CAT</italic>) compared to controls.</p>
<fig id="f3" position="float">
<label>Figure&#xa0;3</label>
<caption>
<p>Cytokines (<italic>TNF-&#x3b1;</italic> and <italic>IL-1&#x3b2;</italic>), <italic>CRH</italic>, and <italic>CAT</italic> gene expression (relative to <italic>&#x3b2;-actin</italic> and <italic>EF1&#x3b1;</italic>) in common carp&#x2019;s liver, kidney, spleen, and gills exposed to 0.2 and 10 ppt salinity. Data are expressed as mean &#xb1; SEM. *P &lt; 0.05 vs. control group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1195016-g003.tif"/>
</fig>
<p>In gills tissue, the mRNA expression of <italic>IL-1&#x3b2;</italic> revealed a significant (P &lt; 0.05) enhancement in the high salinity-exposed fish in comparison with the control group. In contrast, the mRNA expression of <italic>TNF-&#x3b1;</italic>, <italic>CRH</italic>, and <italic>CAT</italic> showed a non-significant change (<xref ref-type="fig" rid="f3">
<bold>Figure&#xa0;3</bold>
</xref>).</p>
<p>The results in <xref ref-type="fig" rid="f4">
<bold>Figure&#xa0;4</bold>
</xref> summarize the expression of proposed genes in the studied organs. <italic>TNF-&#x3b1;</italic> mRNA was markedly upregulated (P &lt; 0.05) in the liver compared with the kidney, spleen, and gills. At the same time, the expression of the same gene revealed no significant elevation in the kidney compared with splenic and gill tissues, and the spleen compared with gills. Concerning <italic>IL-1&#x3b2;</italic> gene expression, the highest expression was exemplified in the liver, which showed a non-significant upregulation compared with other proposed organs. Furthermore, <italic>IL-1&#x3b2;</italic> gene expression slightly increased in the gills compared with the liver and spleen. Similar to <italic>TNF-&#x3b1;</italic>, <italic>CRH</italic> gene expression recorded a significant (P &lt; 0.05) upregulation in the liver compared with the expression of the other three organs.</p>
<fig id="f4" position="float">
<label>Figure&#xa0;4</label>
<caption>
<p>Comparison of gene expressions (relative to <italic>&#x3b2;-actin</italic> and <italic>EF1&#x3b1;</italic>) in common carp&#x2019;s different organs (liver, kidney, spleen, and gills) exposed to 0.2 and 10 ppt salinity. Data are expressed as mean &#xb1; SEM. *P &lt; 0.05 vs. control group.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1195016-g004.tif"/>
</fig>
<p>Furthermore, the former gene increased non-significantly in the renal tissue by three and five folds compared to the spleen and gill expression. Finally, <italic>CAT</italic> gene expression revealed prominent and significant (P &lt; 0.05) upregulations in the hepatic tissue compared with the renal, splenic, and gill tissues, which expressed almost the same values of the <italic>CAT</italic> gene. The abovementioned gene expression data indicated that the recorded gene alterations were organ dependent.</p>
</sec>
<sec id="s3_4">
<label>3.4</label>
<title>Hierarchical clustering heatmap and variable important project (VIP) score</title>
<p>The clustering heatmap depicted in <xref ref-type="fig" rid="f5">
<bold>Figure&#xa0;5</bold>
</xref> provides an intuitive visualization of all datasets which summarizes the correlation between all measured biochemical variables and mRNA expression of target genes in response to 0.2 and 10 ppt salt concentrations for 5 days. The contribution is explicated by a colored scale ranging from the highest (red indicates positive correlation) to the lowest (blue indicates negative correlation). The degree of correlation is shown by the color&#x2019;s intensity. The various squares are colored in accordance with Pearson&#x2019;s correlation coefficient between all measured variables. These data exhibit strong positive correlations between stress, proinflammatory cytokines, and antioxidants-expressed genes in all targeted tissues and the exitance of negative correlations between those genes and the total protein, albumin, and globulin concentrations in blood. In addition, <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6A</bold>
</xref> summarizes the variable averages in response to different salinity concentrations in the current study. These data suggest the occurrence of physiopathological alterations in salinity-stressed fish.</p>
<fig id="f5" position="float">
<label>Figure&#xa0;5</label>
<caption>
<p>Correlation heatmap of all variables. The clustering heatmap provides an intuitive visualization of all data sets which summarizes the correlation between all measured biochemical variables and mRNA expression of target genes in response to 0.2 and 10 ppt salt concentrations for 5 days in each sample. The contribution is explicated by a colored scale ranging from the highest (red indicates positive correlation) to the lowest (blue indicates negative correlation). The degree of correlation is shown by the color&#x2019;s intensity. The various squares are colored in accordance with Pearson&#x2019;s correlation coefficient between all measured variables.</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1195016-g005.tif"/>
</fig>
<fig id="f6" position="float">
<label>Figure&#xa0;6</label>
<caption>
<p>Clustering heatmap and variable importance in projection (VIP) scores. <bold>(A)</bold> Hierarchical clustering heatmap enables intuitive visualization of all data sets. Each colored cell on the map denotes the concentration values, with variable averages in rows and different treatment sets in columns. Dark red is the highest value on the gradation scale, and blue represents the lowest value. <bold>(B)</bold> Variable importance in projection (VIP) scores: the colored boxes on the right display the relative concentrations of the relevant measured parameters in each study group, while the contribution intensity is indicated by a colored scale spanning from the highest (red) to the lowest (blue).</p>
</caption>
<graphic mimetype="image" mime-subtype="tiff" xlink:href="fmars-10-1195016-g006.tif"/>
</fig>
<p>Next, in order to reveal the most influencing variables in response to salinity exposure, the VIP score was calculated. As presented in <xref ref-type="fig" rid="f6">
<bold>Figure&#xa0;6B</bold>
</xref>, <italic>TNF-&#x3b1;, IL-1&#x3b2;, CRH</italic>, and <italic>CAT</italic> mRNA in liver, kidney, and spleen tissue along with blood Na<sup>+</sup>, K<sup>+</sup>, Cl<sup>-</sup>, and cortisone strongly contributed to the mechanism involved in the salinity-induced physiopathological alterations in common carp.</p>
</sec>
</sec>
<sec id="s4" sec-type="discussion">
<label>4</label>
<title>Discussion</title>
<p>Salinity change is a major eco-stress factor affecting marine and estuarine organisms. However, many species can tolerate salinity fluctuation depending on how they cope. The current study is an in-depth understanding of the molecular mechanism response to salinity stress for 5 days by evaluating pro-inflammatory cytokines (<italic>TNF-&#x3b1;</italic> and <italic>IL-1&#x3b2;</italic>), the stress hormone (<italic>CRH</italic>), and antioxidant capacity (<italic>CAT</italic>) in the liver, kidney, spleen, and gills. Salinity challenge disrupts most physiological functions and biological processes, including hepatic, renal, and gill functions, blood dissolved gases, blood parameters, and hormonal regulation (<xref ref-type="bibr" rid="B40">Mohamed et&#xa0;al., 2021</xref>).</p>
<p>In addition, the tolerance to salinity stress is varied according to the aquatic species. In this study, mortalities started on the 3rd day and increased gradually until reaching 33.33% on the 5th day, indicating the limited ability of common carp to salinity adaptation. Therefore, the current study is necessary to shed light on the physiological mechanism depending on molecular and biochemical aspects in the rescue of the disturbed ecosystem and the change in environmental salinity. The current results are matching with that recorded by <xref ref-type="bibr" rid="B1">Akther et&#xa0;al., 2013</xref> who found that acute exposure of <italic>Barbodes gonionotus</italic> to 15 ppt salinity showed a mortality rate of 20% after 24 h and 100% after 4 days.</p>
<p>The liver is the most affected organ by salinity stress, which is linked with a noticeable decrease in serum total protein, albumin, and globulins (Alkhshali and Al-Hilalli, 2019). The alteration of hepatic function is caused by oxidative stress and reactive oxygen species production (<xref ref-type="bibr" rid="B33">Kim and Kang, 2015</xref>), which is confirmed by the upregulation of <italic>CAT</italic> gene expression in the liver. Moreover, the change in circulating total protein, albumin, and globulin levels in the abovementioned results could be proof of water and electrolyte (dehydration) perturbation resulting from hypersalinity stress. In addition, the elevation of stress factors (<italic>CRH</italic> gene, cortisol, and blood glucose) in response to salinity challenges that are linked with the hypothalamic-pituitary-interrenal (HPI) axis often results in tissue modulation. Consequently, elevated corticosteroids reduce protein synthesis, enhance catabolism, and accelerate energy expenditure (<xref ref-type="bibr" rid="B51">Sopinka et&#xa0;al., 2016</xref>).</p>
<p>In addition, there was also a dynamic elevation in blood glucose levels. A stress reaction is expressed as increased blood glucose levels associated with high <italic>CRH</italic> gene expression and high circulating cortisol level, which is assumed to be a result of the hypothalamic-pituitary-interrenal (HPI) axis activity as evidenced by <xref ref-type="bibr" rid="B59">Wang et&#xa0;al., 2020</xref>. Interestingly, the elevation of blood glucose levels after salinity exposure is accompanied by catecholamine secretion, which is part of the mechanism to counteract abrupt changes in environmental salinity. Furthermore, catecholamine release is followed by increased gill perfusion facilitating ion and gas exchange between fish bodies and the external environment (<xref ref-type="bibr" rid="B14">Demska-Zak&#x119;&#x15b; et&#xa0;al., 2021</xref>).</p>
<p>The most influenced aspect after the salinity challenge is the ionic basis as common carp showed significant elevations of Na<sup>+</sup>, K<sup>+</sup>, and Cl<sup>-</sup>. The primary organs for ion transport and water exchange in aquaculture are the gill epithelium, kidney, and intestinal epithelium (<xref ref-type="bibr" rid="B19">Evans and Claiborne, 2009</xref>). In this study, the elevation of Na<sup>+</sup> and Cl<sup>-</sup> is a preparatory stage for ionic equilibrium and water exchange by activating <italic>Na<sup>+</sup>/K<sup>+</sup> ATPase</italic> and upregulating aquaporin3, especially in gills tissue (<xref ref-type="bibr" rid="B32">Jumah, 2020</xref>). The preceding studies denoted the elevation of Na<sup>+</sup>, K<sup>+</sup>, and Cl<sup>-</sup> in pikeperch exposed to high salinity, matching the current findings (<xref ref-type="bibr" rid="B14">Demska-Zak&#x119;&#x15b; et&#xa0;al., 2021</xref>).</p>
<p>The liver is a fundamental organ that plays a crucial role in vital functions in living organisms, including metabolism, immunity, digestion, and detoxification (<xref ref-type="bibr" rid="B5">Atrees and Rabia, 2021</xref>). A stressful environment for aquatic organisms contributes to the deterioration of physiological cellular function by developing oxidative stress (<xref ref-type="bibr" rid="B67">Zhou et&#xa0;al., 2020</xref>). As a response to salinity stress, the present study demonstrates an immune response represented by the upregulation of <italic>TNF-&#x3b1;</italic> and <italic>IL-1&#x3b2;</italic> gene expression in hepatic tissue. The upregulation of these genes is a potent inflammation and pro-inflammatory response to regulate immunity and cope with stressors (<xref ref-type="bibr" rid="B65">Yahfoufi et&#xa0;al., 2018</xref>).</p>
<p>Furthermore, the results emphasized the upregulation of <italic>CRH</italic> gene expression in hepatic tissue. Oxidative stress induced by hypersalinity is associated with the activation of antioxidant enzymes involving <italic>CAT</italic> gene expression trying to overcome the adverse effect of ROS on DNA hepatocytes (<xref ref-type="bibr" rid="B6">Baldissera et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B62">Xavier et&#xa0;al., 2020</xref>).</p>
<p>The kidney is the second osmoregulatory organ after the gills, representing the crucial line (<xref ref-type="bibr" rid="B9">Buddington and Krogdahl, 2004</xref>). The osmoregulatory role of the kidney in stenohaline is prominent in environmental salinity stress. This role is represented in the excretion of a large amount of water through high glomerular filtration and activity reabsorption of the most ions to maintain fluid and electrolytes hemostasis (<xref ref-type="bibr" rid="B53">Takvam et&#xa0;al., 2021</xref>). <italic>TNF-&#x3b1;, IL-1&#x3b2;, CRH</italic>, and <italic>CAT</italic> monitored the molecular mechanism of renal tissue.</p>
<p>Like other organs, the kidney is affected adversely by hypersalinity, starting with the activation of pro-inflammatory cytokines (<xref ref-type="bibr" rid="B8">Brocker et&#xa0;al., 2012</xref>), supporting the current results by the elevation of <italic>TNF-&#x3b1;</italic> and <italic>IL-1&#x3b2;</italic> gene expression. In fish, the hypothalamic-pituitary-interrenal axis is a primary neuroendocrine modulatory system of immunity to tolerate stress (<xref ref-type="bibr" rid="B24">Gallo and Civinini, 2003</xref>). Moreover, it is stimulated by variable stressors <italic>via IL-1&#x3b2;</italic>, subsequently enhancing <italic>CRH</italic> release from the hypothalamic preoptic nucleus and cortisol hormone synthesis and secretion from inter-renal cells of the head kidney (<xref ref-type="bibr" rid="B39">Metz et&#xa0;al., 2006</xref>).</p>
<p>On the other hand, salinity stress has no effect on <italic>CAT</italic> gene expression in the kidney. According to <xref ref-type="bibr" rid="B60">Wang et&#xa0;al. (2016)</xref>, antioxidant enzyme activity, including <italic>SOD</italic> gene expression, is downregulated in juvenile marbled eels after a high salinity challenge but upregulated after a low salinity challenge. The fact that the relationship between enzymatic activity and mRNA expression is not linear (<xref ref-type="bibr" rid="B12">Chambers and Matrisian, 1997</xref>; <xref ref-type="bibr" rid="B60">Wang et&#xa0;al., 2016</xref>) explains the inexplicable changes in <italic>CAT</italic> gene expression.</p>
<p>The spleen is the main lymphoid and immunocompetent organ (<xref ref-type="bibr" rid="B66">Zapata et&#xa0;al., 2006</xref>). So, it is more sensitive and is rapidly affected by salinity stress, as shown in the present study; <italic>TNF-&#x3b1;</italic> and <italic>IL-1&#x3b2;</italic> gene expression is upregulated, agreeing with <xref ref-type="bibr" rid="B63">Xu et&#xa0;al. (2018)</xref> and <xref ref-type="bibr" rid="B64">Xu et&#xa0;al. (2020)</xref>, who reported the upregulation of both genes in the spleen of <italic>Tilapia nilotica</italic> after exposure to 16% salinity. Similarly, <italic>CRH</italic> gene expression was upregulated in the spleen as a response to salinity stress. <xref ref-type="bibr" rid="B29">Harl&#xe9; et&#xa0;al. (2018)</xref> confirmed that <italic>CRH</italic> receptors-2 are expressed in splenic B-cells, supporting our results. Likewise, other organs and the spleen suffer from oxidative stress after salinity stress, which is observed by enhancing antioxidant capacity through the upregulation of <italic>CAT</italic>.</p>
<p>The primary osmoregulatory organs are the gills (<xref ref-type="bibr" rid="B31">Hwang et&#xa0;al., 2018</xref>). They control ion transport <italic>via</italic> the <italic>Na<sup>+</sup>/K<sup>+</sup> ATPase</italic> pump and water exchange <italic>via</italic> aquaporin channels (<xref ref-type="bibr" rid="B35">Li et&#xa0;al., 2006</xref>). Furthermore, <italic>TNF-&#x3b1;</italic> is the main pro-inflammatory cytokine associated with apoptosis and autoimmune conditions (<xref ref-type="bibr" rid="B25">Gao et&#xa0;al., 2015</xref>). The present results are consistent with <xref ref-type="bibr" rid="B16">El-Leithy et&#xa0;al. (2019)</xref>, who confirmed the elevation of <italic>IL-1&#x3b2;</italic> gene expression in <italic>Tilapia nilotica</italic> after high salinity exposure. Moreover, salinity stress has a dual effect on immune response as it down-regulates or activates some immune mediators according to salinity dose and exposure time (<xref ref-type="bibr" rid="B56">Tort, 2011</xref>; <xref ref-type="bibr" rid="B48">Schmitz et&#xa0;al., 2017</xref>). In addition, some stress conditions induce salinity that can suppress or stimulate a specific pathway of cytokine production (<xref ref-type="bibr" rid="B15">Dhabhar, 2008</xref>). Furthermore, as reported by <xref ref-type="bibr" rid="B11">Castillo et&#xa0;al. (2008)</xref>, cortisol secreted in response to stress has an influential inhibitory role in some cytokines, specifically <italic>TNF-&#x3b1;</italic> (<xref ref-type="bibr" rid="B44">Saeij et&#xa0;al., 2003</xref>).</p>
<p>Salinity stress is considered the hypothalamic-pituitary-interrenal axis activator represented by the neuroendocrine response that involves instant secretion of <italic>CRH</italic> by the preoptic nucleus of the hypothalamus, ACTH from the pituitary gland, and, finally, cortisol hormone from the head kidney (<xref ref-type="bibr" rid="B56">Tort, 2011</xref>). <italic>CRH</italic> allocation has been found in the common carp spleen and kidney, indicating that <italic>CRH</italic> receptors are highly expressed in these organs. <xref ref-type="bibr" rid="B30">Huising et&#xa0;al., 2004</xref> explain that no change in <italic>CRH</italic> gene expression in gills tissue is due to a negative feedback mechanism. Hence, enhancing antioxidant enzyme activity can cause a disturbance in the balance between ROS production and removal, resulting in oxidative stress (<xref ref-type="bibr" rid="B13">Chowdhury and Saikia, 2020</xref>). Unexpectedly, the current study showed no change in gills <italic>CAT</italic> gene expression after exposure to salinity challenge due to no change in TNF-&#x3b1;. Pro-inflammatory cytokines (mainly TNF-&#x3b1;) trigger oxidative stress and stimulate the regulation and adaptation of the immune system to tolerate environmental stressors (<xref ref-type="bibr" rid="B65">Yahfoufi et&#xa0;al., 2018</xref>).</p>
<p>The activity of antioxidant enzymes including <italic>CAT</italic> after salinity challenge depending on the salinity dose and time of exposure to hypersalinity; antioxidant capacity has been improved in <italic>Tilapia nilotica</italic> after exposure to high salinity for a short time (<xref ref-type="bibr" rid="B6">Baldissera et&#xa0;al., 2019</xref>; <xref ref-type="bibr" rid="B62">Xavier et&#xa0;al., 2020</xref>). The current results agree with <xref ref-type="bibr" rid="B63">Xu et&#xa0;al. (2018)</xref> who denoted that hypersalinity for a long time has no effect on <italic>CAT</italic> activity in <italic>Tilapia nilotica</italic>. In this study, the powerful upregulation of <italic>CAT</italic> gene expression in the liver may oppose its expression in the kidney, spleen, and gills <italic>via</italic> a negative feedback mechanism.</p>
<p>Hypersalinity induced an osmoregulatory modification in the gills including the activation of the <italic>Na<sup>+</sup>/K<sup>+</sup> ATPase</italic> pump which is considered a compensatory response to the increased absorption of ions, so the elevation of gill&#x2019;s <italic>NKA</italic> activity is an integral part of a successful acclimation to increased salinity (<xref ref-type="bibr" rid="B46">Sangiao-Alvarellos et&#xa0;al., 2006</xref>) besides the high density of mitochondria in the gills and the elongation of the cristae and acquiring tubular profile. Subsequently, there is an increase in the ability to produce energy by ATPase synthase, which is necessary for the generation of ATP. Thus, high energy production is the key activator of the <italic>Na<sup>+</sup>/K<sup>+</sup> ATPase</italic> pump which regulates ion exchange during hypersalinity ending with tolerance (<xref ref-type="bibr" rid="B42">Paumard et&#xa0;al., 2002</xref>). Moreover, the elevation of environmental salinity changes the ultrastructure of chloride cells which perform an integral role in acid-base regulation during exposure to high salinity by the regulation of Cl-/HCO3- exchange (<xref ref-type="bibr" rid="B43">Perry, 1997</xref>). Previous studies have proved the increase in the number and activity of chloride cells after salinity exposure in the gills of common carp (<xref ref-type="bibr" rid="B2">Al-Hilalli and Alkhshali, 2019</xref>), <italic>Oreochromis mossambicus</italic> (<xref ref-type="bibr" rid="B34">Lee et&#xa0;al., 2000</xref>), and juvenile Australian snapper (<xref ref-type="bibr" rid="B22">Fielder et&#xa0;al., 2007</xref>).</p>
<p>Exposure to high salinity requires a marked change in the osmoregulatory mechanism to maintain osmotic homeostasis by excessive water intake and ion excretion. For the active and passive transport of ions and water, all the epithelia in the intestine, gills, and kidney play an essential role in the exchange between water and ions, but the intestinal epithelia are predominant in the regulation of fluid intake among the previous organs (<xref ref-type="bibr" rid="B18">Evans, 2008</xref>). The intestine tight junction consists of several physiologically regulated proteins forming the circumferential seals around the adjacent epithelial cells called claudins. Claudins gene expression was upregulated during hypersalinity as they regulated the permeability of charged and uncharged molecules (<xref ref-type="bibr" rid="B57">Van Itallie et&#xa0;al., 2008</xref>).</p>
<p>The multivariate analyses represented by heatmaps and VIP scores affirm the abovementioned data. The clustering heatmap cleared observable differences between the concentration values of all variables in response to different changes in salinity % exposure. These data strongly confirm the responsive adaptive mechanisms of common carp to changes in salinity concentration. Therefore, the VIP scores revealed that the <italic>TNF-&#x3b1;, IL-1&#x3b2;, CRH</italic>, and <italic>CAT</italic> mRNA in the liver, kidney, and spleen tissue along with blood Na<sup>+</sup>, K<sup>+</sup>, Cl<sup>-</sup>, and cortisone were the most contributing factors in the adaptive mechanism of common carp to salinity alterations.</p>
</sec>
<sec id="s5" sec-type="conclusions">
<label>5</label>
<title>Conclusions</title>
<p>The current experiment is considered a novel study that explains the molecular and biochemical mechanisms for the acclimation to hypersalinity stress in common carp. Total serum protein, albumin, and globulins decreased significantly, while blood glucose, circulating cortisol, Na<sup>+</sup>, K<sup>+</sup>, and Cl<sup>-</sup> increased, by the adverse effect of hypersalinity. In addition, hypersalinity is considered an immune and stress stimulant by upregulating gene expression of pro-inflammatory cytokines, <italic>TNF-&#x3b1;</italic>, and <italic>IL-1&#x3b2;</italic>, as well as <italic>CRH</italic> genes in the liver, kidney, and spleen. Moreover, the acclimation of common carp to hypersalinity is represented by a marked upregulation of <italic>CAT</italic> gene expression in the liver without changes in the kidney and spleen. It is worth mentioning that the salinity challenge had a minimum effect on the gill tissue by regulating the <italic>IL-1&#x3b2;</italic> gene only without changes in <italic>TNF-&#x3b1;</italic>, <italic>CRH</italic>, and <italic>CAT</italic> gene expression. Furthermore, future study is required, using advanced techniques such as electron microscopy for an in-depth clarification of the activity and number of chloride cells inside the gill&#x2019;s microstructure as the main osmoregulatory organ in hypersalinity conditions. In addition, further molecular study is necessary for <italic>Na<sup>+</sup>/K<sup>+</sup> ATPase</italic> and Aquaporin gene expression which are the main contributors of homeostasis to hypersalinity.</p>
</sec>
<sec id="s6" sec-type="data-availability">
<title>Data availability statement</title>
<p>The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/supplementary material.</p>
</sec>
<sec id="s7" sec-type="ethics-statement">
<title>Ethics statement</title>
<p>The animal study was reviewed and approved by the Ethical Research Committee of Faculty of Veterinary Medicine in South Valley University, Egypt under approval number (No. 48/12.9.2022).</p>
</sec>
<sec id="s8" sec-type="author-contributions">
<title>Author contributions</title>
<p>HA, KB, and WE: Conceptualization, Formal analysis, Methodology, Investigation, Writing&#x2014;original draft, and Writing &#x2013; review and editing. AA, MA, and MS: Conceptualization, Formal analysis, Methodology, Data curation, Formal analysis, Writing&#x2014;original draft, and Writing &#x2013; review and editing. HE, ME, and SB: Conceptualization, Methodology, Investigation, Data curation, Formal analysis, Validation, and Writing&#x2014;original draft. LF and SI: Resources, Software, Data curation, Validation, Visualization, Writing &#x2013; original draft, Writing &#x2013; review and editing, and Funding acquisition. FI: Software, Data curation, Validation, Writing &#x2013; review and editing, and Funding acquisition. All authors contributed to the article and approved the submitted version.</p>
</sec>
</body>
<back>
<sec id="s9" sec-type="funding-information">
<title>Funding</title>
<p>This research was funded by the Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R127), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia; and the project 6PFE of the University of Life Sciences "King Mihai I" from Timisoara and Research Institute for Biosecurity and Bioengineering from Timisoara.</p>
</sec>
<ack>
<title>Acknowledgments</title>
<p>The authors are grateful for the resources provided by Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2023R127), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. This paper is published by the project 6PFE of the University of Life Sciences &#x201c;King Mihai I&#x201d; from Timisoara and the Research Institute for Biosecurity and Bioengineering from Timisoara. Moreover, the authors would like to thank Prof. Ahmad Abd Elhady Elkamel, Professor and head of the Aquatic Animal Medicine and Management Department, Faculty of Veterinary Medicine, Assiut University, for his technical assistance with RT-qPCR.</p>
</ack>
<sec id="s10" sec-type="COI-statement">
<title>Conflict of interest</title>
<p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p>
</sec>
<sec id="s11" sec-type="disclaimer">
<title>Publisher&#x2019;s note</title>
<p>All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.</p>
</sec>
<ref-list>
<title>References</title>
<ref id="B1">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Akther</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Mollah</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kadir</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2013</year>). <article-title>Laboratory investigation on salinity tolerance to <italic>Barbodes gonionotus</italic> (Bleeker)</article-title>. <source>Progressive Agric.</source> <volume>20</volume>, <fpage>193</fpage>&#x2013;<lpage>200</lpage>. doi: <pub-id pub-id-type="doi">10.3329/pa.v20i1-2.16871</pub-id>
</citation>
</ref>
<ref id="B2">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Hilalli</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Alkhshali</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Influence of transfer to high salinity on chloride cells, oxygen and energy consumption in common carp <italic>Cyprinus carpio</italic>
</article-title>. <source>J. Anim. Sci. products</source> <volume>2</volume>, <fpage>1</fpage>&#x2013;<lpage>12</lpage>.</citation>
</ref>
<ref id="B3">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Al-Khshali</surname> <given-names>M. S.</given-names>
</name>
<name>
<surname>Al-Hilali</surname> <given-names>H. A.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>Some physiological changes (ALP, AST AND ALT) of common carp (<italic>Cyprinus carpio</italic>) caused by high salinity</article-title>. <source>Biochem. Cell. Arch.</source> <volume>2</volume>, <fpage>4605</fpage>&#x2013;<lpage>4610</lpage>. doi: <pub-id pub-id-type="doi">10.35124/bca.2019.19.2.4605</pub-id>
</citation>
</ref>
<ref id="B4">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Armesto</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Cousin</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Salas-Leiton</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Asensio</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Manchado</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Infante</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Molecular characterization and transcriptional regulation of the renin&#x2013;angiotensin system genes in Senegalese sole (<italic>Solea senegalensis</italic> Kaup 1858): differential gene regulation by salinity</article-title>. <source>Comp. Biochem. Physiol. Part A.: Mol. Integr. Physiol.</source> <volume>184</volume>, <fpage>6</fpage>&#x2013;<lpage>19</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.cbpa.2015.01.021</pub-id>
</citation>
</ref>
<ref id="B5">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Atrees</surname> <given-names>S. S.</given-names>
</name>
<name>
<surname>Rabia</surname> <given-names>H. M.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Herbs and supplements for liver toxicity: a review on mode of action of herbs and supplements on liver toxicity</article-title>. <source>Med. J. Cairo Univ.</source> <volume>89</volume>, <fpage>2179</fpage>&#x2013;<lpage>2183</lpage>. doi: <pub-id pub-id-type="doi">10.21608/mjcu.2021.203687</pub-id>
</citation>
</ref>
<ref id="B6">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Baldissera</surname> <given-names>M. D.</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>C. F.</given-names>
</name>
<name>
<surname>Descovi</surname> <given-names>S. N.</given-names>
</name>
<name>
<surname>Petrolli</surname> <given-names>T. G.</given-names>
</name>
<name>
<surname>Da Silva</surname> <given-names>A. S.</given-names>
</name>
<name>
<surname>Baldisserotto</surname> <given-names>B.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>A caffeine-supplemented diet modulates oxidative stress markers and prevents oxidative damage in the livers of Nile tilapia (<italic>Oreochromis niloticus</italic>) exposed to hypoxia</article-title>. <source>Fish Physiol. Biochem.</source> <volume>45</volume>, <fpage>1041</fpage>&#x2013;<lpage>1049</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10695-019-00616-7</pub-id>
</citation>
</ref>
<ref id="B7">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Bernier</surname> <given-names>N. J.</given-names>
</name>
<name>
<surname>Gorissen</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Flik</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Differential effects of chronic hypoxia and feed restriction on the expression of leptin and its receptor, food intake regulation and the endocrine stress response in <italic>common carp</italic>
</article-title>. <source>J. Exp. Biol.</source> <volume>215</volume>, <fpage>2273</fpage>&#x2013;<lpage>2282</lpage>. doi: <pub-id pub-id-type="doi">10.1242/jeb.066183</pub-id>
</citation>
</ref>
<ref id="B8">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Brocker</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Thompson</surname> <given-names>D. C.</given-names>
</name>
<name>
<surname>Vasiliou</surname> <given-names>V.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The role of hyperosmotic stress in inflammation and disease</article-title>. <source>BioMol. Concepts</source> <volume>3</volume>, <fpage>345</fpage>&#x2013;<lpage>364</lpage>. doi: <pub-id pub-id-type="doi">10.1515/bmc-2012-0001</pub-id>
</citation>
</ref>
<ref id="B9">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Buddington</surname> <given-names>R. K.</given-names>
</name>
<name>
<surname>Krogdahl</surname> <given-names>&#xc5;.</given-names>
</name>
</person-group> (<year>2004</year>). <article-title>Hormonal regulation of the fish gastrointestinal tract</article-title>. <source>Comp. Biochem. Physiol. Part A.: Mol. Integr. Physiol.</source> <volume>139</volume>, <fpage>261</fpage>&#x2013;<lpage>271</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.cbpb.2004.09.007</pub-id>
</citation>
</ref>
<ref id="B10">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Cao</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Bi</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Chi</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Dong</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Xia</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>Z.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Effects of high salinity stress on the survival, gill tissue, enzyme activity and free amino acid content in razor clam <italic>Sinonovacula constricta</italic>
</article-title>. <source>Front. Mar. Sci.</source> <volume>9</volume>. doi: <pub-id pub-id-type="doi">10.3389/fmars.2022.839614</pub-id>
</citation>
</ref>
<ref id="B11">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Castillo</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Castellana</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Acerete</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Planas</surname> <given-names>J. V.</given-names>
</name>
<name>
<surname>Goetz</surname> <given-names>F. W.</given-names>
</name>
<name>
<surname>Mackenzie</surname> <given-names>S.</given-names>
</name>
<etal/>
</person-group>. (<year>2008</year>). <article-title>Stress-induced regulation of steroidogenic acute regulatory protein expression in head kidney of gilthead seabream (<italic>Sparus aurata</italic>)</article-title>. <source>J. Endocrinol.</source> <volume>196</volume>, <fpage>313</fpage>&#x2013;<lpage>322</lpage>. doi: <pub-id pub-id-type="doi">10.1677/JOE-07-0440</pub-id>
</citation>
</ref>
<ref id="B12">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chambers</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>Matrisian</surname> <given-names>L. M.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>Changing views of the role of matrix metalloproteinases in metastasis</article-title>. <source>J. Natl. Cancer Inst.</source> <volume>89</volume>, <fpage>1260</fpage>&#x2013;<lpage>1270</lpage>. doi: <pub-id pub-id-type="doi">10.1093/jnci/89.17.1260</pub-id>
</citation>
</ref>
<ref id="B13">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Chowdhury</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Saikia</surname> <given-names>S. K.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Oxidative stress in fish: a review</article-title>. <source>J. Sci. Res.</source> <volume>12</volume>, <fpage>145</fpage>&#x2013;<lpage>160</lpage>. doi: <pub-id pub-id-type="doi">10.3329/jsr.v12i1.41716</pub-id>
</citation>
</ref>
<ref id="B14">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Demska-Zak&#x119;&#x15b;</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Gomu&#x142;ka</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Ro&#x17c;y&#x144;ski</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zak&#x119;&#x15b;</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Effect of a short-term sodium chloride bath on juvenile pikeperch (<italic>Sander lucioperca</italic>) welfare</article-title>. <source>Aquac. Rep.</source> <volume>19</volume>, <fpage>100569</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aqrep.2020.100569</pub-id>
</citation>
</ref>
<ref id="B15">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Dhabhar</surname> <given-names>F. S.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Enhancing versus suppressive effects of stress on immune function: implications for immunoprotection versus immunopathology</article-title>. <source>Allergy Asthma Clin. Immunol.</source> <volume>4</volume>, <fpage>2</fpage>&#x2013;<lpage>11</lpage>. doi: <pub-id pub-id-type="doi">10.1186/1710-1492-4-1-2</pub-id>
</citation>
</ref>
<ref id="B16">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>El-Leithy</surname> <given-names>A. A. A.</given-names>
</name>
<name>
<surname>Hemeda</surname> <given-names>S. A.</given-names>
</name>
<name>
<surname>El Naby</surname> <given-names>W. S. H. A.</given-names>
</name>
<name>
<surname>El Nahas</surname> <given-names>A. F.</given-names>
</name>
<name>
<surname>Hassan</surname> <given-names>S. A. H.</given-names>
</name>
<name>
<surname>Awad</surname> <given-names>S. T.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Optimum salinity for Nile tilapia <italic>(Oreochromis niloticus</italic>) growth and mRNA transcripts of ion-regulation, inflammatory, stress- and immune-related genes</article-title>. <source>Fish Physiol. Biochem.</source> <volume>45</volume>, <fpage>1217</fpage>&#x2013;<lpage>1232</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10695-019-00640-7</pub-id>
</citation>
</ref>
<ref id="B17">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Emeish</surname> <given-names>W.</given-names>
</name>
</person-group> (<year>2019</year>). <article-title>ADAPTATION OF COMMON CARP TO SALINITY</article-title>. <source>Assiut. Vet. Med. J.</source> <volume>65</volume>, <fpage>101</fpage>&#x2013;<lpage>110</lpage>. doi: <pub-id pub-id-type="doi">10.21608/avmj.2019.168957</pub-id>
</citation>
</ref>
<ref id="B18">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Evans</surname> <given-names>D. H.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Teleost fish osmoregulation: what have we learned since august krogh, homer smith, and ancel keys</article-title>. <source>Am. J. Physiol.-Regulatory Integr. Comp. Physiol.</source> <volume>295</volume>, <fpage>R704</fpage>&#x2013;<lpage>R713</lpage>. doi: <pub-id pub-id-type="doi">10.1152/ajpregu.90337.2008</pub-id>
</citation>
</ref>
<ref id="B19">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Evans</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Claiborne</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2009</year>). &#x201c;<article-title>Osmotic and ionic regulation infishes</article-title>,&#x201d; in <source>Osmotic and ionic regulation:cells and animals</source>. Ed. <person-group person-group-type="editor">
<name>
<surname>Evans</surname> <given-names>D. E.</given-names>
</name>
</person-group> (<publisher-loc>Boca Raton</publisher-loc>: <publisher-name>CRC Press</publisher-name>), <fpage>295</fpage>&#x2013;<lpage>366</lpage>.</citation>
</ref>
<ref id="B20">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Evans</surname> <given-names>T. G.</given-names>
</name>
<name>
<surname>K&#xfc;ltz</surname> <given-names>D.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>The cellular stress response in fish exposed to salinity fluctuations</article-title>. <source>J. Exp. Zool. Part A.: Ecol. Integr. Physiol.</source> <volume>333</volume>, <fpage>421</fpage>&#x2013;<lpage>435</lpage>. doi: <pub-id pub-id-type="doi">10.1002/jez.2350</pub-id>
</citation>
</ref>
<ref id="B21">
<citation citation-type="book">
<person-group person-group-type="author">
<collab>FAO</collab>
</person-group> (<year>2003</year>). <source>Unlocking the water potential of agriculture</source> (<publisher-loc>Italy</publisher-loc>: <publisher-name>Food and Agriculture Organization United Nations</publisher-name>), <fpage>62</fpage>.</citation>
</ref>
<ref id="B22">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Fielder</surname> <given-names>D. S.</given-names>
</name>
<name>
<surname>Allan</surname> <given-names>G. L.</given-names>
</name>
<name>
<surname>Pepperall</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Pankhurst</surname> <given-names>P. M.</given-names>
</name>
</person-group> (<year>2007</year>). <article-title>The effects of changes in salinity on osmoregulation and chloride cell morphology of juvenile Australian snapper, pagrus auratus</article-title>. <source>Aquaculture</source> <volume>272</volume>, <fpage>656</fpage>&#x2013;<lpage>666</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aquaculture.2007.08.043</pub-id>
</citation>
</ref>
<ref id="B23">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Fitzsimmons</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Janjua</surname> <given-names>R. S. N.</given-names>
</name>
<name>
<surname>Ashraf</surname> <given-names>M.</given-names>
</name>
</person-group> (<year>2015</year>). &#x201c;<article-title>Aquaculture handbook, fish farming and nutrition in Pakistan</article-title>,&#x201d; in <source>SoyPak</source> (<publisher-loc>Pakistan</publisher-loc>: <publisher-name>ASA/WISHH</publisher-name>), <fpage>441</fpage>.</citation>
</ref>
<ref id="B24">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gallo</surname> <given-names>V. P.</given-names>
</name>
<name>
<surname>Civinini</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Survey of the adrenal homolog in teleosts</article-title>. <source>Int. Rev. Cytol.</source> <volume>230</volume>, <fpage>89</fpage>&#x2013;<lpage>187</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0074-7696(03)30003-8</pub-id>
</citation>
</ref>
<ref id="B25">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gao</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ge</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Jiang</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2015</year>). <article-title>Tumor necrosis factor-related apoptosis-inducing ligand induces the expression of proinflammatory cytokines in macrophages and re-educates tumor-associated macrophages to an antitumor phenotype</article-title>. <source>Mol. Biol. Cell</source> <volume>26</volume>, <fpage>3178</fpage>&#x2013;<lpage>3189</lpage>. doi: <pub-id pub-id-type="doi">10.1091/mbc.e15-04-0209</pub-id>
</citation>
</ref>
<ref id="B26">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ghelichpour</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Mirghaed</surname> <given-names>A. T.</given-names>
</name>
<name>
<surname>Hoseinifar</surname> <given-names>S. H.</given-names>
</name>
<name>
<surname>Khalili</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Yousefi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Van Doan</surname> <given-names>H.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Expression of immune, antioxidant and stress related genes in different organs of <italic>common carp</italic> exposed to indoxacarb</article-title>. <source>Aquat. Toxicol.</source> <volume>208</volume>, <fpage>208</fpage>&#x2013;<lpage>216</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aquatox.2019.01.011</pub-id>
</citation>
</ref>
<ref id="B27">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Gonzalez</surname> <given-names>R. J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>The physiology of hyper-salinity tolerance in teleost fish: a review</article-title>. <source>J. Comp. Physiol. B.</source> <volume>182</volume>, <fpage>321</fpage>&#x2013;<lpage>329</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s00360-011-0624-9</pub-id>
</citation>
</ref>
<ref id="B28">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Ham&#xe1;&#x10d;kov&#xe1;</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kouril</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Koz&#xe1;k</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Stupka</surname> <given-names>Z.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Clove oil as an anaesthetic for different freshwater fish species</article-title>. <source>Bulgarian J. Agric. Sci.</source> <volume>12</volume>, <fpage>185</fpage>&#x2013;<lpage>194</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s10695-012-9682-5</pub-id>
</citation>
</ref>
<ref id="B29">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Harl&#xe9;</surname> <given-names>G.</given-names>
</name>
<name>
<surname>Kaminski</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Dubayle</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Frippiat</surname> <given-names>J.-P.</given-names>
</name>
<name>
<surname>Ropars</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>Murine splenic b cells express corticotropin-releasing hormone receptor 2 that affect their viability during a stress response</article-title>. <source>Sci. Rep.</source> <volume>8</volume>, <fpage>143</fpage>. doi: <pub-id pub-id-type="doi">10.1038/s41598-017-18401-y</pub-id>
</citation>
</ref>
<ref id="B30">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Huising</surname> <given-names>M. O.</given-names>
</name>
<name>
<surname>Metz</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Van Schooten</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Taverne-Thiele</surname> <given-names>A. J.</given-names>
</name>
<name>
<surname>Hermsen</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Verburg-Van Kemenade</surname> <given-names>B. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2004</year>). <article-title>Structural characterisation of a cyprinid (<italic>Cyprinus carpio l.</italic>) <italic>CRH, CRH-BP</italic> and <italic>CRH-R1</italic>, and the role of these proteins in the acute stress response</article-title>. <source>J. Mol. Endocrinol.</source> <volume>32</volume>, <fpage>627</fpage>&#x2013;<lpage>648</lpage>. doi: <pub-id pub-id-type="doi">10.1677/jme.0.0320627</pub-id>
</citation>
</ref>
<ref id="B31">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Hwang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Seo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Park</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Choi</surname> <given-names>Y.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Mechanisms of salinity control in <italic>Sea bass</italic>
</article-title>. <source>Biotechnol. Bioprocess Eng.</source> <volume>23</volume>, <fpage>271</fpage>&#x2013;<lpage>277</lpage>. doi: <pub-id pub-id-type="doi">10.1007/s12257-018-0049-3</pub-id>
</citation>
</ref>
<ref id="B32">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Jumah</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>A review on the activity of Na+/K+-ATPase in branchial ionocytes and its role in salinity adaptation among diadromous species</article-title>. <source>World J. Advanced Res. Rev.</source> <volume>6</volume>, <fpage>201</fpage>&#x2013;<lpage>211</lpage>. doi: <pub-id pub-id-type="doi">10.30574/wjarr.2020.6.2.0158</pub-id>
</citation>
</ref>
<ref id="B33">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Kim</surname> <given-names>J. H.</given-names>
</name>
<name>
<surname>Kang</surname> <given-names>J. C.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Oxidative stress, neurotoxicity, and non-specific immune responses in juvenile red sea bream, <italic>Pagrus major</italic>, exposed to different waterborne selenium concentrations</article-title>. <source>Chemosphere</source> <volume>135</volume>, <fpage>46</fpage>&#x2013;<lpage>52</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.chemosphere.2015.03.062</pub-id>
</citation>
</ref>
<ref id="B34">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lee</surname> <given-names>T. H.</given-names>
</name>
<name>
<surname>Hwang</surname> <given-names>P. P.</given-names>
</name>
<name>
<surname>Shieh</surname> <given-names>Y. E.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>C. H.</given-names>
</name>
</person-group> (<year>2000</year>). <article-title>The relationship between `deep-hole&#x2019; mitochondria-rich cells and salinity adaptation in the euryhaline teleost, <italic>Oreochromis mossambicus</italic>
</article-title>. <source>Fish Physiol. Biochem.</source> <volume>23</volume>, <fpage>133</fpage>&#x2013;<lpage>140</lpage>. doi: <pub-id pub-id-type="doi">10.1023/A:1007818631917</pub-id>
</citation>
</ref>
<ref id="B35">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Li</surname> <given-names>D. Q.</given-names>
</name>
<name>
<surname>Luo</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>Z.</given-names>
</name>
<name>
<surname>Kim</surname> <given-names>H. S.</given-names>
</name>
<name>
<surname>Song</surname> <given-names>X. J.</given-names>
</name>
<name>
<surname>Pflugfelder</surname> <given-names>S. C.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>JNK and ERK MAP kinases mediate induction of IL-1beta, TNF-alpha and IL-8 following hyperosmolar stress in human limbal epithelial cells</article-title>. <source>Exp. Eye Res.</source> <volume>82</volume>, <fpage>588</fpage>&#x2013;<lpage>596</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.exer.2005.08.019</pub-id>
</citation>
</ref>
<ref id="B36">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Livak</surname> <given-names>K. J.</given-names>
</name>
<name>
<surname>Schmittgen</surname> <given-names>T. D.</given-names>
</name>
</person-group> (<year>2001</year>). <article-title>Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method</article-title>. <source>Methods</source> <volume>25</volume>, <fpage>402</fpage>&#x2013;<lpage>408</lpage>. doi: <pub-id pub-id-type="doi">10.1006/meth.2001.1262</pub-id>
</citation>
</ref>
<ref id="B37">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Lu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Liu</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2022</year>). <article-title>Effects of environmental salinity on the immune response of the coastal fish <italic>Scatophagus argus</italic> during bacterial infection</article-title>. <source>Fish Shellfish Immunol.</source> <volume>124</volume>, <fpage>401</fpage>&#x2013;<lpage>410</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.fsi.2022.04.029</pub-id>
</citation>
</ref>
<ref id="B38">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Marx</surname> <given-names>M. T. S.</given-names>
</name>
<name>
<surname>Souza</surname> <given-names>C. D. F.</given-names>
</name>
<name>
<surname>Almeida</surname> <given-names>A. P. G.</given-names>
</name>
<name>
<surname>Descovi</surname> <given-names>S. N.</given-names>
</name>
<name>
<surname>Bianchini</surname> <given-names>A. E.</given-names>
</name>
<name>
<surname>Martos-Sitcha</surname> <given-names>J. A.</given-names>
</name>
<etal/>
</person-group>. (<year>2022</year>). <article-title>Expression of ion transporters and <italic>Na<sup>+</sup>/K<sup>+</sup>-ATPase</italic> and <italic>H<sup>+</sup>-ATPase</italic> activities in the gills and kidney of silver catfish (Rhamdia quelen) exposed to different pHs</article-title>. <source>Fishes</source> <volume>7</volume>, <fpage>261</fpage>. doi: <pub-id pub-id-type="doi">10.3390/fishes7050261</pub-id>
</citation>
</ref>
<ref id="B39">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Metz</surname> <given-names>J. R.</given-names>
</name>
<name>
<surname>Huising</surname> <given-names>M. O.</given-names>
</name>
<name>
<surname>Leon</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Verburg-Van Kemenade</surname> <given-names>B. M.</given-names>
</name>
<name>
<surname>Flik</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Central and peripheral interleukin-1beta and interleukin-1 receptor I expression and their role in the acute stress response of common carp, <italic>Cyprinus carpio l</italic>
</article-title>. <source>J. Endocrinol.</source> <volume>191</volume>, <fpage>25</fpage>&#x2013;<lpage>35</lpage>. doi: <pub-id pub-id-type="doi">10.1677/joe.1.06640</pub-id>
</citation>
</ref>
<ref id="B40">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mohamed</surname> <given-names>N. A.</given-names>
</name>
<name>
<surname>Saad</surname> <given-names>M. F.</given-names>
</name>
<name>
<surname>Shukry</surname> <given-names>M.</given-names>
</name>
<name>
<surname>El-Keredy</surname> <given-names>A. M. S.</given-names>
</name>
<name>
<surname>Nasif</surname> <given-names>O.</given-names>
</name>
<name>
<surname>Van Doan</surname> <given-names>H.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Physiological and ion changes of Nile tilapia (<italic>Oreochromis niloticus)</italic> under the effect of salinity stress</article-title>. <source>Aquac. Rep.</source> <volume>19</volume>, <fpage>100567</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aqrep.2020.100567</pub-id>
</citation>
</ref>
<ref id="B41">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Mr&#xe1;z</surname> <given-names>J.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Lipids in common carp (<italic>Cyprinus carpio</italic>) and effects on human health</article-title>. <source>Doctoral Thesis</source> (Uppsala:<publisher-name>Swedish University of Agricultural Sciences</publisher-name>) <fpage>36</fpage>.</citation>
</ref>
<ref id="B42">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Paumard</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Vaillier</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Coulary</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Schaeffer</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Soubannier</surname> <given-names>V.</given-names>
</name>
<name>
<surname>Mueller</surname> <given-names>D. M.</given-names>
</name>
<etal/>
</person-group>. (<year>2002</year>). <article-title>The ATP synthase is involved in generating mitochondrial cristae morphology</article-title>. <source>EMBO J.</source> <volume>21</volume>, <fpage>221</fpage>&#x2013;<lpage>230</lpage>. doi: <pub-id pub-id-type="doi">10.1093/emboj/21.3.221</pub-id>
</citation>
</ref>
<ref id="B43">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Perry</surname> <given-names>S. F.</given-names>
</name>
</person-group> (<year>1997</year>). <article-title>The chloride cell: structure and function in the gills of freshwater fishes</article-title>. <source>Annu. Rev. Physiol.</source> <volume>59</volume>, <fpage>325</fpage>&#x2013;<lpage>347</lpage>. doi: <pub-id pub-id-type="doi">10.1146/annurev.physiol.59.1.325</pub-id>
</citation>
</ref>
<ref id="B44">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saeij</surname> <given-names>J. P. J.</given-names>
</name>
<name>
<surname>Van Muiswinkel</surname> <given-names>W. B.</given-names>
</name>
<name>
<surname>Van De Meent</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Amaral</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Wiegertjes</surname> <given-names>G. F.</given-names>
</name>
</person-group> (<year>2003</year>). <article-title>Different capacities of carp leukocytes to encounter nitric oxide-mediated stress: a role for the intracellular reduced glutathione pool</article-title>. <source>Dev. Comp. Immunol.</source> <volume>27</volume>, <fpage>555</fpage>&#x2013;<lpage>568</lpage>. doi: <pub-id pub-id-type="doi">10.1016/S0145-305X(02)00158-1</pub-id>
</citation>
</ref>
<ref id="B45">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Salati</surname> <given-names>A. P.</given-names>
</name>
<name>
<surname>Baghbanzadeh</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Soltani</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Peyghan</surname> <given-names>R.</given-names>
</name>
<name>
<surname>Riazi</surname> <given-names>G.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Effect of different levels of salinity on gill and kidney function in common carp <italic>Cyprinus carpio</italic> (Pisces: cyprinidae)</article-title>. <source>Ital. J. Zool.</source> <volume>78</volume>, <fpage>298</fpage>&#x2013;<lpage>303</lpage>. doi: <pub-id pub-id-type="doi">10.1080/11250003.2011.567400</pub-id>
</citation>
</ref>
<ref id="B46">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sangiao-Alvarellos</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Arjona</surname> <given-names>F. J.</given-names>
</name>
<name>
<surname>M&#xed;guez</surname> <given-names>J. M.</given-names>
</name>
<name>
<surname>Del R&#xed;o</surname> <given-names>M. P. M.</given-names>
</name>
<name>
<surname>Soengas</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Mancera</surname> <given-names>J. M.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Growth hormone and prolactin actions on osmoregulation and energy metabolism of gilthead sea bream (Sparus auratus)</article-title>. <source>Comp. Biochem. Physiol. Part A.: Mol. Integr. Physiol.</source> <volume>144</volume>, <fpage>491</fpage>&#x2013;<lpage>500</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.cbpa.2006.04.015</pub-id>
</citation>
</ref>
<ref id="B47">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Saurabh</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Sahoo</surname> <given-names>P. K.</given-names>
</name>
</person-group> (<year>2008</year>). <article-title>Lysozyme: an important defence molecule of fish innate immune system</article-title>. <source>Aquac. Res.</source> <volume>39</volume>, <fpage>223</fpage>&#x2013;<lpage>239</lpage>. doi: <pub-id pub-id-type="doi">10.1111/j.1365-2109.2007.01883.x</pub-id>
</citation>
</ref>
<ref id="B48">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schmitz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ziv</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Admon</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Baekelandt</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Mandiki</surname> <given-names>S. N.</given-names>
</name>
<name>
<surname>L&#x2019;hoir</surname> <given-names>M.</given-names>
</name>
<etal/>
</person-group>. (<year>2017</year>). <article-title>Salinity stress, enhancing basal and induced immune responses in striped catfish pangasianodon hypophthalmus (Sauvage)</article-title>. <source>J. Proteomics</source> <volume>167</volume>, <fpage>12</fpage>&#x2013;<lpage>24</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.jprot.2017.08.005</pub-id>
</citation>
</ref>
<ref id="B49">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Schyth</surname> <given-names>B. D.</given-names>
</name>
<name>
<surname>Lorenzen</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Pedersen</surname> <given-names>F. S.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Antiviral activity of small interfering RNAs: specificity testing using heterologous virus reveals interferon-related effects overlooked by conventional mismatch controls</article-title>. <source>Virology</source> <volume>349</volume>, <fpage>134</fpage>&#x2013;<lpage>141</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.virol.2006.01.009</pub-id>
</citation>
</ref>
<ref id="B50">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sharma</surname> <given-names>K.</given-names>
</name>
<name>
<surname>Dey</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Choudhary</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Mohanty</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Kumar</surname> <given-names>T.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Effect of salinity on growth, survival and biochemical alterations in the freshwater fish <italic>Labeo rohita</italic> (Hamilton 1822)</article-title>. <source>Indian J. Fish.</source> <volume>67</volume> (<issue>2</issue>), <page-range>41&#x2013;47</page-range>. doi: <pub-id pub-id-type="doi">10.21077/ijf.2019.67.2.86894-06</pub-id>
</citation>
</ref>
<ref id="B51">
<citation citation-type="book">
<person-group person-group-type="author">
<name>
<surname>Sopinka</surname> <given-names>N. M.</given-names>
</name>
<name>
<surname>Donaldson</surname> <given-names>M. R.</given-names>
</name>
<name>
<surname>O&#x2019;connor</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Suski</surname> <given-names>C. D.</given-names>
</name>
<name>
<surname>Cooke</surname> <given-names>S. J.</given-names>
</name>
</person-group> (<year>2016</year>). &#x201c;<article-title>Stress indicators in fish</article-title>,&#x201d; in <source>Fish physiology</source> (<publisher-loc>United Kingdom</publisher-loc>: <publisher-name>Elsevier</publisher-name>), <fpage>405</fpage>&#x2013;<lpage>462</lpage>.</citation>
</ref>
<ref id="B52">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Sunarto</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Mccoll</surname> <given-names>K. A.</given-names>
</name>
</person-group> (<year>2015</year>). <article-title>Expression of immune-related genes of common carp during cyprinid herpesvirus 3 infection</article-title>. <source>Dis. Aquat. organisms</source> <volume>113</volume>, <fpage>127</fpage>&#x2013;<lpage>135</lpage>. doi: <pub-id pub-id-type="doi">10.3354/dao02824</pub-id>
</citation>
</ref>
<ref id="B53">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Takvam</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Wood</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Kryvi</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Nilsen</surname> <given-names>T. O.</given-names>
</name>
</person-group> (<year>2021</year>). <article-title>Ion transporters and osmoregulation in the kidney of teleost fishes as a function of salinity</article-title>. <source>Front. Physiol</source>. <volume>12</volume>, <elocation-id>664588</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fphys.2021.664588</pub-id>
</citation>
</ref>
<ref id="B54">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tang</surname> <given-names>C.-H.</given-names>
</name>
<name>
<surname>Lai</surname> <given-names>D.-Y.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>T.-H.</given-names>
</name>
</person-group> (<year>2012</year>). <article-title>Effects of salinity acclimation on <italic>Na<sup>+</sup>/K<sup>+</sup>-ATPase</italic> responses and FXYD11 expression in the gills and kidneys of the Japanese eel <italic>(Anguilla japonica</italic>)</article-title>. <source>Comp. Biochem. Physiol. Part A. Mol. Integr. Physiol.</source> <volume>163</volume>, <fpage>302</fpage>&#x2013;<lpage>310</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.cbpa.2012.07.017</pub-id>
</citation>
</ref>
<ref id="B55">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tapia-Paniagua</surname> <given-names>S. T.</given-names>
</name>
<name>
<surname>Reyes-Becerril</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Ascencio-Valle</surname> <given-names>F. D. J.</given-names>
</name>
<name>
<surname>Esteban</surname> <given-names>M. &#xc1;.</given-names>
</name>
<name>
<surname>Clavijo</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Balebona</surname> <given-names>S. C.</given-names>
</name>
<etal/>
</person-group>. (<year>2011</year>). <article-title>Modulation of the intestinal microbiota and immune system of farmed sparus aurata by the administration of the yeast debaryomyces hansenii L2 in conjunction with inulin</article-title>. <source>J. Aquac. Res. Dev.</source> <volume>2011</volume>, <fpage>1</fpage>&#x2013;<lpage>12</lpage>. doi: <pub-id pub-id-type="doi">10.4172/2155-9546.S1-012</pub-id>
</citation>
</ref>
<ref id="B56">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Tort</surname> <given-names>L.</given-names>
</name>
</person-group> (<year>2011</year>). <article-title>Stress and immune modulation in fish</article-title>. <source>Dev. Comp. Immunol.</source> <volume>35</volume>, <fpage>1366</fpage>&#x2013;<lpage>1375</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.dci.2011.07.002</pub-id>
</citation>
</ref>
<ref id="B57">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Van Itallie</surname> <given-names>C. M.</given-names>
</name>
<name>
<surname>Holmes</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Bridges</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Gookin</surname> <given-names>J. L.</given-names>
</name>
<name>
<surname>Coccaro</surname> <given-names>M. R.</given-names>
</name>
<name>
<surname>Proctor</surname> <given-names>W.</given-names>
</name>
<etal/>
</person-group>. (<year>2008</year>). <article-title>The density of small tight junction pores varies among cell types and is increased by expression of claudin-2</article-title>. <source>J. Cell Sci.</source> <volume>121</volume>, <fpage>298</fpage>&#x2013;<lpage>305</lpage>. doi: <pub-id pub-id-type="doi">10.1242/jcs.021485</pub-id>
</citation>
</ref>
<ref id="B58">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Velasco</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Guti&#xe9;rrez-C&#xe1;novas</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Botella-Cruz</surname> <given-names>M.</given-names>
</name>
<name>
<surname>S&#xe1;nchez-Fern&#xe1;ndez</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Arribas</surname> <given-names>P.</given-names>
</name>
<name>
<surname>Carbonell</surname> <given-names>J.</given-names>
</name>
<etal/>
</person-group>. (<year>2019</year>). <article-title>Effects of salinity changes on aquatic organisms in a multiple stressor context</article-title>. <source>Philos. Trans. R. Soc. B. Biol. Sci.</source> <volume>374</volume>, <fpage>20180011</fpage>. doi: <pub-id pub-id-type="doi">10.1098/rstb.2018.0011</pub-id>
</citation>
</ref>
<ref id="B59">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>W.</given-names>
</name>
<name>
<surname>Zha</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Guo</surname> <given-names>H.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>D.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>L.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Persistent exposure to environmental levels of microcystin-LR disturbs cortisol production <italic>via</italic> hypothalamic-Pituitary-Interrenal (HPI) axis and subsequently liver glucose metabolism in adult Male zebrafish (<italic>Danio rerio</italic>)</article-title>. <source>Toxins (Basel)</source> <volume>12</volume> (<issue>5</issue>), <fpage>282</fpage>. doi: <pub-id pub-id-type="doi">10.3390/toxins12050282</pub-id>
</citation>
</ref>
<ref id="B60">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Ren</surname> <given-names>Q.</given-names>
</name>
<name>
<surname>Yin</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Liang</surname> <given-names>F.</given-names>
</name>
<name>
<surname>Jia</surname> <given-names>Y.</given-names>
</name>
</person-group> (<year>2016</year>). <article-title>Two superoxide dismutases (<italic>SODs</italic>) respond to bacterial challenge identified in the marbled eel <italic>Anguilla marmorata</italic>
</article-title>. <source>Aquaculture</source> <volume>451</volume>, <fpage>316</fpage>&#x2013;<lpage>325</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aquaculture.2015.09.025</pub-id>
</citation>
</ref>
<ref id="B61">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Wang</surname> <given-names>P. J.</given-names>
</name>
<name>
<surname>Yang</surname> <given-names>W. K.</given-names>
</name>
<name>
<surname>Lin</surname> <given-names>C. H.</given-names>
</name>
<name>
<surname>Hwang</surname> <given-names>H. H.</given-names>
</name>
<name>
<surname>Lee</surname> <given-names>T. H.</given-names>
</name>
</person-group> (<year>2017</year>). <article-title>FXYD8, a novel regulator of renal Na(+)/K(+)-ATPase in the euryhaline teleost, <italic>Tetraodon nigroviridis</italic>
</article-title>. <source>Front. Physiol.</source> <volume>8</volume>, <elocation-id>576</elocation-id>. doi: <pub-id pub-id-type="doi">10.3389/fphys.2017.00576</pub-id>
</citation>
</ref>
<ref id="B62">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xavier</surname> <given-names>W. D. S.</given-names>
</name>
<name>
<surname>Leclercq</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Carvalho</surname> <given-names>P. L. P. F.</given-names>
</name>
<name>
<surname>Vicente</surname> <given-names>I. S. T.</given-names>
</name>
<name>
<surname>Guimar&#xe3;es</surname> <given-names>M. G.</given-names>
</name>
<name>
<surname>Rodrigues</surname> <given-names>E. J. D.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>The putative effect of a <italic>SOD</italic>-rich melon pulp-concentrate on growth performance and antioxidant status of Nile tilapia (<italic>Oreochromis niloticus</italic>) under heat/dissolved oxygen-induced stress</article-title>. <source>Aquaculture</source> <volume>529</volume>, <fpage>735669</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aquaculture.2020.735669</pub-id>
</citation>
</ref>
<ref id="B63">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>E.</given-names>
</name>
<name>
<surname>Suo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Su</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Lu</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Zhao</surname> <given-names>Q.</given-names>
</name>
<etal/>
</person-group>. (<year>2018</year>). <article-title>Histological and transcriptomic responses of two immune organs, the spleen and head kidney, in Nile tilapia (<italic>Oreochromis niloticus</italic>) to long-term hypersaline stress</article-title>. <source>Fish Shellfish Immunol.</source> <volume>76</volume>, <fpage>48</fpage>&#x2013;<lpage>57</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.fsi.2018.02.041</pub-id>
</citation>
</ref>
<ref id="B64">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Xu</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Suo</surname> <given-names>Y.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>J. G.</given-names>
</name>
<name>
<surname>Chen</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Li</surname> <given-names>E.</given-names>
</name>
</person-group> (<year>2020</year>). <article-title>Recovery from hypersaline-Stress-Induced immunity damage and intestinal-microbiota changes through dietary &#x3b2;-glucan supplementation in Nile tilapia (<italic>Oreochromis niloticus</italic>)</article-title>. <source>Animals: an Open Access J. MDPI</source> <volume>10</volume>, <fpage>2243</fpage>. doi: <pub-id pub-id-type="doi">10.3390/ani10122243</pub-id>
</citation>
</ref>
<ref id="B65">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Yahfoufi</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Alsadi</surname> <given-names>N.</given-names>
</name>
<name>
<surname>Jambi</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Matar</surname> <given-names>C.</given-names>
</name>
</person-group> (<year>2018</year>). <article-title>The immunomodulatory and anti-inflammatory role of polyphenols</article-title>. <source>Nutrients</source> <volume>10</volume>, <fpage>1618</fpage>. doi: <pub-id pub-id-type="doi">10.3390/nu10111618</pub-id>
</citation>
</ref>
<ref id="B66">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zapata</surname> <given-names>A.</given-names>
</name>
<name>
<surname>Diez</surname> <given-names>B.</given-names>
</name>
<name>
<surname>Cejalvo</surname> <given-names>T.</given-names>
</name>
<name>
<surname>Guti&#xe9;rrez-De Fr&#xed;as</surname> <given-names>C.</given-names>
</name>
<name>
<surname>Cort&#xe9;s</surname> <given-names>A.</given-names>
</name>
</person-group> (<year>2006</year>). <article-title>Ontogeny of the immune system of fish</article-title>. <source>Fish Shellfish Immunol.</source> <volume>20</volume>, <fpage>126</fpage>&#x2013;<lpage>136</lpage>. doi: <pub-id pub-id-type="doi">10.1016/j.fsi.2004.09.005</pub-id>
</citation>
</ref>
<ref id="B67">
<citation citation-type="journal">
<person-group person-group-type="author">
<name>
<surname>Zhou</surname> <given-names>L.</given-names>
</name>
<name>
<surname>Zhang</surname> <given-names>J.</given-names>
</name>
<name>
<surname>Yan</surname> <given-names>M.</given-names>
</name>
<name>
<surname>Tang</surname> <given-names>S.</given-names>
</name>
<name>
<surname>Wang</surname> <given-names>X.</given-names>
</name>
<name>
<surname>Qin</surname> <given-names>J. G.</given-names>
</name>
<etal/>
</person-group>. (<year>2020</year>). <article-title>Inulin alleviates hypersaline-stress induced oxidative stress and dysbiosis of gut microbiota in Nile tilapia (<italic>Oreochromis niloticus</italic>)</article-title>. <source>Aquaculture</source> <volume>529</volume>, <fpage>735681</fpage>. doi: <pub-id pub-id-type="doi">10.1016/j.aquaculture.2020.735681</pub-id>
</citation>
</ref>
</ref-list>
</back>
</article>